Construction and application of second-generation probiotic saccharomyces cerevisiae boulardii for resisting porcine epidemic diarrhea virus

Abstract

The invention discloses construction and application of second-generation probiotic saccharomyces cerevisiae boulardii for resisting porcine epidemic diarrhea viruses, and belongs to the field of biomedicine.The construction method of the second-generation probiotic saccharomyces cerevisiae boulardii comprises the steps that the second-generation probiotic saccharomyces cerevisiae boulardii is electrically transformed into escherichia coli DH5alpha competent cells, then bacterial colony PCR identification is carried out, and the second-generation probiotic saccharomyces cerevisiae boulardii is obtained. Carrying out target gene fragment sequencing on the PCR amplification product which is detected to be positive, and verifying whether the PCR amplification product is correct or not; culturing the escherichia coli transformant which is verified to be correct, extracting plasmids, and carrying out yeast competent transformation; and carrying out sequencing identification on a PCR amplification product which is detected to be positive through PCR so as to screen out the yeast strain which is correctly transformed and has no error in target gene sequence. The compound disclosed by the invention has extremely high inhibition efficiency on the PEDV virus.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to the construction and application of a second-generation probiotic boulardii yeast strain resistant to porcine epidemic diarrhea virus. Background Art

[0002] PEDV is a coronavirus that causes porcine epidemic diarrhea, an acute enteric infectious disease that seriously endangers the health of pigs. China is the world's largest pig producer and pork consumer. PEDV infection in pig farming poses a significant threat, and the resulting economic losses cannot be ignored. PEDV primarily infects the digestive tract, and the resulting intestinal damage can still affect the growth performance of pigs even after they have recovered from the infection. Currently, there are no effective pharmacological means to control PEDV, and vaccine prevention and control measures face the problems of high strain variability and prone to immune escape. Therefore, there is an urgent need to develop a new prevention and control strategy that has the dual functions of targeted resistance to PEDV infection and regulation of intestinal health. Summary of the Invention

[0003] One of the purposes of the present invention is to provide a method for constructing a second-generation probiotic Boulardii yeast that is resistant to porcine epidemic diarrhea virus, so as to solve the problem in the prior art of lacking a strain construction that has the dual functions of targeted resistance to PEDV infection and regulation of intestinal health.

[0004] The present invention is achieved through the following technical scheme, and a method for constructing a second-generation probiotic boulardii yeast resistant to porcine epidemic diarrhea virus includes the following steps: S100, electrotransformation into Escherichia coli DH5α competent cells, followed by colony PCR identification, using pSF-specific-F / R as the amplification primer, sequencing the target gene fragment of the PCR amplification product that is positive after detection to verify whether it is correct; S200, culturing the Escherichia coli transformants that are verified to be correct, extracting the plasmid, and performing yeast competent transformation; S300, sequencing and identifying the PCR amplification product that is positive after PCR detection, thereby screening out yeast strains that have completed correct transformation and have a correct target gene sequence.

[0005] Furthermore, the amplification primers for pSF-specific-F / R include:

[0006] pSF-specific-F: CATATCACATAGGAAGCAACAG.

[0007] pSF-specific-R:CTACGATACCGATAGAGATGG.

[0008] GRFT-seq-F:GCTTCCGAGCTCTCGAATTCATG.

[0009] GRFT-seq-R: ATCAGTCAGTCAGTGCAGGAGGA.

[0010] Furthermore, the state transformation includes the following sub-steps: S210, electroporation parameters: voltage = 1.5-2.5 KV, Ω = 200 Ω, 25 μFD; colony PCR primer sequences are as shown in pSF-specific-F and pSF-specific-R; S220, colony PCR reaction system is: 2× high-fidelity PCR Mix premix, 25 μL; DNA template, picking a single colony; pSF-specificF (10 μmol / L), 2 μL; pSF-specific R (10 μmol / L), 2 μL; ddH2O, make up to 50 μL; S230, colony PCR conditions are: 95 ℃ pre-denaturation, 3 min; 95 ℃ denaturation, 15 sec; 53 ℃ annealing, 15 sec; 72 ℃ extension 30-60 sec / kb, 30 sec (denaturation-annealing-extension performed 35 cycles); 72 ℃ extension, 5 min.

