Application of GmOSD1a protein and coding gene thereof in regulation and control of plant meiosis

Abstract

The invention relates to the technical field of plant genetic engineering, and discloses application of GmOSD1a protein and a coding gene thereof in regulation and control of plant meiosis. According to the invention, the GmOSD1a gene is cloned in soybean, and the gene participates in the second meiosis process and affects the normal development of gametophytes. The GmOSD1a gene is subjected to targeted editing through the CRISPR / Cas9 technology, gene resources and theoretical support are provided for heterosis fixation of soybeans through apomixis, and the GmOSD1a gene has important application value in the aspects of promoting the soybean apomixis technology and cultivating new soybean varieties.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, in particular to the application of GmOSD1a protein and its encoding gene in regulating plant meiosis. Background Art

[0002] Meiosis is a specialized division process that occurs during the formation of reproductive cells in sexually reproducing individuals. It is essential for gamete formation in eukaryotic sexual reproduction. Meiosis is divided into the first and second meiotic divisions based on changes in chromosome behavior. Each phase consists of four stages: prophase, metaphase, anaphase, and telophase. These stages involve a series of important biological events, including DNA replication, sister chromatid cohesion, homologous chromosome pairing, synapsis, recombination, and segregation. During the first meiotic division, homologous chromosomes in the meiocyte are paired and separated, and during the second meiotic division, sister chromatids separate. Meiosis provides a crucial foundation for maintaining chromosome number constancy and genetic diversity within a species.

[0003] Recent research in rice apomixis has enabled its application in heterotic breeding for crops, bringing enormous production potential. The key to apomixis is the conversion of meiosis to mitosis, specifically involving three key meiotic genes: REC8, PAIR1 (SPO11-1), and OSD1. Therefore, research and application of these genes will be of great significance in advancing the application of apomixis in heterotic breeding for crops. Summary of the Invention

[0004] The purpose of the present invention is to provide application of GmOSD1a protein and its encoding gene in regulating plant meiosis.

[0005] To achieve the purpose of the present invention, in a first aspect, the present invention provides a use of a GmOSD1a protein, a gene encoding the GmOSD1a protein, or a biological material containing the GmOSD1a protein in regulating plant meiosis.

[0006] In the present invention, the GmOSD1a protein is: (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 1; or (b) A protein derived from (a) with equivalent function, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO: 1.

[0007] The biological material includes but is not limited to recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, engineered bacteria or transgenic cell line.

[0008] In the present invention, the plant is a monocotyledonous plant or a dicotyledonous plant, including but not limited to soybean, Arabidopsis, wheat, rice, corn, cotton, and peanut.

[0009] In a second aspect, the present invention provides a method for influencing the normal development of soybean gametophytes or influencing the fertility (or activity) of soybean pollen, the method comprising: weakening or knocking out a gene in soybean by genetic engineering means; GmOSD1a Among them, genes GmOSD1a Encodes the GmOSD1a protein.

[0010] Furthermore, the method comprises: GmOSD1a As the target, a sgRNA sequence based on CRISPR / Cas9 is designed, a DNA fragment containing the encoding sgRNA sequence is connected to a vector carrying CRISPR / Cas9, and soybeans are transformed to obtain transgenic soybeans with the gene function missing.

[0011] Preferably, the nucleotide sequence of the sgRNA action site is 5'-CCGCCATCGCCCGCCGCCGCGCC-3' (SEQ ID NO: 3).

[0012] More preferably, the sgRNA is driven by the GmU6 promoter and the Cas9 protein is driven by the GmUbi3 promoter.

[0013] In a third aspect, the present invention provides the use of the transgenic soybean obtained according to the method in plant breeding.

[0014] Furthermore, breeding methods include, but are not limited to, transgenic, hybridization, backcrossing, selfing, or asexual reproduction.

[0015] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: The present invention cloned the genes involved in meiosis in soybean for the first time. GmOSD1a Gene. GmOSD1a Genes can regulate the plant meiosis process and affect the fertility (or activity) of pollen. Targeted editing through CRISPR / Cas9 technology GmOSD1a Genes that can effectively induce GmOSD1a Gene mutations affect the second meiotic division of soybeans. Targeted editing using CRISPR / Cas9 technology GmOSD1a Gene regulation of soybean meiosis provides an important technical basis and theoretical support for the utilization of soybean apomixis. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 In Example 1 of the present invention GmOSD1a Gene structure.

[0017] Figure 2 This is a map of the CRISPR / Cas9 vector in Example 2 of the present invention.

[0018] Figure 3 The wild-type DN50 and CRISPR / Cas9-induced Gmosd1a Mutant plant phenotypes.

[0019] Figure 4 The wild type DN50 and Gmosd1a Pollen stained with potassium iodide.

