Construction method of aneuploid acute myeloid leukemia cell model

Abstract

The invention discloses a construction method of an aneuploid acute myeloid leukemia cell model, which comprises the following steps: integrating an shRNA (short hairpin Ribonucleic Acid) expression element which can be induced by doxycycline DOX to express a targeted SAC component BUB1B or CENPE into a genome of an AML (acute myeloid leukemia) cell line; dOX is added into a culture system for induction, and the cells can express shRNA targeting BUB1B or CENPE in a transient manner, so that the expression quantity of BUB1B or CENPE is knocked down, the normal function of SAC is mildly interfered, and enough survivable AML aneuploid cells are induced. The method disclosed by the invention has the advantages that firstly, a non-core regulatory molecule BUB1B or CENPE of the SAC is knocked down in a sexual manner, so that the function of the SAC is mildly interfered, and the cell survival rate in the induction process is guaranteed; the'aneuploid 'is used as a unique main anomaly, so that the phenomenon obtained by taking the cell line as a tool to research is determined to be caused by the'aneuploid' characteristic; the method has nuclear heterogeneity, and can better simulate the aneuploid state of AML cells clinically.

Description

Technical Field

[0001] The present invention belongs to the field of leukemia disease models and construction methods thereof, and specifically relates to a method for constructing an aneuploid acute myeloid leukemia cell model. Background Art

[0002] Aneuploidy refers to an abnormal chromosomal number caused by errors in cell division, resulting in the gain or loss of entire chromosomes. Aneuploidy is prevalent in human solid tumors and hematological cancers and plays a significant role in tumor development and progression. Clinically, tumors with high aneuploidy levels are characterized by increased malignancy, poor prognosis, and high recurrence rates. The intratumoral heterogeneity of tumor tissue caused by aneuploidy can drive tumor evolution, allowing cells to acquire additional mutations and evolve karyotypes, promoting malignant tumor development and the development of treatment resistance. Aneuploidy can also lead to immune evasion by reducing tumor immune infiltration. This phenomenon is not related to the gain or loss of specific chromosomes in aneuploidy, but rather stems from the imbalance in intracellular gene dosage caused by aneuploidy itself. Therefore, aneuploidy is considered an important predictor of the prognostic efficacy of tumor immunotherapy.

[0003] Acute myeloid leukemia (AML) is a highly heterogeneous hematologic malignancy and one of the most common acute leukemias in adults, accounting for 20%-30% of all adult leukemia cases. Clinically, aneuploidy occurs in over 50% of AML patients and is a common tumor cell abnormality. The presence of aneuploidy is closely associated with a poor prognosis in AML patients: patients with high aneuploidy levels have a poorer prognosis, with lower complete remission rates, higher relapse rates, and shorter overall survival. Furthermore, patients with high aneuploidy have a poorer response to standard chemotherapy regimens (such as the classic "7+3" intensive chemotherapy regimen) and are more likely to develop drug resistance. This is because karyotypic heterogeneity provides a selective advantage for clones with specific karyotypes. Once certain clones acquire adaptive mutations, such as altered protein expression that confer resistance to chemotherapy drugs, these clones will survive and expand under drug selection pressure, leading to the development of drug resistance.

[0004] Given that the presence of aneuploidy in AML can confer advantages on leukemia cells in terms of proliferation and survival, accelerate the progression of the disease, increase their tolerance to chemotherapy drugs, enhance their immune escape ability, and lead to poor patient prognosis, the development of aneuploid cell models that can mimic the true characteristics of AML tumor cells in vivo has important application value. Currently available aneuploid cell construction technologies mainly include: (1) Knockdown of MAD2L1, the terminal master regulator of the SAC pathway, induces aneuploidy Using human solid tumor colorectal cancer cell lines as a model, researchers have induced aneuploidy by knocking down MAD2L1, the "master control" molecule at the end of the spindle assembly checkpoint (SAC) pathway. However, this strategy has significant drawbacks in AML: MAD2L1 is located at the end of the SAC signaling pathway, and knocking it down directly leads to premature activation of the APC / C, causing severe chromosome segregation defects. AML leukemia cells, as ultra-rapidly growing cancer cells in suspension, face significantly greater cell proliferation pressure than solid tumor cells and lack a microenvironment such as basal cells in direct contact with them to provide proliferation support. Therefore, AML cells are significantly more dependent on SAC function. Knocking down the SAC master control molecule MAD2L1 will lead to excessive inhibition of SAC function, which in turn leads to excessive apoptosis and mortality of AML cells, making it difficult to efficiently obtain viable functional AML aneuploid cells.

[0005] (2) Use of MPS1 inhibitors to induce aneuploid cells Monopolar spindle 1 kinase (MPS1) is a serine / threonine kinase that plays a critical role in cell division, ensuring the proper distribution of chromosomes into daughter cells during cell division. Treating cells with MPS1 inhibitors, such as AZ3146, can significantly increase the mitotic error rate in cancer cells, leading to aneuploidy. However, existing MPS1 inhibitors lack sufficient specificity and may affect other proteins with similar structures or functions to MPS1, potentially leading to unintended biological effects.

[0006] (3) Producing aneuploid cells using microcell-mediated chromosome transfer (MMCT) Using the human colorectal cancer cell line HCT116 as a model, researchers have used the MMCT technique to transfer a single chromosome from donor cells to recipient HCT116 cells, generating a series of HCT116-derived trisomy cell lines carrying one extra chromosome. However, this method is not only technically expensive and time-consuming, but can only generate a specific type of aneuploid cell, trisomy, and cannot effectively simulate the "highly heterogeneous karyotype" characteristic of AML tumor cells.

[0007] (4) Induction of aneuploid cells using cytochalasin D Using a human solid tumor ovarian cancer cell line as a model, researchers generated aneuploid ovarian cancer cells by adding cytochalasin D. However, this method only produced a single type of aneuploidy, primarily characterized by the doubling of the entire chromosome set, such as tetraploidy and octoploidy, and failed to effectively mimic the "highly heterogeneous karyotype" characteristic of AML tumor cells, where random increases and decreases in chromosome number occur.