[0011] Furthermore, the primer sequences for sequencing identification include:

[0012] GRFT-seq-F:GCTTCCGAGCTCTCGAATTCATG.

[0013] GRFT-seq-R: ATCAGTCAGTCAGTGCAGGAGGA.

[0014] Another aspect of the present invention provides an application of a second-generation probiotic Saccharomyces boulardii strain resistant to porcine epidemic diarrhea virus. The second-generation probiotic Saccharomyces boulardii strain is obtained according to the construction method described above, and is used in the application of the strain to resist porcine epidemic diarrhea virus.

[0015] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0016] 1. The second-generation probiotic Saccharomyces boulardii strain constructed in the present invention can achieve extracellular secretory expression of the natural active protein GRFT and maintain antiviral activity. After cultivation, a GRFT yield of 1.13 mg / mL can be achieved.

[0017] 2. The second-generation probiotic Boulardii yeast constructed by the present invention, which is resistant to porcine epidemic diarrhea virus, has a maximum non-toxic dose of 10^6 CFU / mL, which can maintain the active number of yeast to the greatest extent without causing toxicity to the test cells; it has extremely high inhibitory efficiency against PEDV virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The drawings described herein are used to provide a further understanding of the embodiments of the present invention, constitute a part of this application, and do not constitute a limitation of the embodiments of the present invention. In the drawings:

[0019] Figure 1 This is a diagram of the construction strategy of the recombinant plasmid provided in Example 4 of the present invention.

[0020] Figure 2 This is a diagram of the PCR amplification products provided in Example 4 of the present invention.

[0021] Figure 3 This is the electrophoresis gel imaging diagram provided by Example 5 of the present invention.

[0022] Figure 4 This is the chemiluminescence image provided by Example 6 of the present invention.

[0023] Figure 5 This is a graph showing the use of the CCK-8 method to detect cell viability and calculate virus inhibition rate, as provided in Example 6 of the present invention. DETAILED DESCRIPTION

[0024] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments.

[0025] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention pertains. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of this invention. All references mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related thereto. In the event of a conflict with any incorporated reference, the present specification controls. As used herein, the terms "including," "comprising," "having," "containing," and the like are open-ended, meaning to include, but not be limited to, the terms "a," "an," and "an" include plural references unless the context clearly indicates otherwise. It should be noted that the terms "first," "second," and the like are used solely for convenience of description and distinction and are not to be construed as indicating or implying relative importance. As used herein, the term "about" refers to a range of ±20% of the value that follows it. In some embodiments, the term "about" refers to a range of ±10% of the value that follows it. In some embodiments, the term "about" refers to a range of ±5% of the value that follows it.

[0026] Example 1

[0027] This embodiment discloses a method for constructing a second-generation probiotic Saccharomyces boulardii strain resistant to porcine epidemic diarrhea virus, the construction method comprising the following steps:

[0028] Step 1: Electrotransform into E. coli DH5α competent cells, and then perform colony PCR identification. The amplification primers are pSF-specific-F / R. The PCR amplification products that test positive are sequenced for the target gene fragment to verify whether they are correct.

[0029] Specifically, sequencing primers may include:

[0030] pSF-specific-F: CATATCACATAGGAAGCAACAG;

[0031] pSF-specific-R:CTACGATACCGATAGAGATGG;

[0032] GRFT-seq-F:GCTTCCGAGCTCTCGAATTCATG;

[0033] GRFT-seq-R: ATCAGTCAGTCAGTGCAGGAGGA.

[0034] Step 2: Cultivate the E. coli transformants verified to be correct, extract the plasmid, and perform yeast competent transformation.