[0020] Figure 5 The wild type DN50 and Gmosd1a Observation of chromosome behavior. DETAILED DESCRIPTION

[0021] The present invention aims to provide a soybean meiosis-related gene GmOSD1a protein, an encoding gene and an inhibitory factor thereof, and a method for regulating the soybean meiosis process.

[0022] Research has found that mutations in the GmOSD1a gene affect the second meiotic division of soybeans, leading to abnormal gamete development. Cloning this gene will provide a genetic resource for fixing hybrid vigor in soybeans through apomixis, and has important application value in plant genetic engineering breeding.

[0023] Furthermore, the present invention utilizes CRISPR / Cas9 technology to target and edit genes that affect soybean meiosis. GmOSD1a , providing germplasm resources to promote the utilization of soybean apomixis.

[0024] The present invention adopts the following technical solutions: The present invention clones soybean Glyma.03G141800 Gene ， and named it GmOSD1a The amino acid sequence of the encoded protein is shown in SEQ ID NO: 1, and the CDS sequence is shown in SEQ ID NO: 2. The present invention discovered that the CRISPR / Cas9 technology can be used to target and edit GmOSD1a It can affect the soybean meiosis process, resulting in reduced pollen fertility (or vitality).

[0025] In a first aspect, the present invention provides use of soybean GmOSD1a protein or its encoding gene or an inhibitor of the soybean GmOSD1a protein encoding gene in regulating soybean meiosis.

[0026] In a second aspect, the present invention provides a method for regulating soybean multi-meiosis process using CRISPR / Cas9 technology and its application in plant genetic breeding or transgenic plant preparation.

[0027] In the above applications, CRISPR / Cas9 technology is used to target and edit GmOSD1a The gene sequence is modified to cause the gene to lose its function, affecting the second meiotic division of soybeans and resulting in reduced pollen fertility (or activity). Preferably, the present invention utilizes CRISPR / Cas9 technology to target and edit the gene encoding the GmOSD1a protein in plants using the nucleotide sequence shown in SEQ ID NO: 3 as sgRNA, thereby obtaining soybean lines with abnormal meiotic division in a short period of time.

[0028] In the present invention, the soybean GmOSD1a protein has any of the following amino acid sequences: (1) the amino acid sequence shown in SEQ ID NO: 1; (2) The amino acid sequence of the amino acid sequence shown in SEQ ID NO: 1 obtained by replacing, inserting or deleting one or more amino acids, and having the same functional protein; (3) An amino acid sequence having at least 80% homology to the amino acid sequence shown in SEQ ID NO: 1; preferably, the homology is at least 90%; more preferably, 95%.

[0029] In the present invention, the CDS of the soybean GmOSD1a protein has any one of the following nucleotide sequences: (1) the nucleotide sequence shown in SEQ ID NO: 2; (2) A nucleotide sequence encoding a protein with the same function obtained by replacing, inserting or deleting one or more nucleotides of the nucleotide sequence shown in SEQ ID NO: 2.

[0030] The amino acid sequence shown in SEQ ID NO: 1 is the amino acid sequence of soybean GmOSD1a protein. Those skilled in the art can replace, delete and / or add one or more amino acids based on the amino acid sequence disclosed in the present invention and conventional technical means in the art such as conservative substitution of amino acids, without affecting its activity, to obtain a mutant of the GmOSD1a protein having the same activity as the GmOSD1a protein disclosed in the present invention.

[0031] The nucleotide sequence shown in SEQ ID NO:2 is the CDS sequence of the soybean GmOSD1a protein. The gene encoding the GmOSD1a protein described herein can be any nucleotide sequence capable of encoding the GmOSD1a protein. Considering codon degeneracy and codon preferences across species, those skilled in the art can utilize codons suitable for expression in a specific species as needed.

[0032] The present invention also provides an inhibitor of the above-mentioned encoding gene. Preferably, the inhibitor of the soybean GmOSD1a protein encoding gene comprises an interfering RNA or sgRNA capable of inhibiting the expression of the soybean GmOSD1a protein encoding gene.

[0033] The present invention also provides the use of the GmOSD1a protein or its encoding gene, and an inhibitor of the encoding gene in regulating plant meiosis.

[0034] The present invention also provides an expression box containing the coding gene of the GmOSD1a protein or an inhibitor thereof.

[0035] The present invention also provides a vector containing the coding gene of the GmOSD1a protein or an inhibitor thereof.

[0036] The present invention also provides a host cell containing the above expression cassette or vector.

