Compositions and methods for inhibiting expression of 17 beta-hydroxysteroid dehydrogenase type 13 (HSD17B13)

By designing complementary double-stranded ribonucleic acid (dsRNA) agents, the HSD17B13 gene expression is specifically inhibited, solving the problem that HSD17B13 expression in the prior art is not effectively inhibited, and has the potential to treat non-alcoholic fatty liver disease.

CN120457205APending Publication Date: 2025-08-08SHANGHAI ARGO BIOPHARMACEUTICAL CO LTD
View PDF 19 Cites 0 Cited by

Patent Information

Application Number
CN202380085095.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2022-12-22
Filing Date
2023-12-22
Publication Date
2025-08-08

AI Technical Summary

Technical Problem

The prior art has failed to effectively inhibit the expression of 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13), and its role in non-alcoholic fatty liver disease has been underutilized.

Method used

Double-stranded ribonucleic acid (dsRNA) agents are provided to form duplexes to specifically silencing or reducing HSD17B13 gene expression, including mismatch and modification of specific nucleotide sequences to improve efficiency by designing sequences that are highly complementary to HSD17B13 mRNA.

Benefits of technology

Effectively inhibit the expression of HSD17B13 gene, potentially used in the treatment of non-alcoholic fatty liver disease and other related diseases, and selective silencing or reducing the expression of HSD17B13 through RNAi technology.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005443582110000071
    Figure BDA0005443582110000071
  • Figure BDA0005443582110000081
    Figure BDA0005443582110000081
  • Figure BDA0005443582110000091
    Figure BDA0005443582110000091
Patent Text Reader

Abstract

Compositions and methods useful for reducing the expression of the 17 [beta]-hydroxysteroid dehydrogenase type 13 (HSD17B13) gene and for treating diseases and disorders associated with HSD17B13 are provided. Provided are an HSD17B13 dsRNA agent, an HSD17B13 antisense polynucleotide agent, a composition comprising the HSD17B13 dsRNA agent, and a composition comprising the HSD17B13 antisense polynucleotide agent, which can be used to reduce the expression of HSD17B13 in a cell and a subject.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates, in part, to compositions and methods useful for inhibiting expression of the 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) gene. Technical Background

[0002] Members of the 17β-hydroxysteroid dehydrogenase (HSD17B or 17β-HSD) enzyme family have diverse functions, including, for example, sex hormones, fatty acids, and bile acids in the body (Moeller and Adamski (2009) Mol Cell Endocrinol 301:7). The HSD17B family consists of 14 enzymes involved in the reduction or oxidation of sex hormones, fatty acids, and bile acids. Different family members have different tissue distribution, subcellular localization, and catalytic preferences. The HSD17B family exhibits different substrate specificities, including steroids, lipids, and retinoids.

[0003] HSD17B13 is known to be expressed at the highest levels in hepatocytes of the liver, while lower levels can be detected in the ovary, bone marrow, kidney, brain, lung, skeletal muscle, bladder, and testes. Hepatocytes, which constitute the parenchymal tissue of the liver, are responsible for mobilizing lipids for energy and storing excess lipids in the form of lipid droplets (LDs), making the liver the primary organ responsible for lipid homeostasis. The function of HSD17B13 is not fully understood; however, several 17β-HSD family members, including 17β-HSD-4, -7, -10, and -12, have been shown to be involved in carbohydrate and fatty acid metabolism. This suggests that HSD17B13 may also play a role in lipid metabolism pathways. Hepatic upregulation of HSD17B13 has been reported in patients with fatty liver disease, supporting a role for this enzyme in the pathogenesis of non-alcoholic fatty liver disease (NAFLD).

[0004] Therefore, new therapies targeting HSD17B13 represent a novel approach to reduce HSD17B13 levels and treat liver diseases such as non-alcoholic fatty liver disease. Summary of the Invention

[0005] In general, the present disclosure provides novel HSD17B13 gene-specific RNAi agents, compositions comprising HSD17B13 RNAi agents, and methods of using HSD17B13 RNAi agents and compositions comprising HSD17B13 RNAi agents to inhibit HSD17B13 gene expression in vitro and / or in vivo. The HSD17B13 RNAi agents described herein can selectively and effectively reduce, inhibit, or silence HSD17B13 gene expression in a subject (e.g., a human or animal subject).

[0006] According to one aspect of the present invention, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 2 by no more than 3 nucleotides. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, forming a double-stranded region of at least 17 nucleotides in length, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from any one of the nucleotide sequences of SEQ ID NO: 1 by 0, 1, 2, or 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, forming a double-stranded region of at least 17 nucleotides in length, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from any of the nucleotide sequences of SEQ ID NO: 1 by 0, 1, 2, or 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 2 by 0, 1, 2, or 3 nucleotides.In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, forming a double-stranded region of at least 15, 16, or 17 nucleotides in length, wherein the sense strand comprises at least 15, 16, 17, 18, 19, or 20 consecutive nucleotides that differ from any of the 45-65, 46-66, 47-67, 48-68, 49-69, 50-70, 51-71, 52-72, 53-73, 54-74, 55-75, 56-76, 57-77, 58-78, 59-79, 60-80, 61-81, 62-82, 63-83, 64-84, or 65-85 nucleotide sequences of SEQ ID NO: 1 by 0, 1, 2, or 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the corresponding nucleotide sequence of SEQ ID NO: 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, nucleotide positions 2 to 18 in the antisense strand comprise a region of complementarity to the HSD17B13 RNA transcript, wherein the region of complementarity comprises at least 15 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3, and optionally comprises a targeting ligand. In some embodiments, the region of complementarity to the HSD17B13 RNA transcript comprises at least 15, 16, 17, 18, 19, or 20 consecutive nucleotides that differ by no more than 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3. In certain embodiments, the antisense strand of the dsRNA is at least substantially complementary to any one of the target regions of SEQ ID NO: 1 and is provided in any one of Tables 1-3. In some embodiments, the antisense strand of the dsRNA is fully complementary to any one of the target regions of SEQ ID NO: 1 and is provided in any one of Tables 1-3. In some embodiments, the dsRNA agent comprises a sense strand sequence listed in any one of Tables 1-3, wherein the sense strand sequence is at least substantially complementary to the antisense strand sequence in the dsRNA agent. In certain embodiments, the dsRNA agent comprises a sense strand sequence listed in any one of Tables 1-3, wherein the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent comprises an antisense strand sequence listed in any one of Tables 1-3. In some embodiments, the dsRNA agent comprises a sequence listed as a duplex sequence in any one of Tables 1-3.

[0007] In some embodiments, the antisense strand of the dsRNA comprises the nucleotide sequence S1:5'-z1AGAAGCAGAAGGAUUUz2-3', wherein z1 and z2 each independently represent a nucleotide sequence of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length, wherein the nucleotide sequence S1 is substantially or completely complementary to a portion of the HSD17B13 mRNA transcript. In certain embodiments, z1 is selected from C, G, A, or U. In certain embodiments, z1 is U. In certain embodiments, z2 is absent. In certain embodiments, z2 is a nucleotide sequence selected from C, CU, CA, CC, CG, CUU, CUA, CUC, CUG, CUAC, CUAU, CUAA, CUAG, CUAGG, CUAGUU, CUAGGA, CUAGGAU, CUAGGAUG, CUAGGAUGA, or CUAGGAUGAUGUUCAUGGCUUUG. In some embodiments, the antisense strand of the dsRNA consists of the nucleotide sequence SI: 5'-z1AGAAGCAGAAGGAUUUz2-3', wherein z1 and z2 are each independently as defined above. In certain embodiments, the antisense strand of the dsRNA consists of the nucleotide sequence SI': 5'-z1AGAAGCAGAAGGAUUUCz2'-3', wherein z1 is selected from C, G, A, or U, and z 2' The nucleotide sequence is selected from U, A, C, G, UU, UA, UC, UG, UAC, UAU, UAA, UAG, UAGG, UAGUU, UAGGA, UAGGAU, UAGGAUG, AUUUCUAG, UAGGAUGA or UAGGAUGAUGUUCAUGGCUUUG.

[0008] In some embodiments, the sense strand of the dsRNA comprises the nucleotide sequence SII:5'-z3AAAUCCUUCUGCUUCUz4-3', wherein z3 and z4 each independently represent a nucleotide sequence of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In certain embodiments, z4 is selected from C, G, A, or U. In certain embodiments, z4 is A. In certain embodiments, z3 is absent. In certain embodiments, z3 is a nucleotide sequence selected from G, AG, UG, GG, CG, AAG, UAG, GAG, CAG, CUAG, GUAG, AUAG, UUAG, CCUAG, UCCUAG, AUCCUAG, CAUCCUAG, UCAUCCUAG, or CAAAGCCAUGAACAUCAUCCUAG. In some embodiments, the sense strand of the dsRNA consists of the nucleotide sequence SII: 5'-z3AAAUCCUUCUGCUUCUz4-3', wherein z3 and z4 are each independently as defined above. In some embodiments, the sense strand of the dsRNA consists of the nucleotide sequence SII': 5'-z3'GAAAUCCUUCUGCUUCUz4-3', wherein z4 is selected from C, G, A or U, and z 3' Selected from the nucleotide sequence of A, U, G, C, AA, UA, GA, CA, CUA, GUA, AUA, UUA, CCUA, UCCUA, AUCCUA, CAUCCUA, UCAUCCUA or CAAAGCCAUGAACAUCAUCCUA. It will be understood that the sense strand is substantially or completely complementary to the corresponding antisense strand.

[0009] In some embodiments, z1 is a nucleotide sequence that is substantially or completely complementary to z4. In some embodiments, z2 is a nucleotide sequence that is substantially or completely complementary to z3. In some embodiments, z2' is a nucleotide sequence that is substantially or completely complementary to z3'.

[0010] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the antisense strand of the dsRNA comprises the nucleotide sequence SI or SI' as described above, wherein the sense strand is substantially or fully complementary to the antisense strand sequence, forming a duplex region of at least 15, 16, 17, 18, or 19 nucleotides with 0, 1, 2, or 3 mismatches.

[0011] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the antisense strand of the dsRNA consists of the nucleotide sequence SI or SI' as described above, wherein the sense strand is substantially or fully complementary to the antisense strand sequence, forming a duplex region of at least 15, 16, 17, 18, or 19 nucleotides with 0, 1, 2, or 3 mismatches.

[0012] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand of the dsRNA comprises the nucleotide sequence SII and the antisense strand of the dsRNA comprises the nucleotide sequence SI, wherein the nucleotide sequences SII and SI are as described above. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand of the dsRNA consists of the nucleotide sequence SII and the antisense strand of the dsRNA consists of the nucleotide sequence SI, wherein the nucleotide sequences SII and SI are as described above.

[0013] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand of the dsRNA comprises the nucleotide sequence SII' and the antisense strand of the dsRNA comprises the nucleotide sequence SI', wherein the nucleotide sequences SII' and SI' are as described above. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand of the dsRNA consists of the nucleotide sequence SII' and the antisense strand of the dsRNA consists of the nucleotide sequence SI', wherein the nucleotide sequences SII' and SI' are as described above.

[0014] In some embodiments, the antisense strand of the dsRNA comprises the nucleotide sequence SIII: 5'-z5GUGAUCAGAAGCAGAAz6-3', wherein z5 and z6 each independently represent a nucleotide sequence of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length, wherein the nucleotide sequence SIII is substantially or completely complementary to a portion of the HSD17B13 mRNA transcript. In certain embodiments, z5 is selected from C, G, A, or U. In certain embodiments, z5 is U. In certain embodiments, z5 is absent. In certain embodiments, z5 is a nucleotide sequence selected from G, GU, GA, GC, GG, GGU, GGA, GGC, GGG, GGAC, GGAU, GGAA, GGAUU, GGAUGA, GGAUUU, GGAUUUC, GGAUUUCU, GGAUUUCUA, or GGAUUUCUAGGAUGAUGUUCAUG. In some embodiments, the antisense strand of the dsRNA consists of the nucleotide sequence SIII: 5'-z5GUGAUCAGAAGCAGAAz6-3', wherein z5 and z6 are each independently as defined above. In certain embodiments, the antisense strand of the dsRNA consists of the nucleotide sequence SIII':5'-z5GUGAUCAGAAGCAGAAGz6'-3', wherein z5 is selected from C, G, A or U, and z6' is a nucleotide sequence selected from U, A, C, G, GU, GA, GC, GG, GAC, GAU, GAA, GAUU, GAUGA, GAUUU, GAUUUC, GAUUUCU, GAUUUCUA or GAUUUCUAGGAUGAUGUUCAUG.

[0015] In some embodiments, the sense strand of the dsRNA comprises the nucleotide sequence SIV:5'-z7UUCUGCUUCUGAUCACz8-3', wherein z7 and z8 each independently represent a nucleotide sequence of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In certain embodiments, z8 is selected from C, G, A, or U. In certain embodiments, z8 is A. In certain embodiments, z7 is absent. In certain embodiments, z7 is a nucleotide sequence selected from C, AC, UC, GC, CC, ACC, UCC, GCC, CCC, GUCC, AUCC, UUCC, AAUCC, AAAUCC, GAAAUCC, AGAAAUCC, UAGAAAUCC, or CAUGAACAUCAUCCUAGAAAUCC. In some embodiments, the sense strand of the dsRNA consists of the nucleotide sequence SIV:5'-z7UUCUGCUUCUGAUCACz8-3', wherein z7 and z8 are each independently as defined above. In some embodiments, the sense strand of the dsRNA consists of the nucleotide sequence SIV':5'-z7'CUUCUGCUUCUGAUCACz8-3', wherein z8 is selected from C, G, A, or U, and z7' is a nucleotide sequence selected from A, U, G, C, AC, UC, GC, CC, GUC, AUC, UUC, AAUC, AAAUC, GAAAUC, AGAAAUC, UAGAAAUC, or CAUGAACAUCAUCCUAGAAAUC. It is understood that the sense strand is substantially or fully complementary to the corresponding antisense strand.

[0016] In some embodiments, z5 is a nucleotide sequence that is substantially or completely complementary to z8. In some embodiments, z6 is a nucleotide sequence that is substantially or completely complementary to z7. In some embodiments, z6' is a nucleotide sequence that is substantially or completely complementary to z7'.

[0017] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the antisense strand of the dsRNA comprises the nucleotide sequence SIII or SIII' as described above, wherein the sense strand and the antisense strand sequence are substantially or fully complementary to each other, forming a duplex region of at least 15, 16, 17, 18, or 19 nucleotides with 0, 1, 2, or 3 mismatches.

[0018] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the antisense strand of the dsRNA consists of the nucleotide sequence SIII or SIII' as described above, wherein the sense strand and the antisense strand sequence are substantially or fully complementary to each other, forming a duplex region of at least 15, 16, 17, 18, or 19 nucleotides with 0, 1, 2, or 3 mismatches.

[0019] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand of the dsRNA comprises the nucleotide sequence SIV and the antisense strand of the dsRNA comprises the nucleotide sequence SIII, wherein the nucleotide sequences SIII and SIV are as described above. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand of the dsRNA consists of the nucleotide sequence SIV and the antisense strand of the dsRNA consists of the nucleotide sequence SIII, wherein the nucleotide sequences SIII and SIV are as described above.

[0020] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand of the dsRNA comprises the nucleotide sequence SIV' and the antisense strand of the dsRNA comprises the nucleotide sequence SIII', wherein the nucleotide sequences SIII' and SIV' are as described above. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand of the dsRNA consists of the nucleotide sequence SIV' and the antisense strand of the dsRNA consists of the nucleotide sequence SIII', wherein the nucleotide sequences SIII' and SIV' are as described above.

