Application of tRNA (transfer ribonucleic acid) derivative fragment in laryngeal cancer diagnosis

Abstract

The invention relates to the technical field of disease diagnosis, in particular to application of tRNA derivative fragments in laryngeal cancer diagnosis. The invention provides a laryngeal cancer marker, a kit for diagnosing laryngeal cancer and a medicine for treating laryngeal cancer, the inventor screens out a tRF-5c type marker tRF-Val-CAC-008, and the nucleotide sequence of the tRF-5c type marker tRF-Val-CAC-008 is as shown in SEQ ID NO: 1. Compared with a healthy volunteer, the expression of the tRF-Val-CAC-008 in plasma and saliva of a laryngeal cancer patient is remarkably increased, and the inventor further proves that the tRF-Val-CAC-008 can be used as a laryngeal cancer marker and can be used for diagnosing laryngeal cancer in vitro through experimental data. Meanwhile, the inventor finds that an inhibitor of the laryngeal cancer marker can inhibit laryngeal cancer proliferation and promote laryngeal cancer pyroptosis, so that the inhibitor can be used for preparing medicines for treating laryngeal cancer.

Description

Technical Field

[0001] The present invention relates to the technical field of disease diagnosis, and in particular to application of tRNA-derived fragments in the diagnosis of laryngeal cancer. Background Art

[0002] Laryngeal cancer is one of the most common malignant tumors of the head and neck, with squamous cell carcinoma being the primary pathological type. Recently, the incidence of laryngeal cancer has been on the rise. Although combined surgery and radiotherapy have reduced mortality rates, the five-year survival rate remains low due to recurrence and lymph node metastasis. Early diagnosis and treatment of laryngeal cancer patients can not only save the larynx, but also increase the five-year survival rate to over 95%.

[0003] Current clinical routine diagnosis of laryngeal cancer, such as traditional laryngoscopy screening, is invasive and relies on operator experience; imaging examinations have low sensitivity for early tumors; and tissue biopsy as the gold standard has disadvantages such as high trauma, infection risk, and lag time, making it impossible to achieve early and efficient screening.

[0004] Therefore, there is an urgent need to develop a minimally invasive or non-invasive method for early diagnosis of laryngeal cancer. Summary of the Invention

[0005] The present invention aims to solve one of the technical problems in the related art to at least a certain extent. To this end, one object of the present invention is to provide a laryngeal cancer marker, a kit for diagnosing laryngeal cancer, and a drug for treating laryngeal cancer. The inventors screened out a tRF-5c type marker tRF-Val-CAC-008, the nucleic acid sequence of which is shown in SEQ ID NO: 1. Compared with healthy volunteers, the expression of tRF-Val-CAC-008 in the plasma and saliva of laryngeal cancer patients was significantly increased, and the inventors further confirmed through experimental data that tRF-Val-CAC-008 can be used as a laryngeal cancer marker and can be used for in vitro diagnosis of laryngeal cancer. At the same time, the inventors found that inhibitors of laryngeal cancer markers can inhibit laryngeal cancer proliferation and promote laryngeal cancer pyroptosis, indicating that they can be used to prepare drugs for the treatment of laryngeal cancer.

[0006] To this end, the first aspect of the present invention provides a laryngeal cancer marker. In some embodiments of the present invention, the marker is tRF-Val-CAC-008, the nucleic acid sequence of which is shown in SEQ ID NO:1.

[0007] GCTTCTGTAGTGTAGTGGTTATCACGTTC(SEQ ID NO:1)

[0008] High-throughput sequencing methods have enabled the exploration of many new biomarkers. Among them, tRNA-derived fragments (tRFs) have become a research focus. They are short non-coding RNAs produced by mature or precursor transfer RNA (tRNA). Based on their enzyme cleavage sites in the RNA molecule, they are divided into five types, namely tRF-1, tRF-2, tRF-3, tRF-5, and i-tRF. tRFs play a vital role in the occurrence and progression of various cancers. Due to their large number of modified groups, tRFs show greater stability than other small RNAs, which has great advantages in the field of tumor markers. The inventors screened out the tRF-5c type marker tRF-Val-CAC-008 (MINTbase_ID: tRF-29-Q99P9P9NH525), the nucleic acid sequence of which is shown in SEQ ID NO: 1. Compared to healthy volunteers, tRF-Val-CAC-008 levels were significantly increased in the plasma and saliva of laryngeal cancer patients. The inventors further confirmed through experimental data that tRF-Val-CAC-008 can be used as a laryngeal cancer marker for in vitro diagnosis of laryngeal cancer. Specifically, the receiver operating characteristic (ROC) curve showed an area under the curve (AUC) of 0.8569, indicating that the combined diagnosis of plasma and saliva tRF-Val-CAC-008 can distinguish laryngeal cancer patients from healthy volunteers.