[0008] In view of the shortcomings of the prior art described above, the purpose of the present invention is to provide a method for constructing an aneuploid AML cell model that is adapted to the high proliferative pressure characteristics of AML cells, has aneuploidy as the only major defect, and has karyotype heterogeneity, so as to provide a practical in vitro and in vivo tool cell model for further research on the occurrence and development mechanism of AML and the development of new treatment options. Summary of the Invention

[0009] The purpose of this section is to summarize some aspects of the embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the abstract and title of this application to avoid obscuring the purpose of this section, the abstract and the title of the invention, and such simplifications or omissions should not be used to limit the scope of the present invention.

[0010] In view of the above problems and / or the problems existing in the prior art, the present invention is proposed.

[0011] Therefore, the purpose of the present invention is to overcome the deficiencies in the prior art and provide a method for constructing an aneuploid acute myeloid leukemia cell model.

[0012] To solve the above technical problems, the present invention provides the following technical solutions: a method for constructing an aneuploid acute myeloid leukemia cell model, comprising: Using the "tet-on" inducible lentiviral infection method, shRNA expression elements that can be induced by doxycycline (DOX) to express BUB1B or CENPE, regulatory members of the spindle assembly checkpoint SAC pathway, were integrated into the genome of the near-diploid AML cell line; By adding DOX to the culture system, cells can transiently express shRNA targeting BUB1B or CENPE, thereby knocking down the expression of BUB1B or CENPE, gently interfering with the normal function of the spindle assembly checkpoint SAC, and inducing sufficient aneuploid cells while ensuring cell survival. The cell culture medium was then replaced, and DOX was removed from the culture system, allowing the expression of BUB1B or CENPE to return to normal levels, and SAC function was subsequently restored. Among them, the previously induced aneuploid cells will always exist once they are generated. When the SAC function subsequently returns to normal, the aneuploid cells continue to divide normally to generate daughter cells that can only be aneuploid cells with the same karyotype as the mother cell. At this time, the expression of the SAC component proteins that were once transiently knocked down in the aneuploid cells has been restored, and there are no other side effects caused by the continuous knockdown of the SAC components. This group of cells constitutes the experimental group cell line with "aneuploidy" as the only significant defect, that is, the cell model.

[0013] As a preferred embodiment of the construction method of the present invention, the near-diploid AML cell line includes acute myeloid leukemia HL-60 cells.

[0014] As a preferred embodiment of the construction method of the present invention, the shRNA expression element that can be induced by doxycycline (DOX) to express the SAC component BUB1B or CENPE is integrated into the genome of the near-diploid AML cell line, including: Design the mature siRNA sequence targeting BUB1B or CENPE, clone it into the selected lentiviral vector plasmid according to the requirements of the selected "tet-on" series lentiviral expression vector, and verify the correctness of its sequence by sequencing; Use 293T and other lentiviral packaging cells to package the corresponding lentivirus, which is then used to infect a near-diploid AML cell line. Based on the resistance selection gene contained in the selected lentiviral vector, the corresponding antibiotic is selected for screening of stably transformed cell lines to obtain AML stably transformed cell lines that can be inducibly expressed shRNA targeting the SAC component BUB1B or CENPE. The corresponding cell lines can be named "Near-diploid AML Cell Line Name-BUB1B-KD" or "Near-diploid AML Cell Line Name-CENPE-KD."

[0015] As a preferred embodiment of the construction method of the present invention, the antibiotic includes puromycin.

[0016] As a preferred embodiment of the construction method of the present invention, wherein: the induction of aneuploid cells includes: Preparation stage: Resuscitate the constructed "nearly diploid AML cell line name - BUB1B-KD" or "nearly diploid AML cell line name - CENPE-KD" cell line and grow it in maintenance medium. Once it grows well and enters the logarithmic growth phase, enter the aneuploidy induction process; Day 0: Take an equal amount of appropriate cells and divide them into two bottles for parallel culture, so that they are fully grown on the third day. One bottle is cultured with maintenance medium, recorded as the DOX (-) group, and the other bottle is cultured with induction medium with the same formula but containing DOX, recorded as the DOX (+) group; Day 1: Centrifuge and wash the cells from the previous day for at least 3 times; After washing, cells in both the DOX (-) and DOX (+) groups were replaced with maintenance medium without DOX and continued to be cultured; Day 2: Observe cell density and status; Day 3: DOX (-) and DOX (+) groups were passaged. During the passage, a small number of cells were removed from both groups for quantitative PCR detection of endogenous BUB1B or CENPE to verify that the expression of endogenous BUB1B or CENPE in the cells was indeed downregulated. Day 4-5: Observe cell density and status; Day 6: Appropriate amounts of DOX (-) and DOX (+) groups were used for chromosome titration experiments. 100 clear and countable Giemsa-stained photographs of metaphase chromosomes were taken for both the DOX (-) and DOX (+) groups. The chromosomes in each photograph were counted, and the aneuploidy ratios in the DOX (-) and DOX (+) groups were calculated. The chromosome mode information of the selected near-diploid AML cells was queried. Photos with a known mode number of chromosomes were classified as euploid, and photos with a chromosome number less than or greater than the known mode were classified as aneuploid. The aneuploid ratio of cells in the DOX (-) and DOX (+) groups was calculated. At the same time, appropriate amounts of DOX (-) and DOX (+) groups were taken for quantitative PCR testing to verify the restoration of endogenous BUB1B or CENPE expression in the cells, thereby ensuring that aneuploidy was the only major defect of the cell line at this time; After day 6, AML cells from the DOX (-) and DOX (+) groups can be obtained in parallel, representing the euploid and aneuploid AML cells, respectively.