[0021] In some embodiments, the dsRNA agent includes at least one modified nucleotide. In certain embodiments, all or substantially all nucleotides of the antisense strand are modified nucleotides. In certain embodiments, all or substantially all nucleotides of the sense strand and the antisense strand are modified nucleotides. In some embodiments, at least one modified nucleotide comprises: 2'-O-methyl nucleotide, 2'-fluoro nucleotide, 2'-deoxy nucleotide, 2'3'-seco nucleotide mimic, locked nucleotide, unlocked nucleic acid nucleotide (UNA), diol nucleic acid nucleotide (GNA), 2'-F-arabino nucleotide, 2'-methoxyethyl nucleotide, abasic nucleotide, ribitol, reverse nucleotide, reverse abasic nucleotide, reverse 2'-OMe nucleotide, reverse 2'-deoxy nucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholino nucleotide, and 3'-OMe nucleotide, nucleotide comprising 5'-phosphorothioate group, 5'-phosphate modified nucleotide or terminal nucleotide connected to cholesterol derivative or dodecanoic acid bisdecylamide group, 2'-amino modified nucleotide, phosphoramidate, or nucleotide comprising non-natural base. In some embodiments, dsRNA agent comprises E-vinyl phosphonate nucleotide at the 5' end of guide strand. In certain embodiments, dsRNA agent comprises at least one phosphorothioate internucleoside bond. In certain embodiments, the sense strand comprises at least one phosphorothioate internucleoside bond. In some embodiments, the antisense strand comprises at least one phosphorothioate internucleoside bond. In some embodiments, the sense strand comprises 1, 2, 3, 4, 5 or 6 phosphorothioate internucleoside bonds. In some embodiments, the antisense strand comprises 1, 2, 3, 4, 5 or 6 phosphorothioate internucleoside bonds. In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoro nucleotides, wherein less than 6 modified nucleotides are 2'-fluoro nucleotides. In certain embodiments, the antisense strand comprises 3 or 5 2'-fluoro nucleotides, preferably, the antisense strand comprises 5 2'-fluoro nucleotides. In certain embodiments, the antisense strand includes 5 2'-fluoro nucleotides and 5'-phosphonate modified nucleotides, preferably, wherein the 5'-phosphonate modified nucleotides are nucleotides comprising vinylphosphonate. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoro nucleotides, wherein fewer than 4 modified nucleotides are 2'-fluoro nucleotides. In certain embodiments, the sense strand comprises 3 2'-fluoro nucleotides.In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoro nucleotides, preferably, at least 16 of the modified nucleotides are 2'-O-methyl nucleotides and the nucleotides at positions 2, 7, 12, 14, and / or 16, counting from the first paired position at the 5' end of the antisense strand, are 2'-fluoro nucleotides. In certain embodiments, the nucleotides at positions 2, 7, 12, 14, and 16, counting from the first paired position at the 5' end of the antisense strand, are 2'-fluoro nucleotides, and the 5' terminal nucleotide of the antisense strand is a vinylphosphonate-containing nucleotide, wherein the vinylphosphonate-containing nucleotide is V Pu* as defined herein. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoro nucleotides, preferably, at least 18 of the modified nucleotides are 2'-O-methyl nucleotides and the nucleotides at positions 9, 11, and / or 13, counting from the first paired position at the 3' end of the sense strand, are 2'-fluoro nucleotides.

[0022] In certain embodiments, the sense strand is complementary or substantially complementary to the antisense strand, and the length of the complementary region is between 16 and 23 nucleotides. In some embodiments, the length of the complementary region is 19-21 nucleotides. In certain embodiments, the length of the complementary region is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the length of each strand is no more than 40 nucleotides. In some embodiments, the length of each strand is no more than 30 nucleotides. In some embodiments, the length of each strand is no more than 25 nucleotides. In some embodiments, the length of each strand is no more than 23 nucleotides. In some embodiments, the length of each strand is no more than 21 nucleotides.

[0023] In certain embodiments, the dsRNA agent includes at least one modified nucleotide and further includes one or more targeting groups or linking groups. In some embodiments, one or more targeting groups or linking groups are conjugated to the sense strand. In some embodiments, the targeting group or linking group includes N-acetyl-galactosamine (GalNAc).

[0024] In certain embodiments, the targeting group has a structure as shown in Formula (X):

[0025]

[0026] Each n" is independently 1 or 2.

[0027] In some embodiments, the targeting group has the following structure:

[0028]

[0029]

[0030]

[0031]

[0032] In certain embodiments, the dsRNA agent includes a targeting group conjugated to the 5'-end of the sense strand. In some embodiments, the dsRNA agent includes a targeting group conjugated to the 3'-end of the sense strand. In some embodiments, the antisense strand comprises a reverse abasic residue at the 3'-end. In certain embodiments, the sense strand comprises one or two reverse abasic residues and / or one or two imann residues at the 3' or / and 5' ends. In some embodiments, the dsRNA agent has two blunt ends. In some embodiments, at least one chain comprises a 3' overhang of at least 1 nucleotide. In some embodiments, at least one chain comprises a 3' overhang of at least 2 nucleotides.

[0033] In certain embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to a portion of an mRNA encoding HSD17B13, wherein each strand is about 14 to about 30 nucleotides in length, wherein the sequence of the sense strand can be represented by Formula (I):

[0034] 5′-(N′ L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ L N′ F N′ L N′ N4 N′ N5 N′ N6 N′ L N′ L N′ L (N′ L ) m′ -3′ (I)

[0035] in:

[0036] Each N′ F represents 2'-fluorine-modified nucleotides;

[0037] Each N′ N1 ,N′ N2 ,N′ N3 ,N′ N4 ,N′ N5 , and N′ N6 independently represent modified or unmodified nucleotides;

[0038] N′ N1 N′ N2 N′ N3 and N′ N4 N′ N5 N′ N6 Each independently represents a motif comprising at least two differently modified nucleotides;

[0039] Each N′ L independently represents modified or unmodified nucleotides, but does not represent 2'-fluoro-modified nucleotides;

[0040] m' and n' are each independently an integer from 0 to 7.

[0041] In some embodiments, n' is 1 and m' is 1, or n' is 1 and m' is 2, or n' is 1 and m' is 3, or n' is 1 and m' is 4, or n' is 1 and m' is 5, or n' is 3 and m' is 1, or n' is 3 and m' is 2, or n' is 3 and m' is 3, or n' is 5 and m' is 1.

[0042] In certain embodiments, the dsRNA agent comprises a targeting group conjugated to the 5'-end of the sense strand, preferably, the targeting group is selected from any one of the aforementioned GLO-1 to GLO-16 and GLS-1 to GLS-16, more preferably, the targeting group is the aforementioned GLS-15. In certain embodiments, the dsRNA agent comprises a targeting group conjugated to the 3'-end of the sense strand. In certain embodiments, the antisense strand comprises an inverted abasic residue at the 3'-end. In certain embodiments, the sense strand comprises one or two inverted abasic residues and / or one or two imann residues at the 3' or / and 5' ends. In certain embodiments, each 3' and 5' end of the sense strand independently comprises an imann residue. In certain embodiments, the sense strand comprises two imann residues at the 3' and 5' ends, and any residue at the 3' or 5' end is further conjugated to a targeting group, which is preferably the aforementioned GLS-15.

[0043] In certain embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to a portion of an mRNA encoding HSD17B13, wherein each strand is about 14 to about 30 nucleotides in length, wherein the antisense strand sequence can be represented by Formula (II):

[0044] 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5′ (II)

[0045] in:

[0046] Each N F represents 2'-fluorine-modified nucleotides;

[0047] Each N M1 ,N M2 ,N M3 ,N M4 ,N M5 ,N M6 ,N M7 and N M8 independently represents a modified or unmodified nucleotide, preferably, N M2 ,N M3 and N M6 Each independently represents a 2'-fluoro-modified nucleotide;

[0048] Each N L independently represents modified or unmodified nucleotides, but does not represent 2'-fluoro-modified nucleotides;

[0049] n is an integer from 0 to 7.

[0050] In some embodiments, n is 1, or n is 2, or n is 3.

[0051] In some embodiments, N M6,N M3 and N M2 Each independently represents a 2'-fluoro modified nucleotide.

[0052] In some embodiments, N M6 ,N M3 and N M2 All are 2'-fluorine-modified nucleotides.

[0053] In some embodiments, the modified nucleotide is a modified nucleotide as defined above.

[0054] In some embodiments, the modified nucleotide is a 2'-OMe modified nucleotide or a 2'-F modified nucleotide. In some embodiments, the antisense strand sequence can be represented by formula (II'):

[0055] 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N Z -5′ (II')

[0056] in,

[0057] Each N F Indicates a 2'-fluoro modified nucleotide, each N M1 ,N M2 ,N M3 ,N M4 ,N M5 ,N M6 ,N M7 and N M8 Each independently represents a modified or unmodified nucleotide, preferably, each N M1 ,N M2 ,N M3 ,N M6 and N M7 independently represents a 2'-fluoro modified nucleotide, each N L N independently represents a modified or unmodified nucleotide but not a 2'-fluorine-modified nucleotide; Zrepresents a nucleotide comprising a phosphonate mimetic, preferably, N Z represents a vinylphosphonate-containing nucleotide; and n is an integer from 0 to 7.

[0058] In certain embodiments, n is 1, or n is 2, or n is 3.

[0059] In certain embodiments, each N M6 ,N M3 and N M2 independently represent 2'-fluoro modified nucleotides.

[0060] In certain embodiments, N M6 ,N M3 and N M2 All are 2'-fluorine-modified nucleotides.

[0061] In some embodiments, the modified nucleotide is a modified nucleotide as defined above.

[0062] In some embodiments, the modified nucleotide is a 2'-OMe modified nucleotide or a 2'-F modified nucleotide. Z It is a vinylphosphonate-modified nucleotide.

[0063] In certain embodiments, N Z V Pu *, its structure is:

[0064] In certain embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to an mRNA encoding HSD17B13, wherein the complementary region comprises at least 15 consecutive nucleotides, wherein the dsRNA duplex can be represented by formula (III):

[0065] Sense: 5′-(N′ L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ L N′ F N′ L N′ N4 N′ N5 N′ N6 N′ LN′ L N′ L (N′ L ) m′ -3′

[0066] Antisense: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5′

[0067] (III)

[0068] in:

[0069] Each strand is about 17 to about 30 nucleotides in length;

[0070] Each N F and N′ F independently represent 2'-fluoro-modified nucleotides;

[0071] N M1 ,N M2 ,N M3 ,N M4 ,N M5 ,N M6 ,N M7 ,N M8 ,N′ N1 ,N′ N2 ,N′ N3 ,N′ N4 ,N′ N5 , and N′ N6 Each independently represents a modified or unmodified nucleotide;

[0072] Each N L and N′ L independently represents a modified or unmodified nucleotide, but not a 2'-fluoro-modified nucleotide;

[0073] And m', n' and n are each independently an integer from 0 to 7.

[0074] In some embodiments, the modified nucleotide is a modified nucleotide as defined above.

[0075] In some embodiments, the modified nucleotide is a 2'-OMe modified nucleotide or a 2'-F modified nucleotide.

[0076] In some embodiments, n' is 1 and m' is 1, or n' is 1 and m' is 2, or n' is 1 and m' is 3, or n' is 1 and m' is 4, or n' is 1 and m' is 5, or n' is 3 and m' is 1, or n' is 3 and m' is 2, or n' is 3 and m' is 3, or n' is 5 and m' is 1.

[0077] In some embodiments, n is 1, or n is 2, or n is 3.

[0078] In some embodiments, N′ N1 N′ N2 N′ N3 and N′ N4 N′ N5 N′ N6 Each independently represents a motif comprising at least two differently modified nucleotides;

[0079] In some embodiments, N M6 ,N M3 and N M2 Each independently represents a 2'-fluoro modified nucleotide; in certain embodiments, N M6 ,N M3 and N M2 All are 2'-fluorine-modified nucleotides.

[0080] In some embodiments, the sense strand and the antisense strand form a dsRNA duplex, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to an mRNA encoding PNPLA3, wherein the complementary region comprises at least 15 consecutive nucleotides, and the dsRNA duplex is represented by Formula (III'):

[0081] Sense strand: 5′-(N′ L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ L N′ F N′ L N′ N4 N′ N5 N′ N6 N′ LN′ L N′ L (N′ L ) m′ -3′

[0082] Antisense strand: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N Z -5′

[0083] (III')

[0084] in:

[0085] Each strand is 17 to 30 nucleotides in length;

[0086] Each N F and N′ F independently represents a 2'-fluoro modified nucleotide; each N M1 ,N M2 ,N M3 ,N M4 ,N M5 ,N M6 ,N M7 ,N M8 ,N′ N1 ,N′ N2 ,N′ N3 ,N′ N4 ,N′ N5 , and N′ N6 independently represents a modified or unmodified nucleotide; each N L and N′ L independently represents a modified or unmodified nucleotide, but not a 2'-fluoro-modified nucleotide; N Z represents a nucleotide containing a phosphonate mimetic, preferably, N Z represents a vinylphosphonate-containing nucleotide; and each of m′, n′ and n is independently an integer from 0 to 7.

[0087] In certain embodiments, the modified nucleotide is a modified nucleotide as defined above.

[0088] In certain embodiments, the modified nucleotide is a 2'-OMe modified nucleotide or a 2'-F modified nucleotide.

[0089] In some embodiments, n′ is 1 and m′ is 1, or n′ is 1 and m′ is 2, or n′ is 1 and m′ is 3, or n′ is 1 and m′ is 4, or n′ is 1 and m′ is 5, or n′ is 3 and m′ is 1, or n′ is 3 and m′ is 2, or n′ is 3 and m′ is 3, or n′ is 5 and m′ is 1.

[0090] In certain embodiments, n is 1, or n is 2, or n is 3.

[0091] In some embodiments, each N′ N1 N′ N2 N′ N3 and N′ N4 N′ N5 N′ N6 independently represent a motif comprising at least two differently modified nucleotides;

[0092] In some embodiments, each N M6 ,N M3 and N M2 independently represents a 2'-fluoro modified nucleotide; in certain embodiments, N M6 ,N M3 and N M2 All are 2'-fluorine-modified nucleotides.

[0093] In certain embodiments, N Z Vinyl phosphate-modified nucleotides.

[0094] In certain embodiments, N Z V Pu *, its structure is:

[0095] In some embodiments, the dsRNA agent includes a targeting group conjugated to the 5'-end of the sense strand, preferably, the targeting group is selected from any one of the aforementioned GLO-1 to GLO-16 and GLS-1 to GLS-16, more preferably, the targeting group is the aforementioned GLS-15. In certain embodiments, the dsRNA agent includes a targeting group conjugated to the 3'-end of the sense strand. In certain embodiments, the antisense strand comprises an inverted abasic residue at the 3'-end. In certain embodiments, the sense strand comprises one or two inverted abasic residues and / or one or two imann residues at the 3' or / and 5' ends. In certain embodiments, the sense strand comprises two imann residues at the 3' and 5' ends. In certain embodiments, each end of the sense strand comprises an inverted abasic residue. In certain embodiments, each end of the sense strand comprises an imann residue. In certain embodiments, the sense strand includes two imann residues at the 3' and 5' ends, and either residue at the 3' or 5' end is further conjugated to a targeting group, preferably GLS-15. In certain embodiments, the dsRNA agent has two blunt ends. In certain embodiments, at least one strand comprises a 3' overhang of at least 1 nucleotide. In certain embodiments, at least one strand comprises a 3' overhang of at least 2 nucleotides.

[0096] In certain embodiments, at least one interlinkage in the sense strand and / or the antisense strand is a phosphodiester interlinkage. In certain embodiments, at least one interlinkage in the sense strand and / or the antisense strand is a modified interlinkage. In certain embodiments, at least one interlinkage in the sense strand and / or the antisense strand is a phosphorothioate interlinkage. In certain embodiments, at least one phosphorothioate interlinkage is present at the 5'-end, 3'-end, or both ends of the sense strand and / or the antisense strand. In certain embodiments, at least one, two, three, four, five, or six phosphorothioate interlinkages are present at the 5'-end, 3'-end, or both ends of the sense strand and / or the antisense strand. In certain embodiments, at least two modified or unmodified nucleotides at one or both ends of the antisense strand are linked by a phosphorothioate interlinkage. In certain embodiments, three modified or unmodified nucleotides at one or both ends of the antisense strand are linked by a phosphorothioate interlinkage. In certain embodiments, at least two modified or unmodified nucleotides at one end or both ends of the sense strand are linked by a phosphorothioate linkage. In certain embodiments, three modified or unmodified nucleotides at one end or both ends of the sense strand are linked by a phosphorothioate linkage. In certain embodiments, three modified or unmodified nucleotides at the 5'-end of the sense strand are linked by a phosphorothioate linkage, and two modified or unmodified nucleotides at the 3'-end of the sense strand are linked by a phosphorothioate linkage. In certain embodiments, the sense strand comprises a phosphorothioate linkage between a targeting group and a reverse abasic residue or imann residue, and a phosphorothioate linkage between a reverse abasic residue or imann residue and a modified or unmodified nucleotide at the 5' end of the sense strand.