[0009] A second aspect of the present invention provides a kit for diagnosing laryngeal cancer. In some embodiments of the present invention, the kit comprises a reagent for detecting the level of the laryngeal cancer marker described in the first aspect.

[0010] The kit provided by the present invention assists in the early diagnosis of laryngeal cancer by jointly detecting the levels of tRF-Val-CAC-008 in saliva and plasma through a minimally invasive or even non-invasive method, thereby improving the efficiency of early laboratory diagnosis of laryngeal cancer.

[0011] The third aspect of the present invention provides use of the laryngeal cancer marker described in the first aspect in preparing a kit for diagnosing laryngeal cancer.

[0012] A fourth aspect of the present invention provides use of the reagent for detecting the laryngeal cancer marker described in the first aspect in preparing a kit for diagnosing laryngeal cancer.

[0013] A fifth aspect of the present invention provides a pharmaceutical composition, which in some embodiments of the present invention comprises the inhibitor of the laryngeal cancer marker described in the first aspect.

[0014] In some embodiments of the present invention, the nucleic acid sequence of the laryngeal cancer marker inhibitor is shown in SEQ ID NO:4.

[0015] GAACGUGAUAACCACUACACUACAGAAGC(SEQ ID NO:4)

[0016] The sixth aspect of the present invention provides use of the pharmaceutical composition of the fifth aspect in preparing a medicament for treating laryngeal cancer.

[0017] A seventh aspect of the present invention provides a reagent for promoting laryngeal cancer proliferation and inhibiting laryngeal cancer pyroptosis. In some embodiments of the present invention, the reagent comprises the laryngeal cancer marker described in the first aspect or an analog of the laryngeal cancer marker.

[0018] The inventors found that analogs of tRF-Val-CAC-008 can promote laryngeal cancer proliferation, reduce LDH secretion, and reduce the expression of gasdermin E (GSDME) and Caspase-3 proteins, thereby reducing cell pyroptosis.

[0019] In some embodiments of the present invention, the nucleic acid sequence of the laryngeal cancer marker analog is shown in SEQ ID NO:3.

[0020] GCUUCUGUAGUGUAGUGGUUAUCACGUUC(SEQ ID NO:3)

[0021] In an eighth aspect, the present invention provides a reagent for inhibiting laryngeal cancer proliferation and promoting laryngeal cancer pyroptosis. In some embodiments of the present invention, the reagent comprises the inhibitor of the laryngeal cancer marker described in the first aspect.

[0022] In some embodiments of the present invention, the nucleic acid sequence of the laryngeal cancer marker inhibitor is shown in SEQ ID NO:4.

[0023] Additional aspects and advantages of the present invention will be set forth in part in the description which follows and, in part, will be obvious from the description which follows, or may be learned by practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the description of the embodiments with reference to the following drawings, in which:

[0025] Figure 1Figure 2 shows the screening and validation of tRF-Val-CAC-008 in laryngeal cancer tissues. A and B show the screening of tRF-Val-CAC-008 in laryngeal cancer tissues and adjacent tissues by high-throughput sequencing (NGS) (n=4); C and D show the validation of tRF-Val-CAC-008 levels in laryngeal cancer tissues and adjacent tissues by qRT-PCR (n=60); E shows that 66.67% of laryngeal cancer tissues had higher expression levels of tRF-Val-CAC-008 than adjacent tissues. Data are expressed as mean ± SD, *P < 0.05, **P < 0.01; F shows the survival analysis between the high-expression tRF-Val-CAC-008 group and the low-expression group (P = 0.0278).