[0035] Specifically, the conversion methods include:

[0036] 1) Electroporation parameters: voltage = 1.5-2.5 kV, Ω = 200 Ω, 25 μFD.

[0037] The sequences of colony PCR primers are shown as pSF-specific-F and pSF-specific-R.

[0038] 2) The reaction system for colony PCR is:

[0039] 2× High-Fidelity PCR Mix, 25 µL; DNA template, pick a single colony; pSF-specific F (10 µmol / L), 2 µL; pSF-specific R (10 µmol / L), 2 µL; ddH2O, make up to 50 µL.

[0040] 3) Colony PCR conditions are:

[0041] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec; annealing at 53°C for 15 sec; extension at 72°C for 30-60 sec / kb for 30 sec (35 cycles of denaturation-annealing-extension); extension at 72°C for 5 min.

[0042] Step 3: The PCR amplification products that test positive by PCR are sequenced and identified to screen out yeast strains that have completed correct transformation and have the correct target gene sequence for use in subsequent steps.

[0043] Specifically, sequencing primer sequences may include:

[0044] GRFT-seq-F:GCTTCCGAGCTCTCGAATTCATG;

[0045] GRFT-seq-R: ATCAGTCAGTCAGTGCAGGAGGA.

[0046] Example 2

[0047] The yeast strain obtained by screening using the method described in Example 1 was inoculated into SD-URA3 nutrient-deficient medium and cultured with shaking for 72 hours. The supernatant was collected and used to identify protein secretory expression. The supernatant of wild-type probiotic Saccharomyces boulardii and that of Saccharomyces boulardii transformed with an empty vector served as controls. Secretory expression was identified by SDS-PAGE and Western blot.

[0048] In this embodiment, the specific identification steps include:

[0049] Step 1: Prepare BCA standard: dilute 10 µL of 5 mg / mL BSA standard to 100 µL with PBS to a final concentration of 0.5 mg / mL.

[0050] Prepare BCA working solution: add 1 volume of Cu reagent to 50 volumes of BCA reagent (50:1) to make BCA working solution and stabilize it for 24 hours.

[0051] The sample to be tested was diluted 2-fold, 4-fold, 8-fold, and 16-fold; after mixing according to the proportion, the OD562 value was measured with a microplate reader, and the protein concentration was calculated according to the standard curve.

[0052] Step 2: Preparation of SDS-PAGE and relative quantification.

[0053] Gel preparation: BeyoGel Plus PAGE precast gel (Tris-Glycine, 15%, 10 wells);

[0054] Sample loading: 6 μL;

[0055] Electrophoresis: 180 V, 45 min;

[0056] Staining: decolorize after 3-5 hours;

[0057] Imaging: Imaging the destained electrophoresis gel, collecting and saving the image ( Figure 3 Lane 1 is the second-generation probiotic Saccharomyces boulardii, lane 2 is the empty vector control, lane 3 is the wild-type yeast control, and lane 4 is the electrophoresis molecular weight standard);

[0058] Relative quantification: The acquired images were imported into Quantity One (Bio-Rad Laboratories, USA) for grayscale analysis. Using different concentrations of GRFT standard protein (0.1 µg / µL, 0.2 µg / µL, 0.3 µg / µL, 0.4 µg / µL, and 0.5 µg / µL) performed under the same electrophoresis conditions as a benchmark, a concentration-grayscale curve was constructed, and the grayscale value of the target band was substituted into the curve to calculate its relative concentration.

[0059] Step 3: Electrophoresis: Same as SDS-PAGE, without staining;

[0060] Transfer: constant voltage 100 V, transfer for 35 min;

[0061] Blocking: Block with blocking solution at room temperature for 2 h;

[0062] Add primary antibody: GRFT-specific antibody diluted 1:2000, overnight at 4°C;

[0063] Add secondary antibody: 1:1000 dilution of HRP horseradish enzyme-labeled goat anti-rabbit antibody, incubate at 37 °C for 1 h;

[0064] Chemiluminescence: Add equal volumes of ECL luminescent solution A and solution B to the membrane surface for imaging and image acquisition ( Figure 4 , lane 1 is the second-generation probiotic Saccharomyces boulardii, lane 2 is the empty vector control, and lane 3 is the wild-type yeast control).