[0097] In certain embodiments, any of the sense strands in Table 1 can be further modified according to the pattern shown in Formula (I) or (III) above. In certain embodiments, any of the antisense strands in Table 1 can be further modified according to the pattern shown in Formula (II), (II'), (III) or (III') above. In certain embodiments, any of the duplexes in Table 1 can be modified according to the pattern shown in Formula (III) or (III') above. In certain embodiments, the modified sense strand has any of the modification patterns listed in Tables 2-3. In certain embodiments, the modified antisense strand has any of the modification patterns listed in Tables 2-3. In certain embodiments, the modified sense strand is any of the modified sense strands listed in Tables 2-3. In certain embodiments, the modified antisense strand is any of the modified antisense strands listed in Tables 2-3. In certain embodiments, the dsRNA comprises a duplex consisting of AD00462, AD00463, AD00464, AD00465, AD00466, AD00467, AD00468, AD00469, AD00470, AD00471, AD00472, AD00473, AD00675, AD00676, AD00677, AD00678, AD00679, AD00680, AD00681, AD00682, AD00683, AD00684, AD00685, AD00686, AD00687, AD00688, AD00689, AD00690, AD00691, AD00692, AD00693, AD0069 4. AD00695, AD00696, AD00697, AD00675-1, AD00677-1, AD00678-1, AD00682-1, AD00689-1, AD00675-2, AD00677-2 and AD00678-2.

[0098] According to one aspect of the present invention, a composition is provided, which includes any embodiment of the aforementioned dsRNA agent of the present invention. In certain embodiments, the composition also includes a pharmaceutically acceptable carrier. In some embodiments, the composition also includes one or more other therapeutic agents. In certain embodiments, the composition is packaged in a test kit, container, wrapper, dispenser, prefilled syringe or bottle. In some embodiments, the composition is formulated for subcutaneous administration or is formulated for intravenous (IV) administration.

[0099] According to another aspect of the present invention, a cell is provided, comprising any embodiment of the aforementioned dsRNA agent aspect of the present invention. In some embodiments, the cell is a mammalian cell, optionally a human cell.

[0100] According to another aspect of the present invention, a method for inhibiting the expression of the HSD17B13 gene in a cell is provided, the method comprising: (i) preparing a cell comprising an effective amount of any embodiment of the aforementioned dsRNA agent of the present invention or any embodiment of the aforementioned composition of the present invention. In certain embodiments, the method further comprises: (ii) maintaining the prepared cell for a time sufficient to obtain degradation of the mRNA transcript of the HSD17B13 gene, thereby inhibiting the expression of the HSD17B13 gene in the cell. In some embodiments, the cell is located in the subject and the dsRNA agent is administered subcutaneously to the subject. In some embodiments, the cell is located in the subject and the dsRNA agent is administered to the subject via IV. In certain embodiments, the method further comprises assessing inhibition of the HSD17B13 gene after administering the dsRNA agent to the subject, wherein the means for assessing comprises: (i) determining one or more physiological characteristics of an HSD17B13-associated disease, or (ii) comparing the determined physiological characteristics to a pre-treatment baseline physiological characteristic of the HSD17B13-associated disease or condition and / or to a control physiological characteristic of the HSD17B13-associated disease or condition, wherein the comparison indicates one or more of the presence or absence of inhibition of HSD17B13 gene expression in the subject. In some embodiments, the physiological characteristic is one or more of: HSD17B13 mRNA level and HSD17B13 protein level. Reduction in HSD17B13 expression can also be assessed indirectly by measuring a reduction in the biological activity of HSD17B13, such as a reduction in the enzymatic activity of HSD17B13 and / or a reduction in one or more of lipids, triglycerides, cholesterol (including LDL-C, HDL-C, VLDL-C, IDL-C and total cholesterol) or free fatty acids in plasma or tissue samples, and / or a reduction in fat accumulation and / or expansion of lipid droplets in the liver.

[0101] According to another aspect of the present invention, a method for inhibiting HSD17B13 gene expression in a subject is provided, the method comprising administering to the subject an effective amount of an embodiment of the dsRNA agent aspect of the present invention or an embodiment of the composition of the present invention. In some embodiments, the dsRNA agent is administered subcutaneously to the subject. In certain embodiments, the dsRNA agent is administered to the subject via IV. In some embodiments, the method further comprises: evaluating the inhibition of the HSD17B13 gene after administration of the dsRNA agent, wherein the means for evaluating comprises: (i) determining one or more physiological characteristics of an HSD17B13-related disease or condition. (ii) comparing the determined physiological characteristics with pre-treatment baseline physiological characteristics of the HSD17B13-related disease or condition and / or with physiological characteristics of a control for the HSD17B13-related disease or condition, wherein the comparison indicates one or more of the presence or absence of inhibition of HSD17B13 gene expression in the subject. In some embodiments, the expression of the HSD17B13 gene can be assessed based on the level or level change of any of the following variables associated with the expression of the HSD17B13 gene, such as HSD17B13 mRNA level and HSD17B13 protein level. Reduction in HSD17B13 expression can also be assessed indirectly by measuring a reduction in the biological activity of HSD17B13, such as a reduction in the enzymatic activity of HSD17B13 and / or a reduction in one or more of lipids, triglycerides, cholesterol (including LDL-C, HDL-C, VLDL-C, IDL-C, and total cholesterol), or free fatty acids in plasma or tissue samples, and / or a reduction in fat accumulation and / or expansion of lipid droplets in the liver.

[0102] According to another aspect of the present invention, there is provided a method for treating a disease or condition associated with the presence of an HSD17B13 protein, the method comprising administering to a subject an effective amount of any of the above-described dsRNA agent embodiments of the present invention, or any of the above-described compositions of the present invention, for inhibiting HSD17B13 gene expression. In some embodiments, the disease, condition, or illness associated with HSD17B13 is selected from the group consisting of hepatitis, liver fibrosis, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), HCV-related cirrhosis, drug-induced liver injury, hepatocellular necrosis, and HSD17B13-related obesity. In some embodiments, the method further comprises administering to the subject an additional treatment regimen. In some embodiments, the additional treatment regimen comprises treatment for an HSD17B13-related disease or condition. In certain embodiments, the additional treatment regimen comprises: administering to the subject one or more HSD17B13 antisense polynucleotides of the invention, administering to the subject a non-HSD17B13 dsRNA agent, and behavioral changes to the subject. In some embodiments, the non-HSD17B13 dsRNA agent is one or more of: pyridoxine, an ACE inhibitor (angiotensin converting enzyme inhibitor), such as benazepril (Lotensin); an angiotensin II receptor antagonist (ARB) (e.g., losartan potassium, such as Merck & Co.'s Such as candesartan (Atacand); HMG-CoA reductase inhibitors (e.g., statins); calcium binders, such as sodium cellulose phosphate (Calcibind); diuretics, such as thiazide diuretics, such as hydrochlorothiazide (Microzide); insulin sensitizers, such as PPARγ agonist pioglitazone, glp-1r agonists such as liraglutide, vitamin E, SGLT2 inhibitors, DPPIV inhibitors and kidney / liver transplantation; or a combination of any of the foregoing. In some embodiments, the dsRNA agent is administered subcutaneously to the subject. In certain embodiments, the dsRNA agent is administered to the subject by IV. In some embodiments, the method further comprises determining the efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject. In some embodiments, a method of determining efficacy of a treatment in a subject comprises: (i) determining one or more physiological characteristics of an HSD17B13-associated disease or condition in the subject, and (ii) comparing the determined physiological characteristics to a pre-treatment baseline physiological characteristic of the HSD17B13-associated disease or condition, wherein the comparison indicates one or more of the presence, absence, and level of efficacy of a double-stranded ribonucleic acid (dsRNA) agent administered to the subject. In some embodiments, expression of the HSD17B13 gene can be assessed based on the level or change in level of any variable associated with HSD17B13 gene expression, such as HSD17B13 mRNA level, HSD17B13 protein level, and / or HSD17B13 enzyme activity in the subject, or lipid levels, triglycerides, cholesterol levels (including LDL-C, HDL-C, VLDL-C, IDL-C, and total cholesterol), free fatty acid levels in plasma or tissue samples, or fat levels and / or lipid droplet levels in the liver.

[0103] According to another aspect of the present invention, there is provided a method for reducing the level of HSD17B13 protein in a subject as compared to the pre-treatment baseline level of HSD17B13 protein in the subject, the method comprising administering to the subject an effective amount of any of the aforementioned dsRNA agent embodiments of the present invention or any of the aforementioned composition embodiments of the present invention to reduce the level of HSD17B13 gene expression. In some embodiments, the dsRNA agent is administered to the subject subcutaneously or by IV.

[0104] According to another aspect of the present invention, a method for altering a physiological characteristic of an HSD17B13-related disease or condition in a subject compared to a baseline physiological characteristic of the HSD17B13-related disease or condition in the subject is provided, the method comprising administering to the subject an effective amount of an embodiment of any of the aforementioned dsRNA agents of the present invention or an embodiment of any of the aforementioned compositions of the present invention to alter the physiological characteristic of the HSD17B13-related disease or condition in the subject. In some embodiments, the dsRNA agent is administered subcutaneously to the subject or administered to the subject via IV. In certain embodiments, the physiological characteristic is one or more of: HSD17B13 mRNA levels, HSD17B13 protein levels, and / or HSD17B13 enzymatic activity in the subject, or lipid levels, triglycerides, cholesterol levels (including LDL-C, HDL-C, VLDL-C, IDL-C, and total cholesterol), free fatty acid levels in plasma or tissue samples, or fat levels and / or lipid droplet levels in the liver.

[0105] According to another aspect of the present invention, the dsRNA agent is provided for use in a method for treating a disease or condition associated with the presence of an HSD17B13 protein. In some embodiments, the disease or condition is one or more of the following: hepatitis, liver fibrosis, simple fatty liver (steatosis), non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), HCV-related cirrhosis, drug-induced liver injury, hepatocellular necrosis, and HSD17B13-related obesity.

[0106] According to another aspect of the present invention, an antisense polynucleotide agent for inhibiting the expression of an HSD17B13 protein is provided, the agent comprising 10 to 30 consecutive nucleotides, wherein at least one of the consecutive nucleotides is a modified nucleotide, and wherein the nucleotide sequence of the agent is about 80% complementary to the equivalent region of the nucleotide sequence of SEQ ID NO: 1 over its entire length. In some embodiments, the equivalent region is any target region of SEQ ID NO: 1 and the complementary sequence is any sequence provided in one of Tables 1-3. In certain embodiments, the antisense polynucleotide agent comprises one of the antisense sequences provided in one of Tables 1-3.

[0107] According to another aspect of the present invention, a composition comprising any of the aforementioned antisense polynucleotide agents is provided. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition further comprises one or more additional therapeutic agents for treating HSD17B13-related diseases or conditions. In certain embodiments, the composition is packaged in a test kit, container, wrapper, dispenser, prefilled syringe, or vial. In certain embodiments, the composition is formulated for subcutaneous or IV administration.

[0108] According to another aspect of the present invention, there is provided a cell comprising any of the aforementioned embodiments of the antisense polynucleotide agent.In some embodiments, the cell is a mammalian cell, optionally a human cell.

[0109] According to another aspect of the present invention, a method for inhibiting the expression of the HSD17B13 gene in a cell is provided, the method comprising: (i) preparing a cell comprising an effective amount of any of the aforementioned antisense polynucleotide embodiments. In some embodiments, the method further comprises (ii) maintaining the cell prepared in (i) for a period of time sufficient to achieve degradation of the mRNA transcript of the HSD17B13 gene, thereby inhibiting the expression of the HSD17B13 gene in the cell.

[0110] According to another aspect of the present invention, there is provided a method of inhibiting HSD17B13 gene expression in a subject, the method comprising administering to the subject an effective amount of any of the aforementioned antisense polynucleotide agent embodiments.

[0111] According to another aspect of the present invention, a method for treating a disease or condition associated with the presence of an HSD17B13 protein comprises administering to a subject an effective amount of any of the aforementioned antisense polynucleotide agents of the present invention or an embodiment of any of the aforementioned compositions of the present invention to inhibit the expression of the HSD17B13 gene. In certain embodiments, the disease or condition is one or more of the following: hepatitis, liver fibrosis, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), HCV-related cirrhosis, drug-induced liver injury, hepatocellular necrosis, and HSD17B13-related obesity.

[0112] According to another aspect of the present invention, a method is provided for reducing the level of HSD17B13 protein in a subject compared to a pre-treatment baseline level of HSD17B13 protein in the subject, the method comprising administering to the subject an effective amount of any of the aforementioned antisense polynucleotide agents or any of the aforementioned compositions to reduce the level of HSD17B13 gene expression. In certain embodiments, the antisense polynucleotide agent is administered to the subject subcutaneously or via IV.

[0113] According to another aspect of the present invention, an antisense polynucleotide agent for inhibiting the expression of the HSD17B13 gene is provided, the agent comprising 10 to 30 consecutive nucleotides, wherein at least one of the consecutive nucleotides is a modified nucleotide, and wherein the nucleotide sequence of the agent is about 80% or about 85% complementary to the equivalent region of the nucleotide sequence of SEQ ID NO: 1 over its entire length.

[0114] According to another aspect of the present invention, a method is provided for altering a physiological characteristic of an HSD17B13-related disease or condition in a subject compared to a pre-treatment baseline physiological characteristic of the HSD17B13-related disease or condition in the subject, the method comprising administering to the subject an effective amount of any of the aforementioned embodiments of the antisense polynucleotide agent or any of the aforementioned embodiments of the composition of the present invention to alter the physiological characteristic of the HSD17B13 disease or condition in the subject. In some embodiments, the antisense polynucleotide agent is administered to the subject subcutaneously or by IV. In some embodiments, the physiological characteristic is one or more of: HSD17B13 mRNA levels, HSD17B13 protein levels, and / or HSD17B13 enzymatic activity in the subject, or lipid levels, triglycerides, cholesterol levels (including LDL-C, HDL-C, VLDL-C, IDL-C, and total cholesterol), free fatty acid levels in plasma or tissue samples, or fat levels and / or lipid droplet levels in the liver.

[0115] Sequence Description

[0116] SEQ ID NO: 1 and SEQ ID NO: 2 (reverse complement) are Homo sapiens 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [NCBI Reference Sequence: NM_178135.5].

[0117] SEQ ID NO: 3 and SEQ ID NO: 4 (reverse complement) are Homo sapiens 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [NCBI Reference Sequence: NM_001136230.3].

[0118] SEQ ID NO: 5 and SEQ ID NO: 6 (reverse complement) are Homo sapiens 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [Source: HGNC Symbol; Acc: HGNC: 18685; Transcript: ENST00000302219.10].

[0119] SEQ ID NO: 7 and SEQ ID NO: 8 (reverse complement) are predicted cynomolgus monkey 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [NCBI Reference Sequence: XM_005555367.2].

[0120] SEQ ID NO: 9 and SEQ ID NO: 10 (reverse complement) are predicted cynomolgus monkey 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [Source: HGNC Symbol; Acc: HGNC: 18685; Transcript: ENSMFAT00000009821.2].

[0121] SEQ ID NO: 11 and SEQ ID NO: 12 (reverse complement) are predicted cynomolgus monkey 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [Source: HGNC Symbol; Acc: HGNC: 18685; Transcript: ENSMFAT00000009826.2].

[0122] SEQ ID NO: 13 and SEQ ID NO: 14 (reverse complement) are predicted macaque 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [NCBI Reference Sequence: XM_015138766.2].

[0123] SEQ ID NO: 15 and SEQ ID NO: 16 (reverse complement) are predicted macaque 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [Source: HGNC Symbol; Acc: VGNC: 73417; Transcript: ENSMMUT00000062701.2].

[0124] SEQ ID NO: 17 and SEQ ID NO: 18 (reverse complement) are Mus musculus 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [NCBI Reference Sequence: NM_001163486.1].

[0125] SEQ ID NO: 19 and SEQ ID NO: 20 (reverse complement) are Mus musculus 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [NCBI Reference Sequence: NM_198030.2].

[0126] SEQ ID NO: 21 and SEQ ID NO: 22 (reverse complement) are Mus musculus 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [Source: MGI Symbol; Acc: MGI: 2140804; Transcript: ENSMUST00000048118.15].

[0127] SEQ ID NO: 23 and SEQ ID NO: 24 (reverse complement) are Mus musculus 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [Source: MGI Symbol; Acc: MGI: 2140804; Transcript: ENSMUST00000120320.8].

[0128] SEQ ID NO: 25 and SEQ ID NO: 26 (reverse complement) are Mus musculus 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [Source: MGI Symbol; Acc: MGI: 2140804; Transcript: ENSMUST00000112803.3].

[0129] SEQ ID NO: 27 and SEQ ID NO: 28 (reverse complement) are Rattus norvegicus 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [NCBI Reference Sequence: NM_001009684.1].