[0026] Figure 2 The effect of tRF-Val-CAC-008 on the proliferation of laryngeal cancer cells is shown, wherein A shows the relative expression of tRF-Val-CAC-008 in endothelial HLMEC cell lines and laryngeal cancer cell lines (TU138, TU686, AMC-HN-8 and TU212); B and C show the relative levels of tRF-Val-CAC-008 in AMC-HN-8 and TU686 cells after treatment with analogs and inhibitors; D and E show the expression of tRF-Val-CAC-008 by CCK Figure 8 shows the effect of tRF-Val-CAC-008 on the proliferation of laryngeal cancer cells (AMC-HN-8 and TU686 cells); F shows representative results of EdU detection of laryngeal cancer cells (AMC-HN-8 and TU686 cells) treated with tRF-Val-CAC-008 analogs and inhibitors; G shows the statistical results of EdU detection of laryngeal cancer cells (AMC-HN-8 and TU686 cells) treated with tRF-Val-CAC-008 analogs and inhibitors. n = 3, *P < 0.05, **P < 0.01, ***P < 0.001;

[0027] Figure 3Figure 1 shows the effects of tRF-Val-CAC-008 analogs on pyroptosis in laryngeal cancer cells. Figures A and B show microscopic observation of laryngeal cancer cells treated with tRF-Val-CAC-008 analogs or inhibitors. Figures C and D show flow cytometric analysis of cells treated with tRF-Val-CAC-008 analogs or inhibitors. Representative results are shown on the left, and statistical results are shown on the right. Figure E shows lactate dehydrogenase (LDH) release in laryngeal cancer cells (AMC-HN-8 and TU686 cells) treated with tRF-Val-CAC-008 analogs or inhibitors. Figure F shows Western blot analysis of the expression of pyroptosis-related proteins (GSDME and Caspase3) in laryngeal cancer cells (AMC-HN-8 and TU686 cells) treated with tRF-Val-CAC-008 analogs or inhibitors. n = 3, *P < 0.05, **P < 0.01.

[0028] Figure 4 Figure 1 shows that tRF-Val-CAC-008 can be used to diagnose laryngeal cancer. A shows plasma tRF-Val-CAC-008 levels in laryngeal cancer patients (n=34) and healthy volunteers (n=52); B shows saliva tRF-Val-CAC-008 levels in laryngeal cancer patients (n=86) and healthy volunteers (n=86); C shows receiver operating characteristic (ROC) curves for plasma, saliva, and the combination of plasma and saliva for laryngeal cancer; D shows the diagnostic value of tRF-Val-CAC-008 for laryngeal cancer. Data are expressed as mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001. DETAILED DESCRIPTION

[0029] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be understood as limiting the present invention.

[0030] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood to indicate or imply relative importance or implicitly specify the number of the technical features indicated. Therefore, features defined as "first" or "second" may explicitly or implicitly include one or more of such features. Furthermore, in the description of the present invention, unless otherwise specified, "plurality" means two or more.

[0031] The endpoints of the ranges and any values disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.

[0032] In order to make the present invention more easily understood, certain technical and scientific terms are specifically defined below. Unless otherwise clearly defined elsewhere in this document, all other technical and scientific terms used herein have the meaning commonly understood by those skilled in the art to which the present invention belongs.

[0033] In this document, the terms “include” or “comprising” are open expressions, that is, including the contents specified in the present invention, but not excluding other contents.

[0034] As used herein, the terms "optionally," "optional," or "optionally" generally mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0035] Herein, the term "tRNA" stands for transfer RNA (tRNA), a type of RNA consisting of 76-90 nucleotides whose 3' end can attach to a specific amino acid under the catalysis of aminoacyl-tRNA synthetase. During translation, tRNA recognizes the codon on the mRNA using its anticodon and transfers the corresponding amino acid to the polypeptide chain being synthesized in the ribosome. Theoretically, each tRNA molecule can only attach to one amino acid, but the degeneracy of the genetic code allows more than one tRNA to attach to each amino acid. The primary structure of tRNA is linear, but through base pairing with itself, it forms a cloverleaf-shaped secondary structure. This structure consists of four main arms: the amino acid arm, the anticodon arm, the D-loop (or D-arm), and the TψC-loop (or T-arm).

[0036] In this article, the term "tRNA-derived fragments (tRFs)" refers to a class of small noncoding RNAs (scRNAs) produced by the specific cleavage of mature tRNAs or precursor tRNAs under certain conditions. As an emerging class of regulatory noncoding RNAs, tRFs are gradually being revealed to play roles in various physiological and pathological processes. tRFs have the potential to serve as disease biomarkers and therapeutic targets, providing new insights into the diagnosis, prognosis, and treatment of diseases such as cancer.