[0017] As a preferred embodiment of the construction method of the present invention, the maintenance culture medium comprises RPMI 1640 cell culture medium containing 10% to 20% FBS, a final concentration of 2 mM L-alanyl-L-glutamine or a final concentration of 2 mM L-glutamine, 100 U / ml penicillin and 0.1 mg / ml streptomycin.

[0018] As a preferred embodiment of the construction method of the present invention, the induction culture medium, except for the additional addition of DOX, has the same other components as the maintenance culture medium; Based on the total volume of the induction culture medium, the final concentration of DOX added is 20 ng / ml~100 ng / ml; The DOX induction culture time is 16 to 24 hours.

[0019] Another object of the present invention is to overcome the deficiencies in the prior art and provide a method for constructing an aneuploid AML animal model, comprising: Introducing an effective dose of the aneuploid AML cell model according to claim 1 or 5 into an animal to obtain the aneuploid AML animal model; The effective dose is 1×10 6 ~1×10 7 cells / animal.

[0020] Another object of the present invention is to overcome the deficiencies in the prior art and provide an aneuploid AML cell model or an aneuploid AML animal model for use in at least one of the following: 1) Study the pathogenesis of AML, including its occurrence, development, metastasis, drug resistance, and drug sensitivity; 2) Screening for preventive or therapeutic drugs that specifically target aneuploid AML; 3) Assist in the selection of personalized treatment options and / or prognostic assessment for AML.

[0021] Beneficial effects of the present invention: (1) Compared with the existing technology of knocking down the terminal "master control" molecule MAD2L1 of the SAC signaling pathway to induce aneuploidy in colorectal cancer cells, the aneuploidy construction strategy of the present invention is significantly more suitable for leukemia cells with high proliferation pressure such as AML. Compared with solid tumor colorectal cancer cells, leukemia cells have a significantly shorter cell cycle and extreme proliferation pressure. At the same time, due to their suspended growth, they lack the regulatory support of other cells in the microenvironment that contact and interact with them. Therefore, the survival of leukemia cells is more absolutely dependent on the SAC pathway. Based on the solid tumor colorectal cancer cells, The experience in the literature shows that directly knocking down the "master control" molecule MAD2L1 usually leads to excessive apoptosis and mortality of leukemia cells, making it difficult to efficiently construct a successful aneuploid leukemia cell model; the present invention chooses to transiently knock down the "non-core regulatory" molecules BUB1B (kinetochore tension sensor) or CENPE (mechanical executor of kinetochore-microtubule connection) in the SAC pathway. While retaining some SAC pathway activity, it can still induce sufficient chromosome segregation errors to produce "high-proportion, viable" leukemia aneuploid cells, thereby significantly improving the probability of successfully constructing a leukemia cell aneuploid model.

[0022] (2) Compared with the existing technology of inducing aneuploidy using MPS1 inhibitors, the aneuploidy model constructed in this patent has "aneuploidy" as the only major abnormality, without other gene mutations coexisting, thus ensuring that the phenomena obtained by using this cell line as a tool are definitely caused by the characteristic of "aneuploidy".

[0023] (3) Compared with the existing technology of obtaining aneuploidy in a single trisomic state using the MMCT method, the aneuploid model constructed by this patent has a heterogeneous karyotype, which can better simulate the "high heterogeneity" characteristics of clinical tumor tissue.

[0024] (4) Compared with the existing aneuploidy acquisition technology using cytochalasin to obtain the whole chromosome set duplication state (tetraploid, octoploid), the aneuploid model constructed by the present invention has a random increase or decrease in karyotype chromosomes and is heterogeneous, which can better model the highly heterogeneous aneuploid state in clinical tumor tissues. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. Those skilled in the art can also derive other drawings based on these drawings without inventive effort. Among them: Figure 1 Flow chart of aneuploidy induction in HL-60 cells in an embodiment of the present invention.

[0026] Figure 2 This is a representative graph of chromosome titration of HL-60 cells in an example of the present invention (euploid: n=44; aneuploid: n<44 or n>44).

[0027] Figure 3 This is a graph showing the recovery of BUB1B expression in HL-60-BUB1B-KD cells on day 6 in an example of the present invention.

[0028] Figure 4 This is a diagram showing the chromosome number distribution of the euploid and aneuploid groups on day 6 of HL-60-BUB1B-KD in the present invention.

[0029] Figure 5 This is a graph showing the recovery of BUB1B expression in HL-60-BUB1B-KD cells on day 6 in an example of the present invention.

[0030] Figure 6 This is a diagram showing the chromosome number distribution of the euploid and aneuploid groups on day 6 of HL-60-BUB1B-KD in the present invention.

[0031] Figure 7 This is a graph showing the recovery of CENPE expression in HL-60-CENPE-KD cells on the 6th day in an example of the present invention.

[0032] Figure 8 This is a diagram showing the chromosome number distribution of the euploid and aneuploid groups on day 6 of HL-60-CENPE-KD in the present invention.

[0033] Figure 9 This is a graph showing the recovery of CENPE expression in HL-60-CENPE-KD cells on the 6th day in an example of the present invention.

[0034] Figure 10 This is a diagram showing the chromosome number distribution of the euploid and aneuploid groups on day 6 of HL-60-CENPE-KD in the present invention.

[0035] Figure 11 This is a graph showing the size and weight of tumors formed subcutaneously by HL-60 aneuploid cells in NCG mice according to an embodiment of the present invention.

[0036] Figure 12 This is a flow cytometric analysis of the transfer and expansion of HL-60 aneuploid cells in the bone marrow of NCG mice in an embodiment of the present invention.

[0037] Figure 13 This is a growth curve of HL-60-BUB1B-KD cells under corresponding conditions in the comparative example of the present invention.

[0038] Figure 14 This is a flow cytometric analysis of apoptosis of HL-60-CENPE-KD cells in the comparative example of the present invention on the third day after induction.