[0130] SEQ ID NO: 29 and SEQ ID NO: 30 (reverse complement) are Rattus norvegicus 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [NCBI Reference Sequence: XR_005492928.1].

[0131] SEQ ID NO: 31 and SEQ ID NO: 32 (reverse complement) are Rattus norvegicus 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) mRNA [Source: RGD Symbol; Acc: 1359553; Transcript:

[0132] ENSRNOT00000038188.2].

[0133] SEQ ID NOs: 33-288, 837-917 are shown in Table 1 and are sense strand sequences.

[0134] SEQ ID NOs: 289-544, 918-998 are shown in Table 1 and are antisense strand sequences.

[0135] SEQ ID NOs: 545-750, 999-1178 are shown in Table 2, where chemical modifications are indicated by: uppercase: 2'-fluoro; lowercase: 2'-OMe; and phosphorothioate: *. Those skilled in the art will appreciate that "*" is a symbol indicating a linkage relationship, wherein the presence of "*" indicates that the monomers are linked to each other via a phosphorothioate diester bond, and the absence of "*" between two monomers indicates that the monomers are linked to each other via a phosphodiester bond; and invab = inverted abasic. SEQ ID NOs: 751-836, 1179-1188 are shown in Table 3. The delivery molecule is indicated as "GLX-__" at the 3' or 5' end of each sense strand. Chemical modifications are represented by: uppercase: 2'-Fluoro; lowercase: 2'-OMe; and phosphorothioate: *; those skilled in the art will understand that "*" is a symbol indicating a linking relationship, where the presence of "*" means that the monomers are connected to each other through a phosphorothioate diester bond, and the absence of "*" between two monomers indicates that the monomers are connected to each other through a phosphodiester bond; invab = inverted abasic. imann: located at the end of each chain or further conjugated with a delivery molecule VPu*: DETAILED DESCRIPTION

[0136] The present invention includes, in part, RNAi agents, such as, but not limited to, double-stranded (ds) RNAi agents, which are capable of inhibiting the expression of the 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) gene. The present invention also includes, in part, compositions comprising HSD17B13 RNAi agents and methods of using the compositions. The HSD17B13 RNAi agents disclosed herein can be attached to a delivery compound for delivery to cells, including hepatocytes. The pharmaceutical compositions of the present invention may include at least one dsHSD17B13 agent and a delivery compound. In some embodiments of the compositions and methods of the present invention, the delivery compound is a delivery compound containing GalNAc. The HSD17B13 RNAi agent delivered to the cell is capable of inhibiting the expression of the HSD17B13 gene, thereby reducing the activity of the HSD17B13 protein product of the gene in the cell. The dsRNAi agents of the present invention can be used to treat HSD17B13-related diseases and conditions.

[0137] In some embodiments of the present invention, reducing HSD17B13 expression in a cell or subject treats a disease or condition associated with HSD17B13 expression in the cell or subject, respectively. Non-limiting examples of diseases and conditions that can be treated by reducing HSD17B13 activity are: hepatitis, liver fibrosis, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), HCV-related cirrhosis, drug-induced liver injury, hepatocellular necrosis, HSD17B13-related obesity, or other diseases where reducing HSD17B13 protein levels and activity has a medical benefit.

[0138] As used herein, "G," "C," "A," and "U" generally represent nucleotides containing guanine, cytosine, adenine, and uracil as bases, respectively. However, it will be understood that the term "ribonucleotide" or "nucleotide" may also refer to modified nucleotides, as shown below, or nucleotide analogs. It will be understood by those skilled in the art that guanine, cytosine, adenine, and uracil may be substituted with other moieties without substantially changing the basic pairing properties of the oligonucleotide containing the nucleotides containing such substitution moieties. For example, without limitation, a nucleotide containing inosine as a base may base pair with a nucleotide containing adenine, cytosine, or uracil. Therefore, a nucleotide containing, for example, inosine may be used to replace a nucleotide containing uracil, guanine, or adenine in the nucleotide sequences of the present invention. Sequences containing such substitution moieties are embodiments of the present invention.

[0139] As used herein, "17β-hydroxysteroid dehydrogenase type 13" is used interchangeably with the term "HSD17B13" and refers to a naturally occurring gene encoding a 17-hydroxysteroid dehydrogenase type 13 protein from any vertebrate or mammal, including but not limited to humans, cows, chickens, rodents, mice, rats, pigs, sheep, primates, monkeys, and guinea pigs, unless otherwise indicated. The term also refers to fragments and variants of native HSD17B13 that retain at least one in vivo or in vitro activity of native HSD17B13. The amino acid and complete coding sequence of the human HSD17B13 gene reference sequence can be found, for example, in GenBank Ref Seq Accession No. NM_178135.5 (SEQ ID NO: 1 and SEQ ID NO: 2); GenBank Ref Seq Accession No. NM_001136230.3 (SEQ ID NO: 3 and SEQ ID NO: 4); HGNC transcript: ENST00000302219.10 (SEQ ID NO: 5 and SEQ ID NO: 6).Mammalian orthologs of the human HSD17B13 gene can be found, for example, in GenBank RefSeq Accession No. XM_005555367.2, cynomolgus monkey (SEQ ID NO: 7 and SEQ ID NO: 8); HGNC transcript: ENSMFAT00000009821.2, cynomolgus monkey (SEQ ID NO: 9 and SEQ ID NO: 10); HGNC transcript: ENSMFAT00000009826.2, cynomolgus monkey (SEQ ID NO: 11 and SEQ ID NO: 12); GenBank Ref Seq Accession No. XM_015138766.2, macaque monkey (SEQ ID NO: 13 and SEQ ID NO: 14); VGNC transcript: ENSMMUT00000062701.2, macaque monkey (SEQ ID NO: 15 and SEQ ID NO: 16); GenBank Ref Seq accession number NM_001163486.1, mouse, (SEQ ID NO: 17 and SEQ ID NO: 18); GenBank Ref Seq accession number NM_198030.2, mouse, (SEQ ID NO: 19 and SEQ ID NO: 20); MGI transcript: ENSMUST00000048118.15, mouse, (SEQ ID NO: 21 and SEQ ID NO: 22); MGI transcript: ENSMUST00000120320.8, mouse, (SEQ ID NO: 23 and SEQ ID NO: 24); MGI transcript: ENSMUST00000112803.3, mouse, (SEQ ID NO: 25 and SEQ ID NO: 26); GenBank Ref Seq accession number NM_001009684.1, rat (SEQ ID NO: 27 and SEQ ID NO: 28); GenBank Ref Seq accession number XR_005492928.1, rat (SEQ ID NO: 29 and SEQ ID NO: 30); RGD transcript: ENSRNOT00000038188.2, rat (SEQ ID NO: 31 and SEQ ID NO: 32). Other examples of HSD17B13 mRNA sequences can be readily obtained using publicly available databases such as GenBank, UniProt, Ensembl, and OMIM.

[0140] The following describes how to prepare and use compositions comprising HSD17B13 single-stranded (ssRNA) and dsRNA agents to inhibit HSD17B13 gene expression, as well as compositions and methods for treating diseases and conditions caused or regulated by HSD17B13 gene expression. The term "RNAi" is also known in the art and may be referred to as "siRNA."

[0141] As used herein, the term "RNAi" refers to an agent comprising RNA and mediating targeted cutting of RNA transcripts by RNA-induced silencing complex (RISC) pathways. As known in the art, RNAi target region, which is also defined as "target region" or "target portion", refers to a continuous portion of the nucleotide sequence of an mRNA molecule formed during gene transcription, including messenger RNA (mRNA) of the RNA processing product of the primary transcript. The target portion of the sequence will be at least long enough to be used as a substrate for RNAi directed cutting at or near the portion. The target sequence can be 8 to 30 nucleotides long (including endpoints), 10 to 30 nucleotides long (including endpoints), 12 to 25 nucleotides long (including endpoints), 15 to 23 nucleotides long (including endpoints), 16 to 23 nucleotides long (including endpoints), or 18 to 23 nucleotides long (including endpoints), including all shorter lengths within each specified range. In some embodiments of the invention, the target sequence is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides long. In certain embodiments, the target sequence is 9 to 26 nucleotides long (inclusive), including all subranges and integers therebetween. For example, although not intended to be limiting, in certain embodiments of the invention, the target sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long, and its sequence is completely or at least substantially complementary to at least a portion of the RNA transcript of the HSD17B13 gene. Some aspects of the invention include pharmaceutical compositions comprising one or more HSD17B13 dsRNA agents and a pharmaceutically acceptable carrier. In certain embodiments of the present invention, the HSD17B13 RNAi described herein inhibits the expression of the HSD17B13 protein.

[0142] As used herein, "dsRNA agent" means a composition containing RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules that are capable of degrading or inhibiting translation of messenger RNA (mRNA) transcripts of target mRNA in a sequence-specific manner. Although not wishing to be bound by a particular theory, the dsRNA agents of the present invention may act through an RNA interference mechanism (i.e., by inducing RNA interference by interacting with the RNA interference pathway machinery of mammalian cells (RNA-induced silencing complex or RISC)), or through any alternative mechanism or approach. Methods for silencing genes in plant, invertebrate, and vertebrate cells are well known in the art [see, e.g.,

[0143] (Sharp et al., Genes Dev. 2001, 15:485; Bernstein, et al., (2001) Nature 409:363; Nykanen, et al., (2001) Cell 107:309; and Elbashir, et al., (2001) Genes Dev. 15:188)], the disclosures of each of which are incorporated herein by reference in their entirety. Gene silencing procedures known in the art can be used in conjunction with the disclosure provided herein to inhibit the expression of HSD17B13.

[0144] The dsRNA agents disclosed herein are composed of a sense strand and an antisense strand, and include, but are not limited to, short interfering RNA (siRNA), RNAi agents, microRNA (miRNA), short hairpin RNA (shRNA), and dicer substrates. The antisense strand of the dsRNA agents described herein is at least partially complementary to the targeted mRNA. It is understood in the art that dsRNA duplex structures of different lengths can be used to inhibit target gene expression. For example, dsRNAs with duplex structures of 19, 20, 21, 22, and 23 base pairs are known to effectively induce RNA interference (Elbashir et al., EMBO 2001, 20: 6877-6888). It is also known in the art that shorter or longer RNA duplex structures can also effectively induce RNA interference. As used herein, the terms "double-stranded region," "duplex region," and "complementary region" are used interchangeably and refer to a region in which the sense strand is completely or substantially completely complementary to the antisense strand, as is known in the art. HSD17B13 dsRNAs in certain embodiments of the present invention may include at least one strand with a minimum length of 21 nt, or may have shorter duplexes that are effective by reducing one, two, three, or four nucleotides from one or both ends of one of the sequences shown in any one of Tables 1-3, respectively, compared to the dsRNAs listed in Tables 1-3. In some embodiments of the present invention, HSD17B13 dsRNA agents may have a partial sequence of at least 15, 16, 17, 18, 19, 20, or more consecutive nucleotides from one or more of the sequences in Tables 1-3, and their ability to inhibit HSD17B13 gene expression does not differ by more than 5%, 10%, 15%, 20%, 25%, or 30% from the level of inhibition produced by dsRNAs containing the complete sequence. The sense sequences, antisense sequences, and duplexes disclosed in Tables 1-3 may be referred to herein as "parent" sequences, meaning that the sequences disclosed in Tables 1-3 may be modified, shortened, extended, include substitutions, etc., and as described herein, the resulting sequences retain all or at least part of the efficacy of their parental sequences in the methods and compositions of the present invention. The sense and antisense strands included in the dsRNA of the present invention are independently selected. As used herein, the term "independent selection" means that each of two or more similar elements can be selected independently of the selection of other elements. For example, although not intended to be limiting, when preparing the dsRNA of the present invention, "elements" of the two chains can be selected to be included in the duplex.One selected element, the sense sequence, can be SEQ ID NO: 546 (shown in Table 2), while another selected element, the antisense sequence, can be SEQ ID NO: 649, or can be a modified SEQ ID NO: 649 that is shortened, lengthened, and / or includes 1, 2, or 3 substitutions compared to its parent sequence, SEQ ID NO: 649. It should be understood that the duplexes of the present invention need not include the sense and antisense sequences listed in Tables 1-3 paired in the duplex. Each sense and antisense strand sequence in the table is followed by its SEQ ID NO.

[0145] Certain embodiments of the compositions and methods of the present invention include single-stranded RNA in a composition and / or administered to a subject. For example, an antisense strand, such as any of the antisense strands listed in Tables 1-3, can be a composition or administered to a subject in a composition to reduce HSD17B13 polypeptide activity and / or HSD17B13 gene expression in a subject. Tables 1-3 show the antisense strand and sense strand core extension base sequences of certain HSD17B13 dsRNA agents. Single-stranded antisense molecules that can be included in certain compositions of the present invention and / or administered in certain methods of the present invention are referred to herein as "single-stranded antisense agents" or "antisense polynucleotide agents." Single-stranded sense molecules that can be included in certain compositions of the present invention and / or administered in certain methods of the present invention are referred to herein as "single-stranded sense agents" or "sense polynucleotide agents." The term "base sequence" is used herein to refer to a polynucleotide sequence that is not chemically modified or delivered. For example, the sense strand GAUUGGUUCUGUGGGAUAUUA (SEQ ID NO: 40) shown in Table 1 is the base sequence of SEQ ID NO: 552 in Table 2 and SEQ ID NO: 752 in Table 3, wherein SEQ ID NO: 552 and SEQ ID NO: 752 are shown together with their chemical modifications and delivery compounds. Sequences disclosed herein can be assigned identifiers. For example, a single-stranded sense sequence can be identified by "sense strand SS#"; a single-stranded antisense sequence can be identified by "antisense strand AS#," and a duplex comprising the sense and antisense strands can be identified by "duplex AD# / AV#."

[0146] Table 1 includes a sense strand and an antisense strand, and provides identification numbers for duplexes formed by the sense strand and the antisense strand on the same row in Table 1. Sense strands SEQ ID Nos: 183-288 include random nucleobases (n) at positions 1, 2, 3, and 21 from the 5' end. Antisense strands SEQ ID Nos: 439-544 include random nucleobases (n) at positions 1, 19, 20, and 21 from the 5' end. In certain embodiments of the present invention, the antisense sequence includes nucleobase u or nucleobase a at position 1 of the antisense sequence. In certain embodiments of the present invention, the antisense sequence includes nucleobase u at position 1 of the antisense sequence. In certain embodiments of the present invention, the antisense sequence includes nucleobase u at position 1 of the antisense sequence. In the sequences shown in Table 1, "n" can be represented as a nucleotide comprising any one of a, u, c, g, and t, and the sense strand and the antisense strand can be independently selected, and each "n" in the sense strand or the antisense strand can be the same or different. As used in the context of "n" in the sense and antisense strands, it is understood that the nucleobase "n" selected and included in a position in the sense strand is a different nucleobase than "n" in the antisense strand with which the sense strand is paired, but is generally complementary to the nucleobase "n" at the matching position in the opposite strand. As used herein, the term "matching position" in the sense and antisense strands refers to the position in each strand that is "paired" when the two strands are strands of a duplex. For example, in a 21 nucleobase sense strand and a 21 nucleobase antisense strand, the nucleobase at position 1 of the sense strand and the nucleobase at position 21 of the antisense strand are in a "matching position." In another non-limiting example, in a 23 nucleobase sense strand and a 23 nucleobase antisense strand, nucleobase 2 of the sense strand and the nucleobase at position 22 of the antisense strand are in a matching position. In another non-limiting example, in an 18 nucleobase sense strand and an 18 nucleobase antisense strand, nucleobase 1 in the sense strand is in a matched position with nucleobase 18 in the antisense strand, and nucleobase 4 in the sense strand is in a matched position with nucleobase 15 in the antisense strand. One skilled in the art will understand how to identify matched positions in the sense and antisense strands of strands that are or will be duplexes and paired strands.

[0147] Although (n) can be any of a, u, c, g, or t, the "n" at position 1 of the sense strand is typically complementary to the (n) at position 21 of the antisense strand. In two non-limiting examples, (1) if position 1 of the sense strand is "g," then position 21 of the antisense strand is "c"; and (2) if position 1 of the sense strand is "a," then position 21 of the antisense strand is "u" or "t." This type of complementary matching pairing applies to (n) at position 2 of the sense strand and position 20 of the antisense strand; and (n) at position 21 of the sense strand and position 1 of the antisense strand. It should be understood that although n can be any nucleotide at these positions, the nucleotides of the sense and antisense strands are typically still complementary (matched), however, in certain embodiments, they may have mismatches. For example, although not intended to be limiting, in some embodiments, "n" can be "random," meaning that they can, but do not have to, be complementary. In certain embodiments, "n" is complementary. As a non-limiting example, the "n" at position 1 of the antisense strand is "u," and the "n" at position 21 of the sense strand is "a." One skilled in the art will understand how to identify matching positions of the sense and antisense strands that are or will be in a duplex and paired strands.