[0065] Example 3

[0066] The yeast strain screened by the method in Example 2 was used to inhibit porcine epidemic diarrhea virus.

[0067] Example 4

[0068] This example provides a gene cloning construction strategy and screening method for the second-generation probiotic Saccharomyces boulardii.

[0069] The strategy for constructing recombinant plasmids is shown in Figure 1The constructed recombinant plasmid pSF-TEF1-αMF-GRFT-URA3 was first electroporated into Escherichia coli DH5α competent cells, and then identified by colony PCR. The amplification primers were pSF-specific-F / R (SEQ ID NO. 5, SEQ ID NO. 6). The PCR amplification products that tested positive were sequenced for the target gene fragment (sequencing primers were GRFT-seq-F / R, SEQ ID NO. 7, SEQ ID NO. 8) to verify whether they were correct.

[0070] The primer names and sequences are as follows:

[0071] pSF-specific-F: CATATCACATAGGAAGCAACAG (SEQ ID NO.5)

[0072] pSF-specific-R:CTACGATACCGATAGAGATGG (SEQ ID NO.6)

[0073] GRFT-seq-F:GCTTCCGAGCTCTCGAATTCATG (SEQ ID NO.7)

[0074] GRFT-seq-R: ATCAGTCAGTCAGTGCAGGAGGA (SEQ ID NO.8)

[0075] After culturing the above-verified E. coli transformants, the plasmids were extracted and transformed into yeast competent cells. The transformation method is as follows:

[0076] Electroporation parameters:

[0077] Voltage = 1.5-2.5 kV, Ω = 200 Ω, 25 μFD

[0078] The sequences of the colony PCR primers are as described in SEQ ID NO.5 and SEQ ID NO.6.

[0079] Colony PCR reaction system:

[0080] 2× High-Fidelity PCR Mix, 25 µL; DNA template, pick a single colony; pSF-specific F (10 µmol / L), 2 µL; pSF-specific R (10 µmol / L), 2 µL; ddH2O, make up to 50 µL.

[0081] Colony PCR conditions:

[0082] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec; annealing at 53°C for 15 sec; extension at 72°C for 30-60 sec / kb for 30 sec (35 cycles of denaturation-annealing-extension); extension at 72°C for 5 min.

[0083] The PCR amplification products that were positive by PCR detection ( Figure 2 , positive transformants were 1349 bp) and sequenced using primers as described in SEQ ID NOs. 7 and 8. Yeast strains that were correctly transformed and had the correct target gene sequence were selected for subsequent steps.

[0084] Example 5

[0085] A single colony of the second-generation probiotic Saccharomyces boulardii constructed in Example 4 was inoculated into SD-URA3 nutrient-deficient medium and cultured with shaking for 72 hours. The supernatant was collected and used to identify protein secretory expression. The supernatant of wild-type probiotic Saccharomyces boulardii and that of Saccharomyces boulardii transformed with an empty vector served as controls. Secretory expression was identified by SDS-PAGE and Western blot.

[0086] The specific identification steps are:

[0087] BCA method for protein concentration

[0088] BCA standard: dilute 10 µL of 5 mg / mL BSA standard to 100 µL with PBS to a final concentration of 0.5 mg / mL.

[0089] BCA working solution: 50 volumes of BCA reagent plus 1 volume of Cu reagent (50:1) are prepared to make BCA working solution and stabilize for 24 hours;

[0090] Samples to be tested: dilute 2-fold, 4-fold, 8-fold, and 16-fold;

[0091] After mixing according to the proportion, the OD was measured using a microplate reader. 562 The protein concentration was calculated based on the standard curve.