[0039] Figure 15 This is a flow cytometric analysis of apoptosis of HL-60-MAD2L1-KD cells in the comparative example of the present invention on the third day after induction. DETAILED DESCRIPTION

[0040] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.

[0041] A major challenge in studying the mechanisms and treatment options for aneuploidy in AML lies in developing a leukemia cell model characterized by aneuploidy as the sole primary abnormality, without other complex genetic mutations, and exhibiting karyotypic heterogeneity. Aneuploidy is closely linked to cell division, with dysfunction of the SAC (Sac) is a key contributor to aneuploidy. The SAC monitors the proper association of chromosomes with the spindle, ensuring accurate chromosome segregation during cell division and maintaining a stable chromosome number. In colorectal cancer HCT116 cells, perturbing the terminal "master controller" molecule, MAD2L1, has been shown to significantly impair SAC function and induce aneuploidy. Solid tumor cells divide relatively slowly, making them less dependent on SAC function. Furthermore, solid tumor cells can derive survival support from their microenvironment. Consequently, despite the severe disruption of SAC function caused by MAD2L1 knockdown, solid tumor cells can survive and generate functionally aneuploid cells. However, AML cells, characterized by their suspended growth lacking microenvironmental support and extreme proliferative pressure, are significantly more dependent on the SAC pathway than solid tumor cells. Knockdown of the SAC master controller, MAD2L1, often results in excessive mortality, making it difficult to accumulate sufficient numbers of functional aneuploid cells using this approach. This study, based on the non-core regulatory molecules BUB1B (a kinetochore tension sensor) and CEPNE (a microtubule-powered engine) of the SAC pathway, mildly interferes with SAC function in AML leukemia cells, inducing the generation of functional aneuploid AML cells while maintaining their survival.

[0042] Based on the above principles, the present invention takes the nearly diploid AML cell line HL-60 with a uniform and stable karyotype as an example, and constructs an AML aneuploid cell model by targeting BUB1B or CENPE to mildly interfere with SAC function.

[0043] This model first integrates shRNA expression elements that can be induced by Doxycycline (DOX) to target SAC components BUB1B or CENPE into the HL-60 cell genome through the "tet-on" inducible lentiviral infection method.

[0044] By adding DOX induction to the culture system, the cells can transiently express shRNA targeting BUB1B or CENPE, thereby knocking down the expression of BUB1B or CENPE, mildly interfering with the normal function of SAC, and inducing aneuploid cells.

[0045] The cell culture medium was then replaced and DOX was removed from the culture system, allowing the expression of BUB1B or CENPE to return to normal levels, and SAC function was also restored.

[0046] Once induced, aneuploid cells persist. If SAC function subsequently returns to normal, the aneuploid cells continue to divide normally to produce daughter cells with the same karyotype as the parent cell. At this point, the expression of the SAC component proteins that had been transiently knocked down in the aneuploid cells has been restored, so this group of cells constitutes the experimental group cell line with aneuploidy as the only significant defect.

[0047] Correspondingly, cells cultured in parallel and not treated with DOX always maintained their initial near-diploid state, with a stable karyotype and no significant karyotype heterogeneity, and could serve as a control cell line for the "euploid" state.

[0048] This paper uses HL-60 cells, a commonly used representative AML cell line, as an example to describe the construction of an AML aneuploid cell model, which can be extended to any other AML cell line or other types of leukemia-related cell lines. The details are as follows: (1) Construction of HL-60 stable cell lines with genome-integrated inducible expression of shRNA targeting SAC components BUB1B or CENPE The mature sequences of siRNA targeting BUB1B or CENPE were designed (BUB1B sequence: UUCAAAUGCCCGUUUCUGCUG; CENPE sequence: UUUGUAGCACUGAUUUCCUUU) is cloned into the selected lentiviral vector plasmid (such as the commercially available plasmid pTRIPZ) according to the specific requirements of the selected "tet-on" series lentiviral expression vector, and its sequence accuracy is verified by sequencing; The above-mentioned "tet-on" lentiviral expression plasmid and the matching packaging plasmid (such as commercially available VSVG and ΔR8.91) were co-transfected into 293T cells. After 48 hours, the supernatant was aspirated and filtered through a 0.45 μm filter to obtain the viral fluid.

[0049] HL-60 cells are resuspended in this viral solution and polybrene (final concentration 10 μg / ml) is added to promote infection efficiency. HL-60 cells are cultured for 48 hours. Subsequently, the HL-60 cells are collected by centrifugation, the supernatant discarded, and the HL-60 cells are resuspended in fresh maintenance culture medium. Based on the resistance selection gene contained in the selected lentiviral vector, the corresponding antibiotic (such as puromycin, final concentration 1 μg / ml) is added. Culture is continued for at least 5 days. Surviving cells are HL-60 stably transfected cell lines that can inducibly express shRNA targeting the SAC component BUB1B or CENPE and can be designated as HL-60-BUB1B-KD or HL-60-CENPE-KD.

[0050] (2) Transient knockdown of SAC components BUB1B or CENPE induces aneuploid HL-60 cells The induction process lasts for 6 days, and the process is as follows Figure 1 shown.

[0051] Preparation stage: Resuscitate the HL-60-BUB1B-KD or HL-60-CENPE-KD cell line constructed in (1), culture it in the maintenance medium, and enter the aneuploidy induction process after it grows well and enters the logarithmic growth phase.

[0052] Day 0: Take an equal number of cells and divide them into two flasks for parallel culture, allowing them to grow to full growth by day 3. One flask is cultured in maintenance medium, designated as the DOX (-) group, and the other flask is cultured in induction medium with the same formula but containing DOX, designated as the DOX (+) group.

[0053] Objective: To activate the expression of BUB1B or CENPE shRNA integrated into the genome of HL-60-BUB1B-KD or HL-60-CENPE-KD cell lines in the DOX (+) group, thereby downregulating the expression of endogenous BUB1B or CENPE in the cells.