[0037] In this article, the term "laryngeal cancer markers" refers to specific substances (such as proteins, genes, metabolites, etc.) detected in blood, tissues, or other body fluids that are associated with the occurrence, progression, or treatment response of laryngeal cancer. Abnormal changes in these markers may indicate the presence of laryngeal cancer, disease progression, or recurrence risk, and are often used to assist in diagnosis, monitor treatment response, or assess prognosis.

[0038] In this article, the term "pyroptosis" refers to a form of programmed cell death, which is an inflammatory process. Unlike apoptosis, pyroptosis triggers a significant inflammatory response and plays an important role in immune defense and disease development.

[0039] In this article, the term "Receiver Operating Characteristic Curve" refers to a tool used to evaluate the performance of binary classification models, particularly in medical diagnosis, machine learning, and other fields. By visualizing the trade-off between sensitivity and specificity, it helps evaluate classification model performance and optimize decision thresholds. In medicine, it is an important tool for validating the reliability of diagnostic markers, imaging tests, or predictive models.

[0040] As used herein, an "analog" of tRNA refers to a molecule that is structurally or functionally similar to tRNA and is obtained through chemical modification, artificial synthesis, or bioengineering techniques. In the present invention, it specifically refers to a nucleic acid sequence that has similar functions to tRF-Val-CAC-008, such as the sequence shown in SEQ ID NO: 3.

[0041] As used herein, "tRNA inhibitors" refer to molecules that interfere with the normal function of tRNA, inhibiting protein synthesis by blocking tRNA aminoacylation, binding to ribosomes, or other key steps in the translation process. In the present invention, they specifically refer to nucleic acid sequences that inhibit the function of tRF-Val-CAC-008, such as the sequence shown in SEQ ID NO: 4.

[0042] The scheme of the present disclosure will be explained below in conjunction with the examples. Those skilled in the art will understand that the following examples are only used to illustrate the present disclosure and should not be considered to limit the scope of the present disclosure. Where specific techniques or conditions are not specified in the examples, they are carried out according to the techniques or conditions described in the literature in this area or according to the product instructions. Where the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be obtained commercially.

[0043] Sample collection

[0044] The Ethics Committee of Ningbo Medical Center Li Huili Hospital approved this study, and all participants provided written informed consent. All samples, including tissue, plasma, and saliva, were provided by the Department of Otolaryngology and Head and Neck Surgery at Ningbo Medical Center Li Huili Hospital. Tumor and adjacent tissues were collected from 60 surgically resected laryngeal cancer patients and then preserved in RNA fixation reagent (Bioteke, Beijing, China). Plasma was isolated from fresh blood from 52 healthy volunteers and 34 laryngeal cancer patients, and saliva samples were collected from 86 healthy volunteers and 86 laryngeal cancer patients. All samples were immediately stored at −80°C for further testing. Two pathologists diagnosed laryngeal cancer according to the Union for International Cancer Control and World Health Organization guidelines. None of the laryngeal cancer patients received preoperative radiotherapy or chemotherapy.

[0045] Paired t-tests were used to compare tRF-Val-CAC-008 levels in laryngeal cancer tissues and adjacent adjacent tissues. Survival outcomes were assessed using the log-rank test. The diagnostic value of tRF-Val-CAC-008 was analyzed using receiver operating characteristic (ROC) curves. A P value < 0.05 was considered significant. All data were statistically analyzed using SPSS 20.0 software (IBM, IL, USA) and graphed using GraphPad Prism 6.0 software (CA, USA).

[0046] Example 1 tRF-Val-CAC-008 levels are significantly upregulated in laryngeal cancer

[0047] To screen for differentially expressed tRFs, the inventors performed next-generation sequencing on cancerous tissues and adjacent tissues from four laryngeal cancer patients and screened out multiple differentially expressed tRFs ( Figure 1 In this study, we selected the significantly upregulated tRF-Val-CAC-008 for further investigation ( Figure 1 To verify the sequencing results, the levels of tRF-Val-CAC-008 were detected in the cancerous tissues and adjacent tissues of 60 laryngeal cancer patients. Figure 1 As shown in Figures C and D, the level of tRF-Val-CAC-008 in laryngeal cancer tissues was significantly upregulated compared with adjacent adjacent tissues, which was consistent with the sequencing results. In the qRT-PCR results, 66.67% (40 / 60) of the patients' cancer tissues contained high levels of tRF-Val-CAC-008 ( Figure 1 Middle E). The overall survival of laryngeal cancer patients with high tRF-Val-CAC-008 expression was significantly lower than that of laryngeal cancer patients with low tRF-Val-CAC-008 expression ( Figure 1 Middle F).