[0092] SDS-PAGE and relative quantification

[0093] Gel preparation: BeyoGel Plus PAGE precast gel (Tris-Glycine, 15%, 10 wells);

[0094] Sample loading: 6 μL;

[0095] Electrophoresis: 180 V, 45 min;

[0096] Staining: decolorize after 3-5 hours;

[0097] Imaging: Imaging the destained electrophoresis gel, collecting and saving the image ( Figure 3 Lane 1 is the second-generation probiotic Saccharomyces boulardii, lane 2 is the empty vector control, lane 3 is the wild-type yeast control, and lane 4 is the electrophoresis molecular weight standard);

[0098] Relative quantification: The acquired images were imported into Quantity One (Bio-Rad Laboratories, USA) for grayscale analysis. Using different concentrations of GRFT standard protein (0.1 µg / µL, 0.2 µg / µL, 0.3 µg / µL, 0.4 µg / µL, and 0.5 µg / µL) performed under the same electrophoresis conditions as a benchmark, a concentration-grayscale curve was constructed, and the grayscale value of the target band was substituted into the curve to calculate its relative concentration.

[0099] Western blot

[0100] Electrophoresis: Same as SDS-PAGE, without staining;

[0101] Transfer: constant voltage 100 V, transfer for 35 min;

[0102] Blocking: Block with blocking solution at room temperature for 2 h;

[0103] Add primary antibody: GRFT-specific antibody diluted 1:2000, overnight at 4°C;

[0104] Add secondary antibody: 1:1000 dilution of HRP horseradish enzyme-labeled goat anti-rabbit antibody, incubate at 37 °C for 1 h;

[0105] Chemiluminescence: Add equal volumes of ECL luminescent solution A and solution B to the membrane surface for imaging and image acquisition ( Figure 4 , lane 1 is the second-generation probiotic Saccharomyces boulardii, lane 2 is the empty vector control, and lane 3 is the wild-type yeast control).

[0106] Example 6

[0107] Construction of porcine epidemic diarrhea virus infection model

[0108] Vero cells were revived in DMEM complete medium supplemented with 10% fetal bovine serum. PEDV virus solution containing 5 μg / mL trypsin was then inoculated onto a 90% confluent, uniformly growing monolayer of Vero cells. The cells were cultured at 37°C in a 5% CO2 incubator. Cytopathic effects were observed and recorded under an inverted microscope to confirm the establishment of the viral infection model.

[0109] Maximum non-toxic dose of the second-generation probiotic Saccharomyces boulardii

[0110] Second-generation probiotic Saccharomyces boulardii was cultured to 10^8 CFU / mL and serially diluted 10-fold in DMEM basal medium to prepare gradient samples. Different dilutions of the bacterial solution were added to a confluent 96-well plate and incubated for 48 hours at 37°C in a 5% CO2 incubator. The cells were then washed three times with prewarmed phosphate-buffered saline (PBS) and replaced with serum-free DMEM medium for continued culture. A virus-challenged group (PEDV inoculated) and a blank control group (medium alone) were set up. Cytopathic effects were monitored dynamically under a microscope. When cells in the virus control group exhibited typical lesions, CCK-8 assays were performed using a CCK-8 assay. 10 μL of CCK-8 solution was added to each well. After incubation in the dark for 2 hours, the optical density (OD) at 450 nm was measured using a microplate reader. Wells containing only DMEM medium and CCK-8 reagent served as blank calibration groups. The maximum nontoxic dose of the yeast sample was calculated by calculating cell viability.