[0148] The last column in Table 1 represents a duplex, duplex AD#, that includes the sense and antisense sequences listed in the same row. For example, Table 1 discloses a duplex designated as duplex AD#AD00519.um, which includes a sense strand of SEQ ID NO: 33 and an antisense strand of SEQ ID NO: 289. Thus, each row in Table 1 identifies a duplex of the invention, with each row containing both the sense and antisense sequences displayed in the same row, and the designated identifier for each duplex displayed in the last column of that row.

[0149] In some embodiments of the methods of the present invention, a RNAi agent comprising a polynucleotide sequence shown in Table 1 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to the subject comprises a duplex comprising at least one base sequence listed in Table 1, including 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 sequence modifications. In some embodiments of the methods of the present invention, a RNAi agent comprising a polynucleotide sequence shown in Table 1 is linked to a delivery molecule, a non-limiting example of which is a delivery compound comprising a GalNAc compound or a GLS-15 compound.

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161] Table 2 shows the antisense strand and sense strand sequences of certain chemical modifications of the present invention. In some embodiments of the present invention, the RNAi agent with the polynucleotide sequence shown in Table 2 is applied to cells and / or subjects. In some embodiments of the present invention, the RNAi agent with the polynucleotide sequence shown in Table 2 is applied to subjects. In some embodiments of the present invention, the RNAi agent administered to the subject comprises a duplex identified by a row in the first column of Table 2, and comprises the sequence modifications shown in the sense strand sequence and antisense strand sequence in the third and sixth columns of the same row of Table 2, respectively. In some embodiments of the present invention, the sequence shown in Table 2 can be connected to (also referred to herein as "conjugated to") a compound capable of delivering the RNAi agent to cells and / or tissues in the subject. Non-limiting examples of delivery compounds that can be used in certain embodiments of the present invention are compounds containing GalNAc or compounds containing GLS-15. In Table 2, the first column represents the duplex AV# of the base sequence as shown in Table 1. Table 2 discloses duplexes AV# and also shows the chemical modifications contained in the sense and antisense sequences of the duplexes. For example, Table 1 shows the single-stranded base sequences SEQ ID NO: 33 (sense) and SEQ ID NO: 289 (antisense), which together form a duplex identified as Duplex AD#AD00519.um, and Table 2 lists duplex AV#AV00519, which indicates that the duplexes of SEQ ID NO: 545 and SEQ ID NO: 648 contain the base sequences of SEQ ID NO: 33 and SEQ ID NO: 289, respectively, but have the chemical modifications shown in the sense and antisense sequences shown in the third and sixth columns, respectively. The "Sense Strand SS#" in the second column of Table 2 is the identifier assigned to the sense sequence (including modifications) shown in the third column of the same row. The "Antisense Strand AS#" in the fifth column of Table 2 is the identifier assigned to the antisense sequence (including modifications) shown in the sixth column.

[0162]

[0163]

[0164]

[0165]

[0166]

[0167]

[0168] Table 3 shows the antisense strand and sense strand sequences of certain chemically modified HSD17B13 RNAi agents of the present invention. In some embodiments of the inventive method, the RNAi agent shown in Table 3 is administered to a cell and / or a subject. In some embodiments of the inventive method, the RNAi agent with the polynucleotide sequence shown in Table 3 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to the subject comprises a duplex identified in a row in the first column of Table 3, and includes sequence modifications and / or delivery compounds shown in the sense and antisense strand sequences of the third and sixth columns, respectively, in the same row of Table 3. This sequence is used for certain in vivo test studies described elsewhere herein. In some embodiments of the inventive method, the sequence shown in Table 3 can be connected to (also referred to herein as "conjugated to") a compound for delivery, a non-limiting example of which is a compound containing GalNAc, wherein the delivery compound is identified as "GLX-n" on the sense strand of the third column in Table 3. As used herein, "GLX-n" is used to refer to a "GLS-n" or "GLO-n" delivery compound ("X" can be "S" or "O") and GLX-O can be any "GLS-n" and "GLO-n" delivery compound can be attached to the 3' end or the 5' end of the oligonucleotide during synthesis. As used herein and as shown in Table 3, "GLX-n" is used to indicate that the attached GalNAc-containing compound is any one of the following compounds: GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15 and GLO-16, each of which has its own structure provided elsewhere herein. Those skilled in the art will be able to prepare and use the dsRNA compounds of the present invention wherein the linked delivery compound is one of the following compounds: GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15 and GLO-16.The first column of Table 3 provides the duplex AD# assigned to the duplex of the sense and antisense sequences in the row of the table. For example, duplex AD#AD00462 is a duplex of the sense strand SEQ ID NO:752 and the antisense strand SEQ ID NO:795. Each row in Table 3 provides a sense strand and an antisense strand and discloses the duplex of the sense strand and the antisense strand. The "Sense Strand SS#" in the second column of Table 3 is the identifier assigned to the sense sequence (including modifications) shown in the third column of the same row. The "Antisense Strand AS#" in the fifth column of Table 3 is the identifier assigned to the antisense sequence (including modifications) shown in the sixth column. Certain linked GalNAc-containing "GLO-n" or "GLS-n" compounds are shown as GLS-5, GLS-15, or GLX-0, and it is understood that another of the "GLO-n" or "GLS-n" compounds can be substituted for the compound shown as GLO-0, and the resulting compounds are included in embodiments of the methods and / or compositions of the present invention. GLO-0 refers to compound GalNAc3 in Jayaprakash, et al., (2014) J. Am. Chem. Soc., 136, 16958-16961 or compound L96 in WO2015006740.

[0169]

[0170]

[0171] In certain embodiments of the present invention, the dsRNA (also referred to herein as a "duplex") is a dsRNA disclosed in one of Tables 1-3. Each row in Tables 1-3 discloses a duplex comprising the sense strand sequence and the antisense strand sequence in that row of the table. In addition to the duplexes disclosed in Tables 1-3, it should be understood that in some embodiments, the duplexes of the present invention can include the sense and antisense sequences shown in Tables 1-3, which differ from the sequences shown in Tables 1-3 by zero, one, two, or three nucleotides. Thus, as a non-limiting example, in some embodiments, the antisense strand in the duplex of the present invention can be SEQ ID NO: 808, 809, 810, 811, 815, 816, or 817, which differs from the nucleotide sequence in SEQ ID NO: 808, 809, 810, 811, 815, 816, or 817 by zero, one, two, or three nucleotides, respectively.

[0172] It should be understood that the sequence of the sense strand and the sequence of the antisense strand in the duplex of the present invention can be selected independently. Therefore, the dsRNA of the present invention can include the sense strand and antisense strand of the duplex disclosed in the same row in Tables 1-3. Alternatively, in the dsRNA of the present invention, one or both of the sense strand and antisense strand selected in the dsRNA can include the sequences shown in Tables 1-3, but one or both of the sense strand and antisense sequences include 1, 2, 3 or more core base substitutions from the parent sequence. In some embodiments, the selected sequence can be longer or shorter than their parent sequence. Therefore, the dsRNA reagent included in the present invention can, but need not, include the precise sequence of the sense and antisense pairs disclosed as duplexes in Tables 1-3.

[0173] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, nucleotide positions 2 to 18 in the antisense strand comprising a region of complementarity to an HSD17B13 RNA transcript, wherein the region of complementarity comprises at least 15 consecutive nucleotides that differ from one of the antisense sequences listed in one of Tables 1-3 by 0, 1, 2, or 3 nucleotides, and optionally comprises a targeting ligand. In some cases, the region of complementarity to the HSD17B13 RNA transcript comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from one of the antisense sequences listed in one of Tables 1-3 by no more than 3 nucleotides. In some embodiments of the dsRNA agents of the invention, the antisense strand of the dsRNA is at least substantially complementary to any one of the target regions of SEQ ID NO: 1 and is provided in any one of Tables 1-3. In some embodiments, the antisense strand of the dsRNA agents of the invention is fully complementary to any one of the target regions of SEQ ID NO: 1 and is provided in any one of Tables 1-3. In some embodiments, the dsRNA agent comprises a sense strand sequence listed in any one of Tables 1-3, and the sense strand sequence is at least substantially complementary to the antisense strand sequence in the dsRNA agent. In other embodiments, the dsRNA agent of the present invention comprises a sense strand sequence listed in any one of Tables 1-3, and the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In some cases, the dsRNA agent of the present invention comprises an antisense strand sequence listed in any one of Tables 1-3. Some embodiments of the dsRNA agent of the present invention comprise a sense sequence and an antisense sequence disclosed as a duplex in any one of Tables 1-3. As described herein, it should be understood that the sense strand and antisense strand in the duplex of the present invention can be independently selected.

[0174] mismatch

[0175] It is known to those skilled in the art that mismatches are tolerated for efficacy in dsRNA, especially mismatches in the terminal regions of the dsRNA. Certain mismatches are better tolerated, for example, mismatches with wobble base pairs G:U and A:C are better tolerated for efficacy (Du et el., A systematic analysis of the silencing effects of anactive siRNA at all single-nucleotide mismatched target sites. Nucleic Acids Res. 2005 Mar 21; 33(5): 1671-7. Doi: 10.1093 / nar / gki312. Nucleic Acids Res. 2005; 33(11): 3698). In some embodiments of the methods and compounds of the present invention, the HSD17B13 dsRNA agent may contain one or more mismatches with the HSD17B13 target sequence. In some embodiments, the HSD17B13 dsRNA agent of the present invention does not contain mismatches. In certain embodiments, the HSD17B13 dsRNA agent of the present invention includes no more than 1 mismatch. In some embodiments, the HSD17B13 dsRNA agent of the present invention includes no more than 2 mismatches. In certain embodiments, the HSD17B13 dsRNA agent of the present invention includes no more than 3 mismatches. In some embodiments of the present invention, the antisense strand of the HSD17B13 dsRNA agent contains a mismatch with the HSD17B13 target sequence that is not located at the center of the complementary region. In some embodiments, the antisense strand of the HSD17B13 dsRNA agent includes 1, 2, 3, 4 or more mismatches within the last 5, 4, 3, 2 or 1 nucleotides of one or both of the 5' end or 3' end of the complementary region. The methods described herein and / or methods known in the art can be used to determine whether an HSD17B13 dsRNA agent containing a mismatch with the HSD17B13 target sequence effectively inhibits the expression of the HSD17B13 gene.

[0176] Complementarity

[0177] As used herein, unless otherwise indicated, the term "complementary" as used herein, when describing a first nucleotide sequence (e.g., the sense strand of an HSD17B13 dsRNA agent or a target HSD17B13 mRNA) relative to a second nucleotide sequence (e.g., the antisense strand of an HSD17B13 dsRNA agent or a single-stranded antisense polynucleotide), refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (form base pair hydrogen bonds under mammalian physiological conditions (or similar in vitro conditions)) with an oligonucleotide or polynucleotide comprising the second nucleotide sequence and to form a duplex or double helical structure under certain conditions. Other conditions may also be applicable, such as physiologically relevant conditions that may be encountered in vivo. One skilled in the art will be able to determine the most appropriate set of conditions for testing the complementarity of two sequences based on the ultimate application of the hybridizing nucleotides. At least to the extent that the above hybridization requirements are met, complementary sequences comprise Watson-Crick base pairs or non-Watson-Crick base pairs and comprise natural or modified nucleotides or nucleotide mimetics. Sequence identity or complementarity is independent of modification.

[0178] For example, a complementary sequence within an HSD17B13 dsRNA as described herein comprises base pairing of an oligonucleotide or polynucleotide comprising a first nucleotide sequence with an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the full length of one or both nucleotide sequences. Such sequences may be referred to herein as being "fully complementary" relative to one another. It should be understood that, in some embodiments, when two oligonucleotides are designed to form one or more single-stranded overhangs after hybridization, such overhangs are not considered herein to be mismatches with respect to defined complementarity. For example, an HSD17B13 dsRNA agent comprises an oligonucleotide of 19 nucleotides in length and another oligonucleotide of 20 nucleotides in length, wherein the longer oligonucleotide comprises a 19-nucleotide sequence that is fully complementary to the shorter oligonucleotide, which may also be referred to as "fully complementary" for the purposes described herein. Thus, as used herein, "fully complementary" means that all (100%) bases in the contiguous sequence of the first polynucleotide will hybridize to the same number of bases in the contiguous sequence of the second polynucleotide. The contiguous sequence may comprise all or part of the first or second nucleotide sequence.

[0179] As used herein, the term "substantially complementary" means that in hybridizing nucleobase sequence pairs, at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, but not all, of the bases in the contiguous sequence of the first polynucleotide will hybridize to the same number of bases in the contiguous sequence of the second polynucleotide. If the two sequences include one or more, for example, at least 1, 2, 3, 4, or 5 mismatched base pairs upon hybridization, the term "substantially complementary" can be used to refer to a duplex of up to 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 base pairs (bp) of the first sequence relative to the second sequence, while retaining the ability to hybridize under these conditions, which is most relevant to its ultimate application, such as inhibition of HSD17B13 gene expression through the RISC pathway.

[0180] The term "partial complementarity" can be used in this article to refer to hybridized nuclear base sequences, wherein at least 75% but not all of the bases in the continuous sequence of the first polynucleotide will hybridize with the same number of bases in the continuous sequence of the second polynucleotide. In some embodiments, "partial complementarity" means that at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the bases in the continuous sequence of the first polynucleotide will hybridize with the same number of bases in the continuous sequence of the second polynucleotide.

[0181] The terms "complementary," "fully complementary," "substantially complementary," and "partially complementary" are used herein to refer to base pairing between the sense and antisense strands of an HSD17B13 dsRNA agent, between the antisense strand of an HSD17B13 dsRNA agent and the sequence of a target HSD17B13 mRNA, or between a single-stranded antisense oligonucleotide and the sequence of a target HSD17B13 mRNA. It should be understood that the term "antisense strand of an HSD17B13 dsRNA agent" can refer to the same sequence as an "HSD17B13 antisense polynucleotide agent."

[0182] As used herein, the term "substantially identical" or "substantial identity" used when referring to a nucleic acid sequence is intended to refer to a nucleic acid sequence comprising a sequence having at least about 85% sequence identity or more, preferably at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity compared to a reference sequence. The percentage of sequence identity is determined by comparing two optimally aligned sequences in a comparison window. The percentage is calculated by determining the number of positions at which the same nucleic acid base appears in the two sequences to produce the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The invention disclosed herein encompasses nucleotide sequences substantially identical to those disclosed herein (e.g., in Tables 1 to 3). In some embodiments, the sequences disclosed herein are identical, or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to those disclosed herein (e.g., in Tables 1 to 3).

[0183] As used herein, the term "strand comprising a sequence" means an oligonucleotide comprising a nucleotide chain described by a sequence referred to using standard nucleotide nomenclature. As used herein, the term "double-stranded RNA" or "dsRNA" refers to an RNAi comprising an RNA molecule or molecular complex having a hybrid duplex region comprising two antiparallel and substantially or completely complementary nucleic acid strands, which are referred to as having "sense" and "antisense" orientations relative to the target HSD17B13 RNA. The duplex region can be any length that allows for specific degradation of the desired target HSD17B13 RNA via the RISC pathway, but is typically 9 to 30 base pairs in length, for example 15 to 30 base pairs in length. Contemplating duplexes between 9 and 30 base pairs, the duplexes can be any length within this range, e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, and any subranges therebetween, including but not limited to 15 to 30 base pairs, 15 to 26 base pairs, 15 to 23 base pairs, 15 to 22 base pairs, 15 to 21 base pairs, 15 to 20 base pairs, 15 to 19 base pairs, 15 to 18 base pairs, 15 to 17 base pairs, 18 to 30 base pairs, 18 to 26 base pairs, or 21 to 22 base pairs. HSD17B13 dsRNA agents produced in cells by treatment with Dicer and similar enzymes are typically 19 to 22 base pairs in length. One strand of the duplex region of the HSD17B13 dsDNA agent comprises a sequence that is substantially complementary to a region of the target HSD17B13 RNA. The two strands forming the duplex structure can be derived from a single RNA molecule having at least one self-complementary region, or can be formed by two or more separate RNA molecules. When the duplex region is formed by two strands of a single molecule, the molecule can have a duplex region separated by a single-stranded nucleotide chain (referred to herein as a "hairpin loop") between the 3' end of one strand forming the duplex structure and the 5' end of the corresponding other strand.In some embodiments of the invention, the hairpin loop comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more unpaired nucleotides. When the two substantially complementary strands of the HSD17B13 dsRNA agent are composed of separate RNA molecules, those molecules need not be but can be covalently linked. When the two strands are covalently linked by means other than a hairpin loop, the connecting structure is referred to as a "linker." The term "siRNA" is also used herein to refer to dsRNA agents as described herein.