[0048] The RNA extraction and qRT-PCR detection methods involved in the above experiments are as follows:

[0049] 1) RNA isolation and quality control

[0050] Total RNA was extracted from cell and tissue samples using TRIzol reagent (Invitrogen, USA). Total RNA was extracted from plasma and saliva samples using TRIzol LS reagent (Invitrogen, USA) and viral RNA extraction kit R6874 (Omega, USA), respectively. Total RNA concentration and purity were measured using a UV spectrophotometer. An OD260 / OD280 ratio of 1.8 to 2.1 was considered acceptable for each sample.

[0051] 2) Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR)

[0052] cDNA synthesis and qRT-PCR were performed using a reverse transcription and qRT-PCR kit (Shanghai, China). RNU6-2 (U6) small nuclear RNA was used as an internal control. tRF levels were expressed using the ΔCq method, with higher ΔCq values indicating lower levels. Therefore, using -ΔCq to express tRF levels provides a more intuitive reflection of expression levels.

[0053] Example 2 tRF-Val-CAC-008 promotes the proliferation of laryngeal cancer cells

[0054] The inventors detected the expression of tRF-Val-CAC-008 in human endothelial cells (HLMEC) and human laryngeal cancer cell lines (AMC-HN-8, TU686, TU138 and TU212). The results showed that tRF-Val-CAC-008 was relatively highly expressed in AMC-HN-8 and TU686 cells, so these two cell lines were used for further experiments ( Figure 2 Middle A).

[0055] To upregulate or downregulate the level of tRF-Val-CAC-008 in laryngeal cancer cells, tRF-Val-CAC-008 analogs and inhibitors were transfected into AMC-HN-8 and TU686 cells, respectively. qRT-PCR results showed that transfection of analogs significantly increased the level of tRF-Val-CAC-008 in cells, while transfection of inhibitors decreased the level of tRF-Val-CAC-008 in cells ( Figure 2 (B, C).

[0056] CCK-8 and EdU assays were used to examine the effects of tRF-Val-CAC-008 transfection on the proliferation and viability of laryngeal cancer cells. CCK-8 results showed that tRF-Val-CAC-008 analogs could significantly accelerate cell proliferation, while tRF-Val-CAC-008 inhibitors inhibited cell proliferation ( Figure 2(D, E). EdU results showed that after overexpression of tRF-Val-CAC-008, the red fluorescence of each cell increased significantly, indicating that the proliferation ability of laryngeal cancer cells was significantly increased. In contrast, downregulating the level of tRF-Val-CAC-008 had the opposite effect ( Figure 2 Table 1 below shows the sequence information used in the experiment.

[0057] Table 1

[0058] name sequence SEQ ID NOs: tRF-Val-CAC-008 GCTTCTGTAGTGTAGTGGTTATCACGTTC 1 NC UUGUACUACACAAAAGUACUG 2 mimics GCUUCUGUAGUGUAGUGGUUAUCACGUUC 3 inhibitor GAACGUGAUAACCACUACACUACAGAAGC 4

[0059] The experimental methods involved in the above experiments are as follows:

[0060] 1) Cell culture

[0061] The human laryngeal cancer cell line AMC-HN-8 was derived from metastatic lymph node tissue from a 46-year-old Korean male patient diagnosed with laryngeal cancer. TU686 is an epithelial-like cell line isolated from the cancer tissue of a laryngeal cancer patient. Both cell lines were purchased from the Bena Cell Bank (BeNa, China). Cells were grown in RPMI 1640 medium (Hyclone, USA) supplemented with 10% heat-inactivated fetal bovine serum (Gibco, USA) and 1% penicillin / streptomycin and incubated in a 37°C incubator (Thermo Fisher, USA) with 5% CO₂.