[0054] Day 1: Centrifuge and wash the cells from the previous day at least three times to completely remove any DOX introduced by the induction medium in the DOX (+) group. Wash the cells in the DOX (-) group in parallel to ensure that both groups of cells have undergone the same treatment and maintained consistent conditions. After washing, switch cells from both the DOX (-) and DOX (+) groups to a DOX-free maintenance medium and continue culture. Purpose: To disable expression of the genomic-integrated BUB1B or CENPE shRNA in the DOX (+) group's HL-60-BUB1B-KD or HL-60-CENPE-KD cell lines, thereby restoring endogenous BUB1B or CENPE expression after a transient downregulation (sustained downregulation would result in cell death and inability to divide).

[0055] Day 2: Observe cell density and status.

[0056] Day 3: The DOX (-) and DOX (+) groups were passaged. During the passage, a small number of cells were removed from both groups and quantitative PCR was performed to detect endogenous BUB1B or CENPE to verify that the expression of endogenous BUB1B or CENPE in the cells was indeed downregulated.

[0057] Day 4-5: Observe cell density and status.

[0058] Day 6: Chromosome titration experiments were performed on appropriate amounts of DOX (-) and DOX (+) cells. 100 clear and countable Giemsa-stained metaphase chromosomes were taken for both the DOX (-) and DOX (+) cells. The chromosomes in each photo were counted, and the aneuploid ratios in the DOX (-) and DOX (+) cells were calculated. The karyotype of HL-60 cells is nearly diploid, with a mode of 44 chromosomes. Photos showing 44 chromosomes were classified as euploid, while photos showing fewer or more than 44 chromosomes were classified as aneuploid. Figure 2 ), the aneuploidy ratios of cells in the DOX (-) and DOX (+) groups were calculated; At the same time, appropriate amounts of DOX (-) and DOX (+) groups were taken for quantitative PCR experiments to verify the restoration of endogenous BUB1B or CENPE expression in the cells, thereby ensuring that aneuploidy was the only major defect of the cell line at this time.

[0059] After day 6, parallel access to DOX (-) and DOX (+) HL-60 cells can be performed, representing euploid and aneuploid AML cells, respectively, for various experimental studies. After DOX induction and recovery, cells can be expanded to the desired cell number for downstream analysis, ensuring that the appropriate experimental analysis can be performed after day 6.

[0060] In the above induction process, the maintenance culture medium used is RPMI 1640 cell culture medium (or similar medium) containing 10%-20% FBS (preferably 20%), a final concentration of 2 mM L-alanyl-L-glutamine or a final concentration of 2 mM L-glutamine (preferably L-alanyl-L-glutamine), 100 U / ml penicillin and 0.1 mg / ml streptomycin.

[0061] The induction medium used, with the exception of the addition of DOX, contains the same components as the maintenance medium. The final DOX concentration ranges from 20 ng / ml to 100 ng / ml, and the duration of DOX exposure ranges from 16 to 24 hours. Certain concentration and duration combinations may be preferred, for example, using a 20 ng / ml DOX concentration for 24 hours or a 100 ng / ml DOX concentration for 16 hours. The wash solution used can be any suitable cell culture solution (e.g., saline, PBS, etc.), with PBS being preferred. The number of washes can be determined based on actual needs, with three washes being preferred.

[0062] Generally, in order to study the pathogenesis of human aneuploid AML tumor cells or develop treatment options for aneuploid AML tumor cells (such as screening of specific chemotherapy drugs), corresponding human aneuploid tumor xenograft animal models are required.

[0063] Another aspect of the present invention provides a method for constructing a corresponding aneuploid AML animal model, wherein an effective dose of the aneuploid AML cell model described above is administered to an animal in different ways, specifically as follows: The animals used are mammals, preferably mice, and more preferably severe combined immunodeficiency mice (a variety of commercially available mice are available, such as NCG mice, NSG mice, C-NKG mice, and M-NSG mice). Gender is acceptable, but female is preferred. The animals should be 8-12 weeks old, preferably 10 weeks old.

[0064] The effective dose is 1×10 6 ~1×10 7 The method of introducing the cells into the animal is commonly used by those skilled in the art, for example, by subcutaneous injection of the cell suspension into the animal; by injection into the tail vein or tail artery. The growth time of the introduced cells in the animal body is 14 to 21 days. The optimal number of cells is selected according to the different introduction methods and the different growth time of the animal body. Preferably, 1×10 6 ~5×10 6 cells / mouse, grown in vivo for 21 days; 5×10 6 ~1×10 7 For example, in a specific embodiment, cells were cultured at a rate of 2.5×10 6 The cells were introduced into severe combined immunodeficient mice via the tail vein and grown in the body for 21 days.

[0065] In summary, the present invention provides a method for constructing an AML aneuploid cell model. The obtained aneuploid AML cell model and animal model can be used for the following purposes: Study the pathogenesis of AML, including occurrence, development, metastasis, drug resistance and drug sensitivity.

[0066] Screening for preventive or therapeutic drugs that specifically target aneuploidy AML.

[0067] To assist in the selection of personalized treatment options and / or prognostic assessment for AML.

[0068] Example 1 Conditional transient knockdown of BUB1B by lower concentrations of DOX combined with longer treatment time induces aneuploidy in near-diploid human AML cells HL-60 1.1 DOX treatment DOX was added to the maintenance medium of the HL-60-BUB1B-KD cell line that was newly separated the day before and was in the growth phase, so that the final DOX concentration was 20 ng / ml.

[0069] 1.2 DOX Removal After 24 hours, cells were centrifuged, resuspended, and washed three times with PBS.

[0070] 1.3 Cell passaging The cells were cultured for 5 days using the maintenance medium and passaged when they were confluent.