[0184] In some embodiments of the present invention, an HSD17B13 dsRNA agent may comprise a sense sequence and an antisense sequence having no unpaired nucleotides or nucleotide analogs at one or both ends of the dsRNA agent. Ends without unpaired nucleotides are referred to as "blunt ends" and have no nucleotide overhangs. If both ends of a dsRNA agent are blunt-ended, the dsRNA is referred to as "blunt-ended." In some embodiments of the present invention, the first end of the dsRNA agent is blunt-ended, in some embodiments, the second end of the dsRNA agent is blunt-ended, and in certain embodiments of the present invention, both ends of the HSD17B13 dsRNA agent are blunt.

[0185] In some embodiments of the dsRNA medicaments of the present invention, the dsRNA does not have one or two blunt ends. In such cases, there is at least one unpaired nucleotide at the end of the chain of the dsRNA medicament. For example, when the 3' end of one chain of the dsRNA extends beyond the 5' end of the other chain, or vice versa, there is a nucleotide overhang. The dsRNA may comprise an overhang having at least 1, 2, 3, 4, 5, 6 or more nucleotides. The nucleotide overhang may comprise or be composed of nucleotide / nucleoside analogs, including deoxynucleotides / nucleosides. It should be understood that in some embodiments, the nucleotide overhang is on the sense strand of the dsRNA medicament, on the antisense strand of the dsRNA medicament, or at both ends of the dsRNA medicament, and the nucleotides of the overhang may be present at the 5' end, 3' end, or both ends of the antisense strand or sense strand of the dsRNA. In certain embodiments of the present invention, one or more nucleotides in the overhang are replaced by nucleoside phosphorothioates.

[0186] As used herein, the term "antisense strand" or "guide strand" refers to the strand of an HSD17B13 dsRNA agent that includes a region that is substantially complementary to the HSD17B13 target sequence. As used herein, the term "sense strand" or "passenger strand" refers to the strand of an HSD17B13 dsRNA agent that includes a region that is substantially complementary to the antisense strand region of the HSD17B13 dsRNA agent.

[0187] Modification

[0188] In some embodiments of the present invention, the RNA of the HSD17B13 RNAi agent is chemically modified to enhance stability and / or one or more other beneficial characteristics. In certain embodiments of the present invention, nucleic acids can be synthesized and / or modified by methods well established in the art, for example, those described in "Current protocols in Nucleic Acid Chemistry," Beaucage, S Let al. (ed.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications that may be present in certain embodiments of the HSD17B13 dsRNA agents of the present invention include, for example: (a) terminal modifications, e.g., 5' terminal modifications (phosphorylation, conjugation, reverse ligation, etc.), 3' terminal modifications (conjugation, DNA nucleotides, reverse ligation, etc.); (b) base modifications, e.g., base substitution with stabilizing bases, destabilizing bases, or base pairs with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; (c) sugar modifications (e.g., at the 2' or 4' position) or replacement of sugars; and (d) backbone modifications, including modification or replacement of phosphodiester linkages. Some specific examples of RNA compounds that can be used in certain embodiments of the HSD17B13 dsRNA agents, HSD17B13 antisense polynucleotides, and HSD17B13 sense polynucleotides of the present invention include, but are not limited to, RNAs comprising modified backbones or non-natural internucleoside linkages. As a non-limiting example, RNAs having modified backbones may not have phosphorus atoms in the backbone. RNAs that do not have a phosphorus atom in their internucleoside backbone may be referred to as oligonucleosides.In certain embodiments of the invention, the modified RNA has a phosphorus atom in its internucleoside backbone.

[0189] It should be understood that the term "RNA molecule" or "RNA" or "ribonucleic acid molecule" encompasses not only RNA molecules as expressed or found in nature, but also analogs and derivatives of RNA comprising one or more ribonucleotides / ribonucleoside analogs or derivatives as described herein or known in the art. The terms "ribonucleoside" and "ribonucleotide" are used interchangeably herein. RNA molecules can be modified in the core base structure or in the ribose-phosphate backbone structure (e.g., as described below), and molecules comprising ribonucleoside analogs or derivatives must retain the ability to form duplexes. As some non-limiting examples, RNA molecules can also include at least one modified ribonucleoside, including but not limited to 2'-O-methyl modified nucleosides, nucleosides comprising 5' thiophosphate groups, terminal nucleosides connected to cholesterol derivatives or dodecanoic acid bisdecylamide groups, locked nucleosides, abasic nucleosides, 2'-deoxy-2'-fluoro modified nucleosides, 2'-amino modified nucleosides, 2'-alkyl modified nucleosides, morpholino nucleosides, phosphoramidates or nucleosides comprising non-natural bases or any combination thereof. In some embodiments of the present invention, RNA molecules include at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or up to the full length of the HSD17B13 dsRNA agent molecule, which is a modified ribonucleoside. For each of such multiple modified ribonucleosides in the RNA molecule, the modification need not be identical.

[0190] In some embodiments, the dsRNA agent, HSD17B13 antisense polynucleotide and / or HSD17B13 sense polynucleotide of the present invention may comprise one or more independently selected modified nucleotides and / or one or more independently selected non-phosphodiester bonds. As used herein, the terms "nucleotide linker bond", "nucleoside linker bond", "linker bond" and "connector" are used interchangeably and refer to a linker between modified or unmodified nucleotides and / or a modified or unmodified nucleotide and one or more targeting groups. In certain embodiments, the linker bond may be independently selected from: a phosphodiester (PO) bond, a phosphorothioate (PS) bond, and / or a phosphorodithioate (PS2) bond between two nucleotides at any position in a single-stranded or double-stranded oligonucleotide. As used herein, the term "independently selected" is used to refer to selected elements, such as modified nucleotides, non-phosphodiester bonds, etc., and refers to two or more selected elements that may, but need not, be identical to each other.

[0191] As used herein, "nucleotide base," "nucleotide" or "nucleobase" is a heterocyclic pyrimidine or purine compound that is a standard component of all nucleic acids and includes the forming nucleotides adenine (a), guanine (g), cytosine (c), thymine (t) and uracil (u). Nucleobases can be further modified to include, but are not intended to be limited to, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases and fluorinated bases. The term "ribonucleotide" or "nucleotide" can be used herein to refer to unmodified nucleotides, modified nucleotides or surrogate replacement moieties. Those skilled in the art will recognize that guanine, cytosine, adenine and uracil can be substituted with other moieties without substantially changing the base pairing properties of the oligonucleotide comprising the nucleotides bearing such replacement moieties.

[0192] As used herein, "optionally" or "optionally" means that the event or circumstances described later may but need not occur, including where the event or circumstances occur or do not occur. For example, "C1-6 alkyl is optionally substituted with halogen or cyano" means that halogen or cyano may but need not be present, including where the alkyl is substituted with halogen or cyano and where the alkyl is not substituted with halogen and cyano.

[0193] As used herein, in the chemical structures of the compounds of the present invention, the bonds represents an unspecified configuration, i.e., if chiral isomers exist in the chemical structure, the bond Can be or or both and Two configurations. Although some of the above structural formulas are described as some isomeric forms for simplicity, the present disclosure can include all isomers, such as tautomers, rotamers and mixtures thereof. Suitable chiral compounds include: geometric isomers, diastereomers, racemates and enantiomers.

[0194] As used herein, in accordance with the scope of the invention described herein, the chemical formula used in the present invention is or Can be linked to any one or more groups.

[0195] In one embodiment, the modified RNA contemplated for use in the methods and compositions described herein is a peptide nucleic acid (PNA), which has the ability to form a desired duplex structure and allows or mediates the specific degradation of the target RNA through the RISC pathway. In certain embodiments of the invention, the HSD17B13 RNA interfering agent comprises a single-stranded RNA that interacts with the target HSD17B13 RNA sequence to guide the cleavage of the target HSD17B13 RNA.

[0196] Modified RNA backbone can for example comprise, thiophosphate, chiral thiophosphate, phosphorodithioate, phosphotriester, aminoalkylphosphotriester, methylphosphonate and comprise other alkylphosphonates and chiral phosphonates, phosphinate, comprise the phosphoramidate of 3'-aminophosphoramidate and aminoalkylphosphoramidate, thiophosphoramidate, thioalkylphosphonate, thioalkylphosphotriester and have the boric acid phosphate of normal 3'-5' linkage, the analogue of its 2'-5' connection and wherein the adjacent pair of nucleoside unit is connected at 3'-5' to 5'-3' or 2'-5' to 5'-2' those with opposite polarity.Also comprise multiple salt, mixed salt and free acid form. Means for preparing phosphorus-containing linkages are routinely practiced in the art, and such methods can be used to prepare certain modified HSD17B13 dsRNA agents, certain modified HSD17B13 antisense polynucleotides, and / or certain modified HSD17B13 sense polynucleotides of the invention.

[0197] Modified RNA backbones that do not contain a phosphorus atom have backbones formed from short-chain alkyl or cycloalkyl nucleoside linkages, mixed heteroatom and alkyl or cycloalkyl nucleoside linkages, or one or more short-chain heteroatom or heterocyclic nucleoside linkages. These include those with: morpholine linkages (formed in part by the sugar portion of the nucleoside); siloxane backbones; sulfide, sulfoxide, and sulfone backbones; formacetyl and thioformacetyl backbones; methyleneformacetyl and thioformacetyl backbones; backbones containing olefins; sulfamate backbones; methyleneimino and methylenehydrazinyl backbones; sulfonate and sulfonamide backbones; amide backbones; and others with mixed N, O, S, and CH2 component parts. Means for preparing modified RNA backbones that do not contain a phosphorus atom are routinely practiced in the art, and such methods can be used to prepare certain modified HSD17B13 dsRNA agents, certain modified HSD17B13 antisense polynucleotides, and / or certain modified HSD17B13 sense polynucleotides of the present invention.

[0198] In certain embodiments of the present invention, RNA mimics are included in HSD17B13 dsRNA, HSD17B13 antisense polynucleotides, and / or HSD17B13 sense polynucleotides, for example, but not limited to, by replacing the sugar and internucleoside linkages, i.e., the backbone, of the nucleotide units with novel groups. In such embodiments, the base units are maintained for hybridization with appropriate HSD17B13 nucleic acid target compounds. One such oligomeric compound, an RNA mimic that has been shown to have excellent hybridization properties, is known as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of RNA is replaced by an amide-containing backbone, particularly an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to the aza-nitrogen atoms of the amide portion of the backbone. Means for preparing RNA mimics are routinely practiced in the art, and such methods can be used to prepare certain modified HSD17B13 dsRNA agents of the present invention.

[0199] Some embodiments of the present invention include RNAs having phosphorothioate backbones and oligonucleosides having heteroatom backbones, and in particular -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2- [referred to as a methylene(methylimino) or MMI backbone], -CH2-ON(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2-, and -N(CH3)-CH2- [where the natural phosphodiester backbone is represented as -OPO-CH2-]. Means for preparing RNAs having phosphorothioate backbones and oligonucleosides having heteroatom backbones are routinely practiced in the art, and such methods can be used to prepare certain modified HSD17B13 dsRNA agents, certain HSD17B13 antisense polynucleotides, and / or certain HSD17B13 sense polynucleotides of the present invention.

[0200] The modified RNA may also contain one or more substituted sugar moieties. The HSD17B13 dsRNA, HSD17B13 antisense polynucleotides and / or HSD17B13 sense polynucleotides of the present invention may comprise one of the following at the 2' position: OH; F; O-, S- or N-alkyl; O-, S- or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl groups may be substituted or unsubstituted C1 to C 10 Alkyl or C2 to C 10 Some exemplary suitable modifications include O[(CH2) n O] m CH3, O(CH2) n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) nONH2 and O(CH2) n ON[(CH2) n CH3)]2, wherein n and m are 1 to about 10. In other embodiments, the dsRNA comprises one of the following at position 2': C1 to C 10 Lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleavage group, reporter group, intercalator, group for improving the pharmacokinetic properties of HSD17B13 dsRNA agent, or group for improving the pharmacodynamic properties of HSD17B13 dsRNA agent, HSD17B13 antisense polynucleotide and / or HSD17B13 sense polynucleotide, and other substituents with similar properties. In some embodiments, the modification includes 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., alkoxy-alkoxy. Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e., O(CH2)2ON(CH3)2, also known as 2'-DMAOE, as described in the Examples below; and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH2)2. Means for preparing modified RNAs such as those described are routinely practiced in the art, and such methods can be used to prepare certain modified HSD17B13 dsRNA agents of the invention.

[0201] Other modifications include 2'-methoxy (2'-OCH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the RNA of the HSD17B13 dsRNA agent, HSD17B13 antisense polynucleotide and / or HSD17B13 sense polynucleotide of the present invention, particularly at the sugar on the 3' terminal nucleotide or the 3' position of the sugar in the 2'-5' linked HSD17B13 dsRNA, HSD17B13 antisense polynucleotide or HSD17B13 sense polynucleotide, and at the 5' position of the 5' terminal nucleotide. The HSD17B13 dsRNA agent, HSD17B13 antisense polynucleotide and / or HSD17B13 sense polynucleotide can also have a sugar mimetic, such as a cyclobutyl moiety in place of the pentofuranosyl sugar. Methods for preparing modified RNA such as those described are routinely practiced in the art, and such methods can be used to prepare certain modified HSD17B13 dsRNA agents, HSD17B13 antisense polynucleotides, and / or HSD17B13 sense polynucleotides of the invention.

[0202] In some embodiments, HSD17B13 dsRNA agents, HSD17B13 antisense polynucleotides and / or HSD17B13 sense polynucleotides can include nucleobase (often referred to in the art as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine and guanine and the pyrimidine bases thymine, cytosine, and uracil. Modified nucleobases include additional synthetic and natural nucleobases such as 5-methylcytosine (5-Me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl derivatives and other alkyl derivatives of adenine and guanine, 2-propyl derivatives and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, Cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Additional nucleobases that can be included in certain embodiments of the HSD17B13 dsRNA agents of the invention are known in the art, see, for example: Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. Ed. Wiley-VCH, 2008; The Concise Encyclopedia Of Polymer Science And Engineering, pp. 858-859, Kroschwitz, JL, Ed. John Wiley & Sons, 1990, English et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pp. 289-302, Crooke, ST and Lebleu, B., Ed., CRC Press, 1993.Methods for preparing dsRNA, HSD17B13 antisense strand polynucleotides and / or HSD17B13 sense strand polynucleotides comprising nucleobase modifications and / or substitutions, such as those described herein, are routinely practiced in the art, and such methods can be used to prepare certain modified HSD17B13 dsRNA agents, HSD17B13 sense polynucleotides and / or HSD17B13 antisense polynucleotides of the invention. Teachings on the synthesis of specifically modified oligonucleotides can be found in the following U.S. Patents: U.S. Pat. No. 5,218,105, describing polyamine-conjugated oligonucleotides; U.S. Pat. No. 5,541,307, describing oligonucleotides with backbone modifications; U.S. Pat. No. 5,521,302, describing a process for preparing oligonucleotides with chiral phosphine bonds; U.S. Pat. No. 5,539,082, describing peptide nucleic acids; U.S. Pat. No. 5,554,746, describing oligonucleotides with a trilactam backbone; U.S. Pat. No. 5,571,902, describing methods and materials for oligonucleotide synthesis; U.S. Pat. No. 5,578,718, describing nucleosides with alkylthio groups, wherein these groups can be used as other moieties attached to any position of the nucleoside. linkers; US Pat. No. 5,587,361 describes oligonucleotides with thiophosphate bonds of high chiral purity; US Pat. No. 5,506,351 describes a process for preparing 2'-O-alkylguanosine and related compounds, including 2,6-diaminopurine compounds; US Pat. No. 5,587,469 describes oligonucleotides containing N-2 substituted purines; US Pat. No. 5,587,470 describes oligonucleotides containing 3-deazapurines; US Pat. No. 5,608,046 describes conjugated 4'-demethyl nucleoside analogs; US Pat. No. 5,610,289 describes backbone-modified oligonucleotide analogs; US Pat. No. 6,262,241 describes a method for synthesizing 2'-fluoro-oligonucleotides, and others.