[0037] The above-mentioned GmOSD1a protein or its encoding gene or the inhibitor of the gene encoding soybean GmOSD1a protein can be used in the form of GmOSD1a protein or its encoding gene or the inhibitor of the gene encoding soybean GmOSD1a protein itself, or in the form of an expression cassette, vector containing the gene encoding GmOSD1a protein or its inhibitor, or a host cell containing the expression cassette or the vector.

[0038] In the present invention, the plant is a monocotyledonous plant or a dicotyledonous plant, including but not limited to soybean, Arabidopsis, wheat, rice, corn, cotton, peanut, etc.

[0039] The present invention also provides a method for regulating the plant meiosis process, using gene editing technology or transgenic technology to interfere with the plant meiosis process. GmOSD1a The function of the gene affects the second meiotic division process of plants.

[0040] Preferably, the gene editing technology is CRISPR / Cas9 technology, which uses sgRNA to target and edit the gene encoding the GmOSD1a protein in plants, thereby knocking out the gene encoding the GmOSD1a protein; the sequence of the sgRNA is shown in SEQ ID NO: 3.

[0041] The present invention first discovered GmOSD1a The gene can affect the second meiotic division process and affect pollen activity. Targeted editing through CRISPR / Cas9 technology GmOSD1a The gene can obtain soybean mutants with reduced fertility in a short period of time. This technology provides a theoretical basis and technical support for fixing hybrid advantages in soybeans using apomixis technology, and has important application value in soybean genetic engineering breeding.

[0042] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0043] Example 1 Soybean GmOSD1a clone Cloned soybeans Glyma.03G141800 gene, named GmOSD1a . GmOSD1a The gene is located on chromosome 3, with a total length of 1260 bp and a CDS sequence length of 648 bp ( Figure 1 ), GmOSD1a The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO: 1, and the CDS sequence is shown in SEQ ID NO: 2.

[0044] Example 2 GmOSD1a Gene knockout The CRISPR / cas9 recombinant plasmid pVK005-04-SoyU6-2-GmUbi3- was constructed, in which the GmU6 promoter (SEQ ID NO: 4) drives the sgRNA (the sgRNA sequence targeting the GmOSD1a gene is shown in SEQ ID NO: 3: CCGCCATCGCCCGCCGCCGCGCC) and the GmUbi3 promoter (LOC100799042, Glyma.20G141600v4) drives the Cas9 protein. GmOSD1a ( Figure 2 ), and the recombinant plasmid was introduced into wild-type Dongnong 50 (DN50) soybean (provided by Northeast Agricultural University, national approval number: Heishendou 2007022) by Agrobacterium-mediated soybean cotyledonary node infection. A total of 70 soybean plants were obtained through genetic transformation. GmOSD1a ko Transgenic plants. T0 generation transgenic plants were identified using bar test strips, and a total of 23 T0 generation transgenic plants were identified. GmOSD1a ko Positive transgenic plants. Extract positive transgenic DNA and perform sequencing analysis. GmOSD1a ko Positive transgenic lines undergo gene editing at the targeted site. GmOSD1a ko #07 is a chimeric mutant obtained in the T0 generation, with a substitution at the target site; GmOSD1a ko #44 is a heterozygous mutant obtained in the T0 generation, with a 7-base deletion at the target site; GmOSD1a ko #47 is a heterozygous mutant obtained in the T0 generation, with a single base deletion at the target site. Seeds from positive T0 plants were planted in an artificial climate chamber, and sequencing and phenotypic observations were performed on T1 plants.

[0045] Recombinant plasmid pVK005-04-SoyU6-2-GmUbi3- GmOSD1a The construction method is as follows: Before using the kit (Plant Cas9 / gRNA Plasmid Construction Kit, Beijing Weishanglide Biotechnology Co., Ltd., Catalog No. VK005-04), design and synthesize gRNA target primers: The following oligo primers were designed (SEQ ID NO: 5-6): Target-Sense: 5'-ATTCCATCGCCCGCCGCCGCGCC-3′ Target-Anti: 5'-AACGGCGCGGCGGCGGGCGATGG-3′ Directions: Note: After receiving the kit, please centrifuge the tube before use to avoid solution residue on the tube wall.

[0046] Step 1: Formation of oligoduplex Dilute the synthesized oligos to 10 μM and mix them in the following proportions: Target-Sense: 5 μL; Target-Anti: 5 μL; H2O: 15 μL; The final volume was 25 μL.

[0047] After mixing, process according to the following procedures: 95℃ for 3 minutes; slowly cool from 95℃ to 25℃, for example, -1℃ / 20 seconds; or place the sample tube in 95℃ water and cool naturally to room temperature (16℃) for 5 minutes.

[0048] Step 2: Insert the oligo dimer into the vector Cas9 / gRNA vector (from the Plant Cas9 / gRNA Plasmid Construction Kit): 2 μL Oligo dimer from step 1: 1 μL; Solution 1: 1 μL; Solution 2: 1 μL; H2O: 5 μL; The final volume was 10 μL.