[0071] Take cells at the end of culture and perform: Quantitative PCR was used to test whether BUB1B expression had been restored. Figure 3 : DOX (+) group is the aneuploid group, and DOX (-) group is the euploid group, the same below], to prove that the cells in the DOX (+) group have no other defects except the defect of "aneuploidy"; Chromosome titration statistics of the aneuploidy ratio of the two groups of cells ( Figure 4 ) to prove that the aneuploidy ratio of cells in the DOX (+) group was significantly increased, and the number of chromosomes was different. The constructed aneuploidy model has the characteristics of "karyotype heterogeneity".

[0072] Figure 4 The statistical table of the scatter plot is shown in Table 1.

[0073] Table 1 Compared with the HL-60 cells in the DOX (-) group, whose chromosome number was mainly reflected in the near-euploid state of 44 chromosomes, the HL-60 cells in the DOX (+) group that completed the induction process had significantly discrete chromosome numbers (many cells showed <44 and >44 chromosomes, and the chromosome number was not fixed. These cells with chromosome numbers ≠44 were all aneuploid cells). This reflects the successful construction of "aneuploidy" and the karyotypic heterogeneity of the obtained aneuploids.

[0074] Example 2 Conditional transient knockdown of BUB1B by higher DOX concentrations combined with shorter treatment time induces aneuploidy in near-diploid human AML cells HL-60 2.1 DOX treatment DOX was added to the maintenance medium of the HL-60-BUB1B-KD cell line that was newly separated the day before and was in the growth phase, so that the final DOX concentration was 100 ng / ml.

[0075] 2.2 DOX Removal After 16 hours, cells were centrifuged, resuspended, and washed three times with PBS.

[0076] 2.3 Cell passaging Continue culturing the cells in maintenance medium for 5 days, and subculture them when they are full grown. Take the cells at the end of the culture and perform the following: Quantitative PCR was used to test whether BUB1B expression had been restored ( Figure 5 ), to prove that the cells in the DOX (+) group had no other accompanying defects except the defect of "aneuploidy"; Chromosome titration statistics of the aneuploidy ratio of the two groups of cells ( Figure 6 ) to prove that the aneuploidy ratio of cells in the DOX (+) group was significantly increased, and the number of chromosomes was different. The constructed aneuploidy model has the characteristics of "karyotype heterogeneity".

[0077] Figure 6 The statistical table of the scatter plot is shown in Table 2.

[0078] Table 2 Example 3 Conditional transient knockdown of CENPE by lower DOX concentrations combined with longer treatment time induces aneuploidy in near-diploid human AML cells HL-60 3.1 DOX treatment DOX was added to the maintenance medium of the HL-60-CENPE-KD cell line that was newly separated the day before and was in the growth phase, so that the final DOX concentration was 20 ng / ml.

[0079] 3.2 DOX Removal After 24 hours, cells were centrifuged, resuspended, and washed three times with PBS.

[0080] 3.3 Cell passaging Continue culturing the cells in maintenance medium for 5 days, and subculture them when they are full grown. Take the cells at the end of the culture and perform the following: Quantitative PCR was used to test whether the expression of CENPE had been restored ( Figure 7 ), to prove that the cells in the DOX (+) group had no other accompanying defects except the defect of "aneuploidy"; Chromosome titration statistics of the aneuploidy ratio of the two groups of cells ( Figure 8 ) to prove that the aneuploidy ratio of cells in the DOX (+) group was significantly increased, and the number of chromosomes was different. The constructed aneuploidy model has the characteristics of "karyotype heterogeneity". Figure 8The statistical table of the scatter plot is shown in Table 3.

[0081] Table 3 Example 4 Conditional transient knockdown of CENPE by higher DOX concentrations combined with shorter treatment time induces aneuploidy in near-diploid human AML cells HL-60 4.1 DOX treatment DOX was added to the maintenance medium of the HL-60-CENPE-KD cell line that was newly separated the day before and was in the growth phase, so that the final DOX concentration was 100 ng / ml.

[0082] 4.2 DOX Removal After 16 hours, cells were centrifuged, resuspended, and washed three times with PBS.

[0083] 4.3 Cell passaging Continue culturing the cells in maintenance medium for 5 days, and subculture them when they are full grown. Take the cells at the end of the culture and perform the following: Quantitative PCR was used to test whether the expression of CENPE had been restored ( Figure 9 ), to prove that the cells in the DOX (+) group had no other accompanying defects except the defect of "aneuploidy"; Chromosome titration statistics of the aneuploidy ratio of the two groups of cells ( Figure 10 ) to prove that the aneuploidy ratio of cells in the DOX (+) group was significantly increased, and the number of chromosomes was different. The constructed aneuploidy model has the characteristics of "karyotype heterogeneity". Figure 10 The statistical table of the scatter plot is shown in Table 4.

[0084] Table 4 Example 5 Construction of subcutaneous tumor model in severe combined immunodeficiency NCG mice In this Example 5, the AML aneuploid cells obtained in Example 1 were used to construct a subcutaneous tumor model in NCG mice.

[0085] 5.1 Cell culture Aneuploidy was induced according to the process of Example 1, and the culture was expanded to obtain a sufficient number of cells.

[0086] 5.2 Model Construction Count the cells and resuspend them in PBS to a concentration of 5 × 10 7 100 μl of cell suspension (containing 5 × 10 cells / ml) was injected into the middle and posterior part of the left armpit of each NCG mouse.6 cells) and continue to raise the mice.

[0087] 5.3 Tumor Acquisition Mice were sacrificed 1, 2, and 3 weeks after injection, and tumors were removed by dissection. Tumor weight was measured using an analytical balance, and tumor volume was measured using the water displacement method. The tumor formation rate was 100%, with the optimal tumor size at 2 weeks, making this an appropriate endpoint for various studies (e.g., aneuploidy-related drug screening, drug efficacy evaluation, and regulatory factor function evaluation). Figure 11 ).

[0088] Example 6 Construction of a bone marrow metastasis tumor model in severe combined immunodeficiency NCG mice In this Example 6, the AML aneuploid cells obtained in Example 3 were used to construct a bone marrow metastasis model in NCG mice.