[0062] 2) Cell transfection

[0063] Cells in the exponential growth phase were seeded into 6-well plates at a density of 2 × 10 cells per well. 5 Cells were cultured for 24 hours. When approximately 60% of the cells were confluent, tRF-Val-CAC-008 analogs or inhibitors were transfected using Lipofectamine 2000 reagent (Invitrogen, USA). All oligonucleotide sequences were synthesized by GenePharma (China) and are detailed in Table 1.

[0064] 3) CCK-8 assay

[0065] Cell proliferation ability was detected by CCK-8. Laryngeal cancer cells were seeded into 96-well plates at a seeding density of 5 × 10 3 Six replicate wells were set up for each cell type and transfected with either a tRF-Val-CAC-008 analog or inhibitor. At 0, 24, 48, 72, and 96 hours of culture, 10 μL of CCK-8 reagent was added to each well. The cells were incubated at 37°C for 3 hours, and the absorbance at 450 nm was measured using a microplate reader (Labsystem, Finland). The experiment was repeated three times to verify the reliability of the results.

[0066] 4) EdU experiment

[0067] Use BeyoClick according to the instructions. TM EdU-555 assay kit (Beyotime, China) was used. Laryngeal cancer cells were transfected with tRF-Val-CAC-008 analogs or inhibitors. After 24 hours of culture, EdU working solution preheated at 37°C was added to the well plate. The final EdU concentration was 10 μM. The cells were incubated in an incubator for 3 hours and then fixed with 4% paraformaldehyde (Biosharp, China) at room temperature for 15 minutes. The cells were then washed three times with washing solution (Beyotime, China) and incubated with 1 ml of permeabilization solution (Beyotime, China) at room temperature for 10 minutes. After washing twice with washing solution, the cells were incubated in the dark with Edu reaction solution for 30 minutes and then with Hoechst 33342 for 10 minutes. Finally, the cells were observed and photographed using a fluorescence microscope. Image J was used to calculate the positive cell rate in each group.

[0068] Example 3 tRF-Val-CAC-008 inhibits laryngeal cancer cell pyroptosis

[0069] To further evaluate the function of tRF-Val-CAC-008 in laryngeal cancer cells, live cell imaging was used to assess morphological changes after treatment. After 12 h of treatment with the tRF-Val-CAC-008 inhibitor, some AMC-HN-8 and TU686 cells became swollen and a large number of blebs appeared on the plasma membrane ( Figure 3 A and B), which are consistent with the characteristics of cell pyroptosis, but this morphological feature was not observed after treatment with tRF-Val-CAC-008 analogs. In addition, flow cytometry detected a significant decrease in the percentage of apoptotic cells after treatment with tRF-Val-CAC-008 analogs, while an increase in the percentage of apoptotic cells after treatment with tRF-Val-CAC-008 inhibitors ( Figure 3 Consistent with these results, LDH secretion was decreased after treatment with a tRF-Val-CAC-008 analog, whereas LDH secretion was increased after treatment with a tRF-Val-CAC-008 inhibitor ( Figure 3 In addition, Western blot results showed that after upregulating the level of tRF-Val-CAC-008 in laryngeal cancer cells, the expression of pyroptosis-related proteins GSDME and Caspase-3 were inhibited ( Figure 3 Middle (F), these data indicate that tRF-Val-CAC-008 analogs can inhibit pyroptosis of laryngeal cancer cells.

[0070] The experimental methods involved in the above experiments are as follows:

[0071] 1) Flow cytometry

[0072] Cell apoptosis was detected using the Annexin V-FITC / PI apoptosis detection kit (Beyotime, China). After laryngeal cancer cells were transfected with tRF-Val-CAC-008 analogs or inhibitors, the cells were harvested by trypsinization, washed twice with chilled PBS, and then incubated with FITC-linked Annexin V for 30 minutes. The cells were immediately stained with PI and analyzed by flow cytometry using a FACS Calibur (BD Biosciences, USA). The data were processed using FlowJo software.