[0203] Certain embodiments of the HSD17B13 dsRNA agents, HSD17B13 antisense polynucleotides, and / or HSD17B13 sense polynucleotides of the present invention include RNA modified to include one or more locked nucleic acids (LNAs). Locked nucleic acids are nucleotides with modified ribose moieties that contain an additional bridge connecting the 2' and 4' carbons. This structure effectively "locks" the ribose in a 3'-endo structural conformation. The addition of locked nucleic acid to the HSD17B13 dsRNA agents, HSD17B13 antisense polynucleotides, and / or HSD17B13 sense polynucleotides of the present invention can increase stability in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O R. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Methods for preparing dsRNA agents, HSD17B13 antisense polynucleotides, and / or HSD17B13 sense polynucleotides containing locked nucleic acid are routinely practiced in the art, and such methods can be used to prepare certain modified HSD17B13 dsRNA agents of the present invention.

[0204] Certain embodiments of the HSD17B13 dsRNA compounds, sense polynucleotides and / or antisense polynucleotides of the present invention comprise at least one modified nucleotide, wherein the at least one modified nucleotide comprises: 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2'3'-seco nucleotide mimetics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, and 3'-OMe nucleotides, nucleotides containing a 5'-phosphorothioate group, nucleotides containing a vinylphosphonate, nucleotides containing an adenosine diphosphate, nucleotides containing ... In some embodiments, the HSD17B13 dsRNA compound comprises an E-vinylphosphonate nucleotide at the 5' end of the antisense strand (also referred to herein as the guide strand).

[0205] Certain embodiments of the HSD17B13 dsRNA compounds, the 3' and 5' ends of the sense polynucleotides, and / or the 3' end of the antisense polynucleotides of the present invention include at least one modified nucleotide, wherein the at least one modified nucleotide includes: an abasic nucleotide, a ribitol, an inverted nucleotide, an inverted abasic nucleotide, an inverted 2'-Ome nucleotide, or an inverted 2'-deoxy nucleotide. It is known to those skilled in the art that the inclusion of abasic or inverted abasic nucleotides at the end of an oligonucleotide enhances stability (Czauderna et al. Structural variations and stabilizing modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Res. 2003; 31(11): 2705-2716. doi: 10.1093 / nar / gkg393). In some embodiments, the HSD17B13 dsRNA compound includes one or more inverted abasic residues (invab) at the 3'-end or the 5'-end, or at both the 3'-end and the 5'-end. Exemplary inverted abasic residues (invab) include, but are not limited to, the following:

[0206]

[0207] Certain embodiments of the HSD17B13 dsRNA compounds, the 3' and 5' ends of the sense polynucleotides and / or the 3' end of the antisense polynucleotides of the present invention include at least one modified nucleotide, wherein the at least one modified nucleotide comprises: an isomannosyl nucleotide. Specific examples of isomannosyl nucleotides include, but are not limited to:

[0208]

[0209] Wherein each phrase "Olig" independently represents a polynucleotide portion. Exemplary isomannide residues (imann) include, but are not limited to, the following structures:

[0210]

[0211] In certain embodiments, the isomannoside nucleotides may also be conjugated to one or more targeting groups or delivery molecules, such as a GalNAc moiety.

[0212] Certain embodiments of the HSD17B13 dsRNA compounds and antisense polynucleotides of the present invention include at least one modified nucleotide, wherein the at least one modified nucleotide comprises an unlocked nucleic acid nucleotide (UNA) or / and a glycol nucleic acid nucleotide (GNA). It is known to those skilled in the art that UNA and GNA are thermally unstable chemical modifications that can significantly improve the off-target profile of siRNA compounds (Janas, et al., Selection of GalNAc-conjugated siRNAs with limited off-target-driven rat hepatotoxicity. Nat Commun. 2018; 9(1): 723. doi: 10.1038 / s41467-018-02989-4; Laursen et al., Utilization of unlocked nucleic acid (UNA) to enhance siRNA performance in vitro and in vivo. Mol BioSyst. 2010; 6: 862–70).

[0213] The HSD17B13 dsRNA compounds and antisense polynucleotides of certain embodiments of the present invention further comprise a phosphate moiety. As used herein, a phosphate moiety refers to a phosphate group attached to a sugar portion of a nucleotide (e.g., ribose or deoxyribose or its analogs), including phosphates or phosphate mimetics. Nucleotides comprising phosphate mimetics can also be defined as phosphonate-modified nucleotides.

[0214] In some embodiments, the phosphonate mimetic is 5'-vinylphosphonate (VP). In exemplary embodiments, the vinylphosphonate disclosed herein has the following structure:

[0215]

[0216] The vinylphosphonates disclosed herein can be linked to the antisense strand or the sense strand of the dsRNA disclosed herein.In certain preferred embodiments, the vinylphosphonates disclosed herein are linked to the antisense strand of the dsRNA, optionally at the 5' end of the antisense strand of the dsRNA.

[0217] In certain embodiments, the vinylphosphonate modified nucleotides disclosed herein have the structure of Formula (IV):

[0218]

[0219] Where X is O or S;

[0220] R is hydrogen, hydroxy, fluorine or C 1-20 Alkoxy (e.g., methoxy or n-hexadecyloxy);

[0221] R5' is =C(H)-P(O)(OH)2 and the double bond between the C5' carbon and R5' is in the E or Z direction (eg, the E direction); and

[0222] B is a nucleobase or a modified nucleobase, optionally wherein B is adenine, guanine, cytosine, thymine or uracil.

[0223] In certain embodiments, R5' is ═C(H)-P(O)(OH)2 and the double bond between the C5' carbon and R5' is in the E direction. In certain embodiments, R is methoxy and R5' is ═C(H)-P(O)(OH)2 and the double bond between the C5' carbon and R5' is in the E direction. In certain embodiments, X is S, R is methoxy, and R5' is ═C(H)-P(O)(OH)2 and the double bond between the C5' carbon and R5' is in the E direction.

[0224] Vinylphosphonate modifications are also contemplated for use in the dsRNA, compositions, and methods disclosed herein. The structure of an exemplary vinylphosphonate is:

[0225]

[0226] In certain embodiments, the vinylphosphonate-modified nucleotide is V Pu*, which has the following structure:

[0227]

[0228] In many cases, protecting groups are used in the process of preparing the compounds of the present invention. As used herein, the term "protected" refers to a designated portion having a protecting group attached thereto. In some embodiments of the present invention, the compound contains one or more protecting groups. A variety of protecting groups can be used in the methods of the present invention. Generally speaking, protecting groups render chemical functional groups inert to specific reaction conditions and can be attached to or removed from such functional groups in a molecule without substantially damaging the remainder of the molecule. General protecting groups, especially hydroxy protecting groups, are well known in the art (Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2nd edition, John Wiley & Sons, New York, 1991).

[0229] As used herein, examples of protecting groups (e.g., hydroxy protecting groups) include, but are not limited to, methyl, ethyl, benzyl (Bn), phenyl, isopropyl, tert-butyl, acetyl, chloroacetyl, trichloroacetyl, trifluoroacetyl, pivaloyl, tert-butoxymethyl, methoxymethyl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, allyl, cyclohexyl, 9-fluorenylmethoxycarbonyl (Fmoc), methanesulfonate, tosylate, trifluoromethanesulfonate, benzoyl, benzoyl, Acylformate, p-phenylbenzoyl, 4-methoxybenzyl, monomethoxytrityl, dimethoxytrityl, trimethoxytrityl, 4-chlorobenzyl, 4-nitrobenzyl, 2,4-dinitrophenyl, 4-acyloxybenzyl, 2-methylphenyl, 2,6-dimethylphenyl, 2-chlorophenyl, 2,6-dichlorobenzyl, diphenylmethyl, triphenylmethyl, 4-methylthio-1-butyl, S-acetylthioacetate (SATA), 2-cyanoethyl, 2-cyanoethyl , 1-dimethylethyl (CDM), 4-cyano-2-butenyl, 2-(trimethylsilyl)ethyl (TSE), 2-(phenylthio)ethyl, 2-(triphenylsilyl)ethyl, 2-(benzylsulfonyl)ethyl, 2,2,2-trichloroethyl, 2,2,2-tribromoethyl, 2,3-dibromopropyl, 2,2,2-trifluoroethyl, phenylthio, 2-chloro-4-tritylphenyl, 2-bromophenyl, 2-[N-isopropyl-N-(4-methoxyphenyl)]-]

[00145] Examples of the present invention include 4-(4-(N-trifluoroacetyl)amino)ethyl, 4-(N-trifluoroacetylamino)butyl, 4-oxopentyl, 4-tritylaminophenyl, 4-benzylaminophenyl, tetrahydropyranyl, morpholino, trimethylsilyl, triethylsilyl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, pivaloyloxymethyl (POM), and 9-phenylxanthine-9-yl.

[0230] As used herein, examples of amino protecting groups include, but are not limited to, carbamate protecting groups such as 2-trimethylsilylethoxycarbonyl (Teoc), 1-methyl-1-(4-biphenyl)ethoxycarbonyl (Bpoc), tert-butoxycarbonyl (BOC), allyloxycarbonyl (Alloc), 9-fluorenyl-methoxycarbonyl (Fmoc), benzyloxycarbonyl (Cbz); amide protecting groups such as formyl, acetyl, pivaloyl, trihaloacetyl, benzoyl, 2-nitrobenzenesulfonyl; and imide and cyclic imide protecting groups such as phthalimido and dithiosuccinyl. The compounds and methods of the present invention also encompass equivalents of these amino protecting groups.

[0231] Another modification that can be included in the RNA of certain embodiments of the HSD17B13 dsRNA agents, HSD17B13 antisense polynucleotides, and / or HSD17B13 sense polynucleotides of the present invention includes chemically linking one or more ligands, moieties, or conjugates to the RNA that can enhance one or more characteristics of the HSD17B13 dsRNA agent, HSD17B13 antisense polynucleotide, and / or HSD17B13 sense polynucleotide, respectively. Non-limiting examples of characteristics that can be enhanced include: HSD17B13 dsRNA agent, HSD17B13 antisense polynucleotide, and / or HSD17B13 sense polynucleotide activity, cellular distribution, delivery of the HSD17B13 dsRNA agent, pharmacokinetic properties of the HSD17B13 dsRNA agent, and cellular uptake of the HSD17B13 dsRNA agent. In some embodiments of the present invention, the HSD17B13 dsRNA agent comprises one or more targeting groups or linking groups, which are conjugated to the sense strand in certain embodiments of the HSD17B13 dsRNA agent of the present invention. A non-limiting example of a targeting group is a compound comprising N-acetyl-galactosamine (GalNAc). The terms "targeting group," "targeting agent," "linking agent," "targeting compound," and "targeting ligand" are used interchangeably herein. In certain embodiments of the present invention, the HSD17B13 dsRNA agent comprises a targeting compound conjugated to the 5'-end of the sense strand. In certain embodiments of the present invention, the HSD17B13 dsRNA agent comprises a targeting compound conjugated to the 3'-end of the sense strand. In some embodiments of the present invention, the HSD17B13 dsRNA agent comprises a targeting group containing GalNAc. In certain embodiments of the present invention, the HSD17B13 dsRNA agent does not include a targeting compound conjugated to one or both of the 3'-end and the 5'-end of the sense strand. In certain embodiments of the invention, the HSD17B13 dsRNA agent does not include a GalNAc-containing targeting compound conjugated to one or both of the 5'-end and the 3'-end of the sense strand.

[0232] Additional targeting agents and linking agents are well known in the art. For example, targeting agents and linking agents that can be used in certain embodiments of the present invention include, but are not limited to, lipid moieties, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86:6553-6556); cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060); thioethers, such as beryl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770); thiocholesterol (Oberhauser et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060); al., Nucl. Acids Res., 1992, 20: 533-538); aliphatic chains, for example, dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10: 1111-1118; Kabanov et al., FEBS Lett., 1990, 259: 327-330; Svinarchuk et al., Biochimie, 1993, 75: 49-54); phospholipids, for example, di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycerol-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36: 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783); a polyamine or polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973); or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654); a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237); or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).

[0233] Certain embodiments of compositions comprising HSD17B13 dsRNA agents, HSD17B13 antisense polynucleotides, and / or HSD17B13 sense polynucleotides may include ligands that alter the distribution, targeting, etc., of the HSD17B13 dsRNA agents. In some embodiments of compositions comprising HSD17B13 dsRNA agents of the invention, the ligand increases affinity for a selected target (e.g., a molecule, a cell or cell type, a compartment such as a cell or organ compartment, a tissue, an organ, or a region of the body), for example, compared to a species lacking such a ligand. Ligands useful in the compositions and / or methods of the invention can be naturally occurring substances, such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulins); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid); or lipids. The ligand can also be a recombinant molecule or a synthetic molecule, such as a synthetic polymer, such as a synthetic polyamino acid or polyamine. Some examples of polyamino acids are polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly-(L-lactide-co-glycolic acid) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly-(2-ethyl acrylic acid), N-isopropylacrylamide polymer or polyphosphazene. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide-polyamines, peptide mimetic polyamines, dendrimer polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines or alpha helical peptides.

[0234] The ligands included in the compositions and / or methods of the present invention may comprise a targeting group, some non-limiting examples of which are cell or tissue targeting agents, such as lectins, glycoproteins, lipids, or proteins, for example, antibodies that bind to specific cell types (e.g., kidney cells or hepatocytes). The targeting group can be thyrotropin, melanocyte stimulating hormone, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, multivalent fucose, glycosylated polyamino acids, multivalent galactose, transferrin, bisphosphonates, polyglutamic acid, polyaspartic acid, lipids, cholesterol, steroids, bile acids, folic acid, vitamin B12, vitamin A, biotin, or RGD peptide or RGD peptide mimetic.

[0235] Other examples of ligands include dyes, intercalating agents (e.g., acridine), cross-linking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules such as cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl, hexadecylglycerol, borneol, menthol, 1,3-propylene glycol, heptadecyl, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine), and peptide conjugates (e.g., antennapedia peptides). peptide), Tat peptide), alkylating agents, phosphate / ester, amino, sulfhydryl, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.

[0236] The ligands included in the compositions and / or methods of the present invention can be proteins, such as glycoproteins, or peptides, such as molecules with specific affinity for the auxiliary ligand, or antibodies, such as those that bind to specific cell types, such as cancer cells, endothelial cells, cardiomyocytes, or bone cells. The ligands useful in embodiments of the compositions and / or methods of the present invention can be hormones or hormone receptors. Ligands useful in embodiments of the compositions and / or methods of the present invention can be lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, or multivalent fucose. Ligands useful in embodiments of the compositions and / or methods of the present invention can be substances that can increase the uptake of the HSD17B13 dsRNA agent into cells, such as by disrupting the cell's cytoskeleton, such as by disrupting the cell's microtubules, microfilaments, and / or intermediate filaments. Non-limiting examples of agents of this type are: taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, and myoservin.

[0237] In some embodiments, the ligand connected to the HSD17B13 dsRNA agent of the present invention acts as a pharmacokinetic (PK) modulator. Examples of PK modulators that can be used in the compositions and methods of the present invention include, but are not limited to, lipophiles, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, vitamins, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkyl glycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, serum protein binding aptamers, etc. It is also known to bind to serum proteins, so short oligonucleotides containing multiple thiophosphate bonds in the backbone, such as oligonucleotides of about 5 bases, 10 bases, 15 bases, or 20 bases, can also be used in the compositions and / or methods of the present invention as ligands.

[0238] HSD17B13 dsRNA reagent composition

[0239] In some embodiments of the present invention, the HSD17B13 dsRNA agent is in a composition. The compositions of the present invention may include one or more HSD17B13 dsRNA agents and, optionally, one or more pharmaceutically acceptable carriers, delivery agents, targeting agents, detectable labels, and the like. Non-Limiting Examples of Useful Targeting Agents According to some embodiments of the methods of the present invention, "HSD17B13" refers to an agent that directs the HSD17B13 dsRNA agent of the present invention to and / or into the cells to be treated. The choice of targeting agent will depend on the following factors: the nature of the HSD17B13-related disease or condition, and the cell type being targeted. In a non-limiting example, in some embodiments of the present invention, it may be desirable to target the HSD17B13 dsRNA agent to and / or within hepatocytes. It should be understood that in some embodiments of the methods of the present invention, the therapeutic agent comprises an HSD17B13 dsRNA agent having only a delivery agent, such as a delivery agent comprising N-acetylgalactosamine (GalNAc), without any additional attachment elements. For example, in some aspects of the invention, an HSD17B13 dsRNA agent can be attached to a delivery compound comprising GalNAc and contained in a composition comprising a pharmaceutically acceptable carrier and administered to a cell or subject without any detectable label or targeting agent attached to the HSD17B13 dsRNA agent or the like.