[0089] 6.1 Cell culture Aneuploidy was induced according to the process of Example 3, and the culture was expanded to obtain a sufficient number of cells.

[0090] 6.2 Model Construction Count the cells and resuspend them in PBS to a concentration of 2.5 × 10 7 Each NCG mouse was injected with 100 μl of cell suspension (containing 2.5 × 10 6 cells) and continue to raise the mice.

[0091] 6.3 Tumor Acquisition Mice were sacrificed 1 week, 2 weeks, and 3 weeks after injection, and the bone marrow was obtained by dissection and prepared into bone marrow single cell suspension. The suspension was labeled with a PE-labeled flow cytometric antibody that specifically recognizes human CD45. Human CD45 is only present on human HL-60 aneuploid cells that were introduced into NCG mice via the tail vein and successfully transferred to the bone marrow for expansion. Flow cytometric analysis of the bone marrow single cell suspension was performed, and the percentage of human CD45-positive cells was counted, which can indicate the transfer and expansion of aneuploid cells in the mouse bone marrow. The bone marrow transfer rate was 100%, with a higher percentage in the bone marrow at 3 weeks, which is the most appropriate value. It is suitable as the evaluation endpoint time for various studies (such as aneuploidy-related drug screening, drug efficacy evaluation, and regulatory factor function) Figure 12 ).

[0092] Comparative Example 1 The recommended DOX induction concentration used in commercial "Tet-on" vectors cannot induce sufficient viable AML aneuploid cells 1.1 DOX treatment DOX was added to the maintenance medium of freshly split HL-60-BUB1B-KD cells in their normal growth phase, resulting in a final DOX concentration of 0.5 µg / ml. This final DOX concentration is the recommended concentration for various common commercial DOX-inducible vectors (including the pTRIPZ vector used in this patent).

[0093] 1.2 DOX Removal After 16 hours, cells were centrifuged, resuspended, and washed three times with PBS.

[0094] 1.3 Cell observation and counting Press 2×10 4 Cells were plated in 12-well plates with 100 cells / well and cultured in maintenance medium. Three replicate wells were taken daily for viable cell counts, revealing no cell proliferation. All cells died within three days of DOX withdrawal. This phenomenon suggests that even with the current recommended DOX concentration (0.5 µg / ml), even with the minimum induction time of 16 hours recommended in this patent, SAC function was severely impaired, leading to cell death and thus preventing the induction process of this AML cell aneuploidy model.

[0095] This phenomenon suggests that even if mild regulatory molecules of the SAC pathway are selected for knockdown, the knockdown process still needs to be strictly controlled according to the DOX concentration and time combination described in this patent in order to successfully complete the complete aneuploidy induction process and obtain sufficient viable functional aneuploid AML cells ( Figure 13 ).

[0096] Comparative Example 2 The recommended DOX induction time using commercial "Tet-on" vectors is insufficient to induce sufficient viable AML aneuploid cells HL-60-CENPE-KD cells were treated with 20 ng / ml DOX for 36, 48, or 72 hours (the recommended induction time for the pTRIPZ vector used in this invention and other common commercial DOX-inducible vectors of the same type is greater than 24 hours and less than 72 hours). 2.1 DOX treatment DOX was added to the maintenance medium of freshly split HL-60-CENPE-KD cells in the growth phase to a final DOX concentration of 20 ng / ml. Three plates of cells were set up in parallel to test three induction times: 36, 48, and 72 hours.

[0097] 2.2 DOX Removal After 36, 48, or 72 hours, cells were centrifuged, resuspended, and washed three times with PBS.

[0098] 2.3 Cell observation and counting On day 3 after DOX treatment (all groups completed induction), flow cytometry apoptosis analysis (Annexin V / PI double staining) was performed on all three groups of cells, revealing a cell death rate >75% at all induction times. This phenomenon suggests that even at the lowest induction concentration of 20 ng / ml DOX, recommended by the present invention, within the commonly recommended DOX treatment durations, SAC function is severely impaired, leading to cell death and thus preventing the induction of the aneuploidy AML cell model.

[0099] This phenomenon suggests that even if mild regulatory molecules of the SAC pathway are selected for knockdown, the knockdown process still needs to be strictly controlled according to the DOX concentration and time combination described in the present invention in order to successfully complete the complete aneuploidy induction process and obtain sufficient viable functional aneuploid AML cells ( Figure 14 ).

[0100] Comparative Example 3 Knockdown of the SAC core control molecule MAD2L using various reported DOX concentration and time combinations resulted in excessively high cell apoptosis rates and was unable to induce sufficient numbers of viable AML aneuploid cells. 3.1 Construction of the HL-60-MAD2L1-KD cell line According to the lentiviral packaging and infection method described in the present invention, an HL-60 cell line was constructed to knock down the SAC core control MAD2L1. The mature siRNA sequence targeting MAD2L1 was selected from a published literature (ACAGUACAAAUAUCCAUUGCU).

[0101] 3.2 DOX treatment Two groups of HL-60-MAD2L1-KD cells were set up in parallel and induced using the DOX concentration and time combinations reported in published literature.

[0102] Condition 1: 50 ng / ml DOX induction for 24 h; Condition 2: 200 ng / ml DOX induction for 16 h.

[0103] 3.3 DOX Removal After 24 or 16 hours, cells were centrifuged, resuspended, and washed three times with PBS.

[0104] 3.4 Cell passaging The cells were cultured in the maintenance medium and flow cytometry apoptosis assay (Annexin V / PI double staining) was performed on the two groups of cells on day 3. It was found that the apoptosis rate of HL-60 cells was >90% regardless of the DOX concentration. The proportion of viable cells after induction was too low to complete the entire induction protocol. Therefore, it is difficult to obtain sufficient functional aneuploid viable cells by simply transplanting AML cells into colorectal cancer solid tumors ( Figure 15 ).

[0105] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, and all of these should be included in the scope of the present invention.