[0073] 2) Lactate dehydrogenase (LDH) release test

[0074] LDH content in cells was measured using a lactate dehydrogenase cytotoxicity assay kit (Beyotime, China) according to the manufacturer's instructions. Laryngeal cancer cells were transfected with tRF-Val-CAC-008 analogs or inhibitors, seeded into 96-well plates, and cultured for 24 hours. The cells were then centrifuged at 400g for 5 minutes in a multiwell plate centrifuge. After removing the supernatant, the prepared LDH-releasing reagent was added, and the cells were incubated in an incubator for 1 hour and centrifuged at 400g for 5 minutes in a multiwell plate centrifuge. 120 μl of the supernatant from each well was aspirated and added to the corresponding wells of a new 96-well plate. The cells were then assayed using a microplate reader.

[0075] 3) Western blot

[0076] Forty-eight hours after laryngeal cancer cells were transfected with tRF-Val-CAC-008 analogs or inhibitors, total protein was extracted using a total protein extraction kit (Beyotime, China). The isolated protein concentration was quantified using a BCA assay kit (Beyotime, China). Buffer was added to the sample, gently mixed, and then heated in a 95°C water bath for 10 minutes to completely denature the protein. The protein during electrophoresis was diluted to an equal concentration of 1× buffer before gel preparation, electrophoretic separation, membrane transfer, and immunoreaction. Immunoreaction was performed using primary antibodies against glyceraldehyde-3-phosphate dehydrogenase (GAPDH), GSDME, and caspase-3 (Proteintech, China). Protein expression was detected by electrochemiluminescence (Millipore, USA).

[0077] Example 4 Diagnostic Value of tRF-Val-CAC-008 for Laryngeal Cancer

[0078] To evaluate the diagnostic significance of tRF-Val-CAC-008 for laryngeal cancer, the levels of tRF-Val-CAC-008 in plasma and saliva samples of laryngeal cancer patients were detected. Compared with healthy volunteers, the expression of tRF-Val-CAC-008 in the plasma and saliva of laryngeal cancer patients was significantly increased ( Figure 4 The ROC curve results showed that plasma tRF-Val-CAC-008 could effectively distinguish laryngeal cancer patients from healthy volunteers, with an area under the curve (AUC) of 0.6331, a sensitivity of 58.82%, and a specificity of 66.07%. Similarly, salivary tRF-Val-CAC-008 distinguished laryngeal cancer patients from healthy volunteers with an AUC of 0.6662, a sensitivity of 44.19%, and a specificity of 81.4%. The combined detection of plasma and salivary tRF-Val-CAC-008 levels had a good predictive ability for laryngeal cancer diagnosis, with an AUC of 0.8569, a sensitivity of 85.29%, and a specificity of 80.77% ( Figure 4 (C, D).

[0079] In the description of this specification, the reference terms "one embodiment", "some embodiments", "example", "specific example", "some implementation plans" or "some examples" mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic expressions of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.

[0080] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. A laryngeal cancer marker, characterized in that: The marker is tRF-Val-CAC-008, and the nucleic acid sequence is shown in SEQ ID NO:

1.

2. A kit for diagnosing laryngeal cancer, characterized in that: Contains a reagent for detecting the level of the laryngeal cancer marker according to claim 1.

3. Use of the laryngeal cancer marker according to claim 1 in preparing a kit for diagnosing laryngeal cancer.

4. Use of the reagent for detecting the laryngeal cancer marker according to claim 1 in preparing a kit for diagnosing laryngeal cancer.

5. A pharmaceutical composition, characterized in that The invention also comprises the laryngeal cancer marker inhibitor according to claim 1.

6. The pharmaceutical composition according to claim 5, characterized in that The nucleic acid sequence of the laryngeal cancer marker inhibitor is shown in SEQ ID NO:

4.

7. Use of the pharmaceutical composition according to claim 5 or 6 in the preparation of a medicament for treating laryngeal cancer.

8. A reagent for promoting laryngeal cancer proliferation or inhibiting laryngeal cancer pyroptosis, characterized in that: The invention comprises the laryngeal cancer marker or an analogue of the laryngeal cancer marker according to claim 1.

9. The reagent according to claim 8, characterized in that The nucleic acid sequence of the laryngeal cancer marker analog is shown in SEQ ID NO:

3.

10. An agent for inhibiting laryngeal cancer proliferation or promoting laryngeal cancer pyroptosis, characterized in that: The invention also comprises the laryngeal cancer marker inhibitor according to claim 1.

11. The reagent according to claim 10, characterized in that The nucleic acid sequence of the laryngeal cancer marker inhibitor is shown in SEQ ID NO: 4.

Images