[0049] Incubate at 16°C for 2 hours.

[0050] Step 3: Conversion Take 5-10 μL of the final product of step 2 and add it to 50 μL of freshly thawed DH5a competent cells, flick to mix, place on ice for 30 minutes, heat shock at 42°C for 90 seconds, let it stand on ice for 2 minutes, then add 500 μL of antibiotic-free LB, place it in a 37°C constant temperature shaker at 170 rpm, and after 1 hour of recovery, add it to a plate coated with kanamycin resistance (Kan+).

[0051] Identification of positive clones: Pick 3 to 5 white colonies, shake them and sequence them.

[0052] Example 3 GmOSD1a Observation of mutant phenotypes Separated from T1 generation Gmosd1a The phenotype of homozygous mutants was observed. The results showed that during the vegetative growth period, Gmosd1a There was no difference between the mutant and wild-type DN50; however, at the pod-setting stage, all mutants showed a Gmosd1a The mutants were less fertile and produced fewer pods ( Figure 3 ). Then Gmosd1a The pollen of the mutant was stained with potassium iodide and the results showed Gmosd1a Pollen grains developed abnormally, some were not stained, and some were larger or smaller than wild-type DN50 ( Figure 4 The above experimental results show that Gmosd1a Pollen development is defective in the mutant.

[0053] Example 4 GmOSD1a Genes that influence the second meiotic division To clarify GmOSD1a How do genes affect meiosis? Gmosd1a The changes in chromosome behavior of homozygous mutants at different stages were observed. Figure 5As shown. According to the morphology of chromosomes in each stage of meiosis, prophase I of meiosis can be subdivided into five stages: leptotene, zygotene, pachytene, diplotene and telophase. In pachytene, chromosomes shorten and thicken, taking on the shape of thick threads. In telophase, chromosomes further condense, and 20 bivalents can be clearly observed. When entering metaphase I, the 20 bivalents are arranged on the equatorial plate. In telophase I, after the dyads move to the two poles, the chromosomes untwist and stretch, the nucleolus is re-formed, the nuclear membrane is rebuilt, and the cytoplasm divides at the same time to form two daughter cells. In telophase II, after each chromosome moves to the two poles, it untwists and stretches, the nuclear membrane is reassembled, and the nucleolus reappears. The spindle disappears and the cytoplasm divides. After the above two consecutive divisions, 4 daughter cells are formed. Gmosd1a In the mutant, it was specifically observed that at meiosis I, the mutant chromosomes were no different from those of the wild type. However, at the end of meiosis II, sister chromosomes did not separate, and dimers with abnormal chromosome numbers were produced ( Figure 5 ). The above experimental data show that GmOSD1a It plays an important role in controlling the separation of meiotic II chromosomes and provides valuable gene and germplasm resources for soybean apomixis breeding.

[0054] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

Claims

1. Application of GmOSD1a protein, its encoding gene or biological materials containing said gene in regulating plant meiosis; in, The GmOSD1a protein is: (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 1; or (b) A protein derived from (a) with equivalent function, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that The biological material is recombinant DNA, expression cassette, transposon, plasmid vector, virus vector or engineered bacteria.

3. The use according to claim 1 or 2, characterized in that The plant is a monocotyledonous plant or a dicotyledonous plant.

4. The use according to claim 3, characterized in that The plant is selected from soybean, Arabidopsis, wheat, rice, corn, cotton, and peanut.

5. A method for influencing the normal development of soybean gametophytes or influencing the fertility of soybean pollen, characterized in that: The method comprises: using genetic engineering means to weaken or knock out the gene in soybean GmOSD1a Among them, genes GmOSD1a Encodes the GmOSD1a protein described in claim 1.

6. The method according to claim 5, characterized in that include: Gene GmOSD1a As the target, a sgRNA sequence based on CRISPR / Cas9 is designed, a DNA fragment containing the encoding sgRNA sequence is connected to a vector carrying CRISPR / Cas9, and soybeans are transformed to obtain transgenic soybeans with the gene function missing.

7. The method according to claim 6, characterized in that The nucleotide sequence of the sgRNA action site is 5'-CCGCCATCGCCCGCCGCCGCGCC-3'.

8. The method according to claim 6 or 7, characterized in that The sgRNA is driven by the GmU6 promoter, and the Cas9 protein is driven by the GmUbi3 promoter.

9. Use of the transgenic soybean obtained according to the method according to any one of claims 5 to 8 in plant breeding.

10. The use according to claim 9, characterized in that Breeding methods include transgenics, hybridization, backcrossing, selfing or asexual reproduction.

Images