Claims

1. A method for constructing an aneuploid acute myeloid leukemia cell model, characterized by: include, Using the "tet-on" inducible lentiviral infection method, doxycycline (DOX)-inducible shRNA expression elements targeting BUB1B or CENPE, regulatory members of the spindle assembly checkpoint SAC pathway, were integrated into the genome of a near-diploid AML cell line. By adding DOX to the culture system, cells can transiently express shRNA targeting BUB1B or CENPE, thereby knocking down the expression of BUB1B or CENPE, gently interfering with the normal function of the spindle assembly checkpoint SAC, and inducing aneuploid cells while ensuring cell survival. The cell culture medium was then replaced, and DOX was removed from the culture system, allowing the expression of BUB1B or CENPE to return to normal levels, and SAC function was subsequently restored. Among them, the previously induced aneuploid cells will always exist once they are generated. When the SAC function subsequently returns to normal, the aneuploid cells continue to divide normally to generate daughter cells that can only be aneuploid cells with the same karyotype as the mother cell. At this time, the expression of the SAC component proteins that were transiently knocked down in the aneuploid cells has been restored, and there are no other side effects caused by the continuous knockdown of SAC components. This group of cells constitutes the experimental group cell line with "neuploidy" as the only significant defect, that is, the cell model.

2. The construction method according to claim 1, wherein: The near-diploid AML cell lines include acute myeloid leukemia HL-60 cells.

3. The construction method according to claim 1, wherein: The shRNA expression element that can be induced by doxycycline (DOX) to express the SAC component BUB1B or CENPE is integrated into the genome of the near-diploid AML cell line, include, Design the mature siRNA sequence targeting BUB1B or CENPE, clone it into the selected lentiviral vector plasmid according to the requirements of the selected "tet-on" series lentiviral expression vector, and verify the correctness of its sequence by sequencing; Lentiviral packaging cells, such as 293T, were used to package the corresponding lentiviruses, which were then used to infect near-diploid AML cell lines. Based on the resistance selection genes contained in the selected lentiviral vectors, corresponding antibiotics were selected for screening of stably transfected cell lines. AML stably transfected cell lines that can be inducibly expressed shRNA targeting the SAC component BUB1B or CENPE were obtained and named near-diploid AML cell line-BUB1B-KD and near-diploid AML cell line-CENPE-KD.

4. The construction method according to claim 3, wherein: The antibiotics include puromycin.

5. The construction method according to any one of claims 1 to 4, characterized in that: The inducing of aneuploid cells comprises: Preparation stage: Resuscitate the constructed near-diploid AML cell line - BUB1B-KD or near-diploid AML cell line - CENPE-KD cell line, grow it in maintenance medium, and enter the aneuploidy induction process after it grows well and enters the logarithmic growth phase; Day 0: Take an equal amount of appropriate cells and divide them into two bottles for parallel culture, so that they are fully grown on the third day. One bottle is cultured with maintenance medium, recorded as the DOX (-) group, and the other bottle is cultured with induction medium with the same formula but containing DOX, recorded as the DOX (+) group; Day 1: Centrifuge and wash the cells from the previous day for at least 3 times; After washing, cells in both the DOX (-) and DOX (+) groups were replaced with maintenance medium without DOX and continued to be cultured; Day 2: Observe cell density and status; Day 3: DOX (-) and DOX (+) groups were passaged. During the passage, a small number of cells were removed from both groups for quantitative PCR detection of endogenous BUB1B or CENPE to verify that the expression of endogenous BUB1B or CENPE in the cells was indeed downregulated. Day 4-5: Observe cell density and status; Day 6: Appropriate amounts of DOX (-) and DOX (+) groups were used for chromosome titration experiments. 100 clear and countable Giemsa-stained photographs of metaphase chromosomes were taken for both the DOX (-) and DOX (+) groups. The chromosomes in each photograph were counted, and the aneuploidy ratios in the DOX (-) and DOX (+) groups were calculated. The chromosome mode information of the selected near-diploid AML cells was queried. Photos with a known mode number of chromosomes were classified as euploid, and photos with a chromosome number less than or greater than the known mode were classified as aneuploid. The aneuploid ratio of cells in the DOX (-) and DOX (+) groups was calculated. At the same time, appropriate amounts of DOX (-) and DOX (+) groups were taken for quantitative PCR testing to verify the restoration of endogenous BUB1B or CENPE expression in the cells, thereby ensuring that aneuploidy was the only major defect of the cell line at this time; After day 6, AML cells from the DOX (-) and DOX (+) groups can be obtained in parallel, representing the euploid and aneuploid AML cells, respectively.

6. The construction method according to claim 5, wherein: The maintenance culture medium includes RPMI 1640 cell culture medium containing 10% to 20% FBS, 2 mM final concentration of L-alanyl-L-glutamine or 2 mM final concentration of L-glutamine, 100 U / ml penicillin and 0.1 mg / ml streptomycin.

7. The construction method according to claim 5, wherein: The induction culture medium, except for the additional addition of DOX, has the same other components as the maintenance culture medium; Based on the total volume of the induction culture medium, the final concentration of DOX added is 20 ng / ml~100 ng / ml; The DOX induction culture time is 16 to 24 hours.

8. A method for constructing an aneuploid AML animal model, characterized by: include, An effective dose of the aneuploid AML cell model according to claim 1 or 5 is introduced into an animal to obtain the aneuploid AML animal model.

9. The construction method according to claim 8, wherein: The effective dose is 1×10 6 ~1×10 7 cells / animal.

10. Use of the aneuploid AML cell model constructed by the method of any one of claims 1 to 7 or the aneuploid AML animal model constructed by the method of any one of claims 8 to 9 in at least one of the following: 1) Study the pathogenesis of AML, including its occurrence, development, metastasis, drug resistance, and drug sensitivity; 2) Screening for preventive or therapeutic drugs that specifically target aneuploid AML; 3) Assist in the selection of personalized treatment options and / or prognostic assessment for AML.

Images