[0111] Inhibition rate of the second-generation probiotic Saccharomyces boulardii against porcine epidemic diarrhea virus

[0112] The maximum non-toxic dose of the second-generation probiotic Boulardii yeast suspension (100 μL) was mixed with an equal volume of PEDV virus liquid and pre-incubated at 37°C for 90 minutes to achieve virus-probiotic interaction. 100 μL of the above mixture was inoculated into a monolayer of Vero cells and placed in a 5% CO2 incubator for adsorption infection for 90 minutes. The culture supernatant was removed and replaced with a cell maintenance medium containing 2% fetal bovine serum for continued culture. The experiment simultaneously set up a virus control group (an equal volume of PEDV virus liquid mixed with cell culture medium) and a normal cell control group (normal cultured cells not infected with the virus). The process of cell pathology was continuously observed. When the cell pathology rate of the virus control group reached 80%, the cell survival rate was detected by CCK-8 method to calculate the virus inhibition rate ( Figure 5 ). Virus inhibition rate% = (OD of probiotics treatment group 450 -OD of virus control group 450 ) / (OD of normal cell control group 450 -OD of virus control group 450 ) 100%.

[0113] Sequence Listing

[0114] SEQ ID NO.1: Codon-optimized GRFT gene sequence, including the start codon and the stop codon

[0115] ATGTCTTTGACCCACAGAAAGTTCGGTGGTAGTGGTGGTTCTCCATTCTCTGGTTTGTCTTCTATTGCTGTCCGTAGCGGCTCTTACTTGGATGCTATTATTATTGACGGTGTCCATCACGGTGGTTCCGGTGGTAACTTGTCCCCAACTTTCACCTTTGGTTCAGGTGAATACATTTCCAATATGACTATCAGATCTGGTGACTACATCGACAACATCTCTTTCGAAACCAACATGGGTAGAAGATTCGGTCCATACGGTGGTTCCGGTGGTTCTGCTAACACTTTGTCCAACGTTAAGGTTATCCAAATCAACGGTTCTGCCGGTGATTACTTGGACTCCTTAGATATCTACTACGAACAATACTAA

[0116] SEQ ID NO.2: Native signal peptide α-Mating Factor of Saccharomyces boulardii, containing the start codon

[0117] ATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTTAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTTTGGATAAAAGAGAGGCTGAAGCT

[0118] SEQ ID NO.3: Native promoter TEF1 of Saccharomyces boulardii

[0119] CAATGCATACTTTGTACGTTCAAAATACAATGCAGTAGATATATTTATGCATATTACATATAATACATATCACATAGGAAGCAACAGGCGCGTTGGACTTTTAATTTTCGAGGACCGCGAATCCTTACATCACACCCAATCCCC CACAAGTGATCCCCCACACCATAGCTTCAAAATGTTTCTACTCCTTTTTTACTCTTCCAGATTTTCTCGGACTCCGCGCATCGCCGTACCACTTCAAAACACCCAAGCACAGCATACTAAATTTCCCCTCTTTCTTCCTCTAG GGTGTCGTTAATTACCCGTACTAAAGGTTTGGAAAAGAAAAAAGAGACCGCCTCGTTTCTTTTTCTTCGTCGAAAAAGGCAATAAAAATTTTTATCACGTTTCTTTTTCTTGAAAATTTTTTTTTTTGATTTTTTTCTCTTTCG ATGACCTCCATTGATATTTAAGTTAATAAAACGGTCTTCAATTTCTCAAGTTTCAGTTTCATTTTTCTTGTTCTATTACAACTTTTTTTACTTCTTGCTCATTAGAAAGAAAGCATAGCAATCTAATCTAAGTTTTAATTACAAA

[0120] SEQ ID NO.4: Gene expression cassette. The underlined sequence is the restriction endonuclease cleavage site. The bold portion is the signal peptide α-Mating Factor (including the start codon). The unmarked sequence is the codon-optimized GRFT gene sequence (including the stop codon).

[0121] GAATTCATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTTAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTTTGGATAAAAGAGAGGCTGAAGCTTCTTTGACCCACAGAAAGTTCGGTGGTAGTGGTGGTTCTCCATTCTCTGGTTTGTCTTCTATTGCTGTCCGTAGCGGCTCTTACTTGGATGCTATTATTATTGACGGTGTCCATCACGGTGGTTCCGGTGGTAACTTGTCCCCAACTTTCACCTTTGGTTCAGGTGAATACATTTCCAATATGACTATCAGATCTGGTGACTACATCGACAACATCTCTTTCGAAACCAACATGGGTAGAAGATTCGGTCCATACGGTGGTTCCGGTGGTTCTGCTAACACTTTGTCCAACGTTAAGGTTATCCAAATCAACGGTTCTGCCGGTGATTACTTGGACTCCTTAGATATCTACTACGAACAATACTAA TCTAGA

[0122] SEQ ID NO.5: Colony PCR primer pSF-specific-F

[0123] CATATCACATAGGAAGCAACAG

[0124] SEQ ID NO.6: Colony PCR primer pSF-specific-R

[0125] CTACGATACCGATAGAGATGG

[0126] SEQ ID NO.7: Sequencing primer GRFT-seq-F

[0127] GCTTCCGAGCTCTCGAATTCATG

[0128] SEQ ID NO.8: Sequencing primer GRFT-seq-R

[0129] ATCAGTCAGTCAGTGCAGGAGGA

[0130] The specific implementation methods described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific implementation method of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for constructing a second-generation probiotic boulardii yeast strain resistant to porcine epidemic diarrhea virus, characterized in that: The construction method comprises: S100, electrotransform into Escherichia coli DH5α competent cells, and then perform colony PCR identification. The amplification primers are pSF-specific-F / R. The PCR amplification products that test positive are sequenced for the target gene fragment to verify whether they are correct; S200, culturing the verified E. coli transformants, extracting the plasmids and performing yeast competent transformation; S300, sequencing and identifying the PCR amplification products that are positive by PCR detection, thereby screening out yeast strains that have completed correct transformation and have correct target gene sequences.

2. The method for constructing the second-generation probiotic boulardii yeast resistant to porcine epidemic diarrhea virus according to claim 1, characterized in that: The amplification primers are pSF-specific-F / R and include: pSF-specific-F: CATATCACATAGGAAGCAACAG; pSF-specific-R:CTACGATACCGATAGAGATGG; GRFT-seq-F:GCTTCCGAGCTCTCGAATTCATG; GRFT-seq-R: ATCAGTCAGTCAGTGCAGGAGGA.

3. The method for constructing the second-generation probiotic boulardii yeast resistant to porcine epidemic diarrhea virus according to claim 1, characterized in that: The state conversion includes the following sub-steps: S210, electroporation parameters: voltage = 1.5-2.5 kV, Ω = 200 Ω, 25 μFD; Colony PCR primer sequences are shown as pSF-specific-F and pSF-specific-R; S220, colony PCR reaction system is: 2× High-Fidelity PCR Mix, 25 µL; DNA template, pick a single colony; pSF-specific F (10 µmol / L), 2 µL; pSF-specific R (10 µmol / L), 2 µL; ddH2O, make up to 50 µL; S230, colony PCR conditions are: Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec; annealing at 53°C for 15 sec; extension at 72°C for 30-60 sec / kb for 30 sec (35 cycles of denaturation-annealing-extension); extension at 72°C for 5 min.

4. The method for constructing the second-generation probiotic Saccharomyces boulardii resistant to porcine epidemic diarrhea virus according to claim 1, characterized in that: The primer sequences for sequencing identification include: GRFT-seq-F:GCTTCCGAGCTCTCGAATTCATG; GRFT-seq-R: ATCAGTCAGTCAGTGCAGGAGGA.

5. Application of a second-generation probiotic boulardii yeast strain resistant to porcine epidemic diarrhea virus, characterized in that: The second-generation probiotic boulardii yeast is obtained according to the construction method of claims 1 to 4, and includes the following applications: Application in combating porcine epidemic diarrhea virus.

Images