[0240] Where the HSD17B13 dsRNA agents of the present invention are administered with and / or linked to one or more of the following: delivery agents, targeting agents, labeling agents, and the like, skilled artisans will recognize and be able to select and use agents suitable for the methods of the present invention. Labeling agents can be used in certain methods of the present invention to determine the location of the HSD17B13 dsRNA agent in cells and tissues, and can be used to determine the cell, tissue, or organ location of a therapeutic composition comprising an HSD17B13 dsRNA agent that has been administered in the methods of the present invention. Methods for attaching and using labeling agents, such as enzyme labels, dyes, radioactive labels, and the like, are well known in the art. It should be understood that in some embodiments of the compositions and methods of the present invention, the labeling agent is linked to one or both of the sense polynucleotide and the antisense polynucleotide contained in the HSD17B13 dsRNA agent.

[0241] Delivery of HSD17B13 dsRNA Reagents and HSD17B13 Antisense Polynucleotide Reagents

[0242] Certain embodiments of the methods of the present invention include delivering the HSD17B13 dsRNA agent into cells. As used herein, the term "delivery" refers to promoting or influencing cellular uptake or absorption. Absorption or uptake of the HSD17B13 dsRNA agent can occur by independent diffusion or active cellular processes, or by using a delivery agent, targeting agent, etc. that can be associated with the HSD17B13 dsRNA agent of the present invention. Delivery methods suitable for the methods of the present invention include, but are not limited to, in vivo delivery, wherein the HSD17B13 dsRNA agent is injected into a tissue site or administered systemically. In some embodiments of the present invention, the HSD17B13 dsRNA agent is attached to a delivery agent.

[0243] Non-limiting examples of methods that can be used to deliver HSD17B13 dsRNA agents to cells, tissues, and / or subjects include: HSD17B13 dsRNA-GalNAc conjugates, SAMiRNA technology, LNP-based delivery methods, and naked RNA delivery. These and other delivery methods have been successfully used in the art to deliver therapeutic RNAi agents for the treatment of various diseases and conditions, such as, but not limited to, liver disease, acute intermittent porphyria (AIP), hemophilia, pulmonary fibrosis, and the like. Detailed information on various delivery methods can be found in publications such as: Nikam, RR & K.R. Gore (2018) Nucleic Acid Ther, 28(4), 209-224 Aug 2018; Springer AD & S.F. Dowdy (2018) Nucleic Acid Ther. Jun 1; 28(3): 109–118; Lee, K. et al., (2018) Arch Pharm Res, 41(9), 867-874; and Nair, JK et al., (2014) J. Am. Chem. Soc. 136: 16958-16961, the contents of each of which are incorporated herein by reference.

[0244] Some embodiments of the present invention include using lipid nanoparticles (LNPs) to deliver the HSD17B13 dsRNA agent of the present invention to cells, tissues and / or subjects. LNPs are commonly used for delivering HSD17B13 dsRNA agents in vivo, including therapeutic HSD17B13 dsRNA agents. One benefit of using LNPs or other delivery agents is that when LNPs or other delivery agents are used to deliver them to a subject, the stability of the HSD17B13 RNA agent is improved. In some embodiments of the present invention, LNPs include cationic LNPs loaded with one or more HSD17B13 RNAi molecules of the present invention. The LNPs containing the HSD17B13 RNAi molecules are administered to a subject, and the LNPs and the HSD17B13 RNAi molecules to which they are connected are taken up by cells through endocytosis, and their presence results in the release of RNAi triggering molecules that mediate RNAi.

[0245] Another non-limiting example of a delivery agent that can be used in embodiments of the present invention to deliver the HSD17B13 dsRNA agent of the present invention to cells, tissues, and / or subjects is an agent comprising GalNAc that is attached to the HSD17B13 dsRNA agent of the present invention and delivers the HSD17B13 dsRNA agent to cells, tissues, and / or subjects. Examples of certain additional delivery agents comprising GalNAc that can be used in certain embodiments of the methods and compositions of the present invention are disclosed in PCT application: WO2020191183A1 (incorporated herein in its entirety). Non-limiting examples of GalNAc targeting ligands that can be used in the compositions and methods of the present invention to deliver the HSD17B13 dsRNA agent to cells are targeting ligand clusters. Examples of targeting ligand clusters presented herein are referred to as: GalNAc ligands with phosphodiester linkages (GLOs) and GalNAc ligands with phosphorothioate linkages (GLSs). The term "GLX-n" may be used herein to indicate that the GalNAc-containing compound that is attached is any one of the following compounds: GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, each of which has a structure shown below, wherein the position of attachment of the GalNAc targeting ligand to the RNAi agent of the invention is at the respective rightmost position (denoted by 16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16. The structures of GLO-1 to GLO-16 and GLS-1 to GLS-16 are shown below.

[0246]

[0247]

[0248]

[0249]

[0250] In certain embodiments, the aforementioned isomannose nucleotides may also be conjugated to one or more GalNAc targeting ligands. Specific examples of isomannose nucleotides conjugated to GalNAc targeting ligands include, but are not limited to:

[0251] wherein each phrase "Olig" independently refers to a polynucleotide portion.

[0252] In some embodiments of the present invention, in vivo delivery can also be performed using a β-glucan delivery system, such as those described in U.S. Patent No. 5,100,000. U.S. Patent Nos. 5,032,401 and 5,607,677 and U.S. Publication No. 2005 / 0281781, the entire contents of which are incorporated herein by reference. HSD17B13 RNAi agents can also be introduced into cells in vitro using methods known in the art, such as electroporation and lipofection. In certain embodiments of the methods of the present invention, HSD17B13 dsRNA is delivered in the absence of a targeting agent. These RNAs can be delivered as "naked" RNA molecules. As a non-limiting example, the HSD17B13 dsRNA of the present invention can be delivered in a manner that includes an RNAi agent but does not include a targeting agent, such as a GalNAc targeting compound.

[0253] In addition to certain delivery modes described herein, it will be understood that RNAi delivery modes, such as but not limited to those described herein and those used in the art, can be used in conjunction with the embodiments of HSD17B13 RNAi agents and treatment methods described herein.

[0254] The HSD17B13 dsRNA agents of the present invention can be administered to a subject in an amount and manner effective to reduce the level and activity of the HSD17B13 polypeptide in a cell and / or subject. In some embodiments of the methods of the present invention, one or more HSD17B13 dsRNA agents are administered to cells and / or subjects to treat a disease or condition associated with HSD17B13 expression and activity. In some embodiments, the methods of the present invention comprise administering one or more HSD17B13 dsRNA agents to a subject in need of such treatment to alleviate a disease or condition associated with HSD17B13 expression in the subject. The HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents of the present invention can be administered to reduce HSD17B13 expression and / or activity in one or more of cells in vitro, ex vivo, and in vivo.

[0255] In some embodiments of the present invention, the level of HSD17B13 polypeptide in a cell is reduced and its activity is thereby reduced by delivering (e.g., introducing) a HSD17B13 dsRNA agent or a HSD17B13 antisense polynucleotide agent into a cell. Targeting agents and methods can be used to help deliver HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents to specific cell types, cell subtypes, organs, spatial regions in a subject, and / or subcellular regions in a cell. HSD17B13 dsRNA agents can be administered alone or in combination with one or more additional HSD17B13 dsRNA agents in certain methods of the present invention. In some embodiments, two, three, four, or more independently selected HSD17B13 dsRNA agents are administered to a subject.

[0256] In certain embodiments of the present invention, an HSD17B13 dsRNA agent is administered to a subject to treat an HSD17B13-related disease or condition in combination with one or more additional treatment regimens for treating the HSD17B13-related disease or condition. Non-limiting examples of additional treatment regimens are: administration of one or more HSD17B13 antisense polynucleotides of the present invention, administration of non-HSD17B13 dsRNA agents, and behavioral changes. Additional treatment regimens can be administered at one or more times before, simultaneously with, and after the administration of the HSD17B13 dsRNA agent of the present invention. It should be understood that as used herein, simultaneous with or within five minutes of time zero, within 10 minutes of time zero, within 30 minutes of time zero, within 45 minutes of time zero, and within 60 minutes of time zero, wherein "time zero" is the time when the HSD17B13 dsRNA agent of the present invention is administered to the subject. Non-limiting examples of non-HSD17B13 dsRNA agents are: pyridoxine, ACE inhibitors (angiotensin converting enzyme inhibitors), such as benazepril (Lotensin); angiotensin II receptor antagonists (ARBs) (e.g., losartan potassium, such as Cozaar from Merck & Co.); ; such as Candesartan (Atacand); HMG-CoA reductase inhibitors (e.g., statins); calcium binders, such as sodium cellulose phosphate (Calcibind); diuretics, such as thiazide diuretics, such as hydrochlorothiazide (Microzide); insulin sensitizers, such as the PPARγ agonist pioglitazone, glp-1r agonists such as liraglutide, vitamin E, SGLT2 inhibitors, DPPIV inhibitors, and kidney / liver transplantation; or a combination of any of the foregoing. Non-limiting examples of behavioral changes are: dietary regimens, counseling, and exercise regimens. These and other therapeutic agents and behavioral modifications are known in the art and are used to treat HSD17B13 diseases or conditions in subjects and can be administered to subjects in combination with administration of one or more HSD17B13 dsRNA agents of the present invention to treat HSD17B13 diseases or conditions. The HSD17B13 dsRNA agents of the invention administered to cells or subjects to treat HSD17B13-associated diseases or disorders may act synergistically with one or more other therapeutic agents or activities and increase the effectiveness of the one or more therapeutic agents or activities and / or increase the effectiveness of the HSD17B13 dsRNA agent in treating HSD17B13-associated diseases or disorders.

[0257] The therapeutic methods of the present invention comprise administering an HSD17B13 dsRNA agent, which can be used prior to the onset of an HSD17B13-associated disease or condition and / or while an HSD17B13-associated disease or condition is present, including at the early, intermediate, and late stages of the disease or condition, and at all times before and after any of these. The methods of the present invention can also be used to treat a subject who has previously been treated for an HSD17B13-associated disease or condition with one or more other therapeutic agents and / or therapeutic activities, wherein the other therapeutic agents and / or therapeutic activities were unsuccessful, had minimal success, and / or are no longer successful in treating the HSD17B13-associated disease or condition in the subject.

[0258] Vector-encoded dsRNA

[0259] In certain embodiments of the present invention, a vector can be used to deliver the HSD17B13 dsRNA agent to a cell. The HSD17B13 dsRNA agent transcription unit can be contained in a DNA or RNA vector. The preparation and use of such vectors encoding transgenes for delivering sequences to cells and / or subjects are well known in the art. Vectors can be used in the methods of the present invention, which result in transient expression of the HSD17B13 dsRNA, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more hours, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 weeks or more. The length of transient expression can be determined using conventional methods based on elements, such as, but not limited to, selected specific vector constructs and target cells and / or tissues. Such transgenes can be introduced as linear constructs, circular plasmids, or viral vectors, which can be integrating or non-integrating vectors. Transgenes can also be constructed to allow their inheritance as extrachromosomal plasmids (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92: 1292).

[0260] One or more individual strands of an HSD17B13 dsRNA agent can be transcribed from a promoter on an expression vector. Where two separate strands are to be expressed to produce, for example, dsRNA, the two separate expression vectors can be co-introduced into cells using methods such as transfection or infection. In certain embodiments, each individual strand of an HSD17B13 dsRNA agent of the present invention can be transcribed from two promoters contained on the same expression vector. In certain embodiments of the present invention, an HSD17B13 dsRNA agent is expressed as an inverted repeat polynucleotide linked by a linker polynucleotide sequence, such that the HSD17B13 dsRNA agent has a stem and loop structure.

[0261] Some non-limiting examples of RNA expression vectors are DNA plasmids or viral vectors. The expression vectors that can be used in embodiments of the present invention are compatible with eukaryotic cells. Eukaryotic cell expression vectors are routinely used in the art and can be obtained from many commercial sources. The delivery of the HSD17B13 dsRNA expression vector can be systemic, for example, by intravenous or intramuscular administration, by administration to target cells explanted from a subject and then reintroduced into the subject, or by any other means that allows introduction into the desired target cells.

[0262] Viral vector systems that may be included in embodiments of the methods include, but are not limited to: (a) adenoviral vectors;

[0263] (b) Retroviral vectors, including but not limited to lentiviral vectors, Moloney murine leukemia virus, etc.; (c) adeno-associated viral vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picornavirus vectors; (i) poxvirus vectors, such as smallpox, such as cowpox virus vectors or avian pox, such as canarypox or fowlpox; and (j) helper-dependent or gutless adenovirus. The construct for recombinant expression of the HSD17B13 dsRNA agent may include regulatory elements, such as promoters, enhancers, etc., which can be selected to provide constitutive or regulated / inducible expression. The use of promoters and enhancers, etc., and viral vector systems are conventional in the art and can be used in combination with the methods and compositions described herein.

[0264] Certain embodiments of the present invention include the use of viral vectors for delivering HSD17B13 dsRNA agents to cells. Many adenovirus-based delivery systems are routinely used in the art for delivery to, for example, the lungs, liver, central nervous system, endothelial cells, and muscle. Some non-limiting examples of viral vectors that can be used in the methods of the present invention are: AAV vectors, poxviruses such as cowpox virus, Modified Virus Ankara (MVA), NYVAC, avian pox such as fowlpox or canarypox.

[0265] Certain embodiments of the invention include methods for delivering HSD17B13 dsRNA agents into cells using vectors, and such vectors can be in a pharmaceutically acceptable carrier, which can, but need not, comprise a slow-release matrix in which the gene delivery vehicle is embedded. In some embodiments, the vectors used to deliver HSD17B13 dsRNA can be produced by recombinant cells, and the pharmaceutical compositions of the invention can comprise one or more cells that produce the HSD17B13 dsRNA delivery system.

[0266] Pharmaceutical compositions containing HSD17B13 dsRNA or ssRNA agents

[0267] Certain embodiments of the present invention include the use of pharmaceutical compositions containing an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent and a pharmaceutically acceptable carrier. Pharmaceutical compositions containing an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent can be used in the methods of the present invention to reduce HSD17B13 gene expression and HSD17B13 activity in cells, and can be used to treat HSD17B13-related diseases or conditions. Such pharmaceutical compositions can be formulated according to the mode of delivery. Non-limiting examples of formulations for delivery modes include compositions formulated for subcutaneous delivery, compositions formulated for systemic administration by parenteral delivery, compositions formulated for intravenous (IV) delivery, compositions formulated for intrathecal delivery, compositions formulated for direct delivery to the brain, and the like. The pharmaceutical compositions of the present invention can be administered by one or more means to deliver HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents to cells, such as topically (e.g., via a transdermal patch), pulmonary, such as by inhalation or insufflation of a powder or aerosol, including via a nebulizer; intratracheally, intranasally, epidermally, and transdermally, orally, or parenterally. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subcutaneous injection, such as via an implantable device; or intracranial, such as by intraparenchymal, intrathecal, or intraventricular administration. HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents can also be delivered directly to target tissues, such as directly to the liver, directly to the kidneys, and the like. It should be understood that "delivering an HSD17B13 dsRNA agent" or "delivering an HSD17B13" antisense polynucleotide agent" refers to directly delivering an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent, respectively, as well as expressing an HSD17B13 dsRNA agent in a cell from an encoding vector delivered to the cell, or by any suitable means that causes the HSD17B13 dsRNA or HSD17B13 antisense polynucleotide agent to appear in the cell. The preparation and use of formulations and means for delivering inhibitory RNA are well known and routinely used in the art.

[0268] As used herein, a "pharmaceutical composition" comprises a pharmacologically effective amount of an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent of the present invention and a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" refers to a carrier for administering a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The term specifically excludes cell culture media. For orally administered drugs, pharmaceutically acceptable carriers include, but are not limited to, pharmaceutically acceptable excipients such as inert diluents, disintegrants, binders, lubricants, sweeteners, flavorings, colorants, and preservatives. Suitable inert diluents include sodium carbonate and calcium carbonate, sodium phosphate and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrants. Binders may include starch and gelatin, and, if present, lubricants are typically magnesium stearate, stearic acid, or talc. If desired, tablets may be coated with materials such as glyceryl monostearate or glyceryl distearate to delay absorption in the gastrointestinal tract. The agents included in the pharmaceutical formulations are further described below.

[0269] As used herein, terms such as "pharmacologically effective amount," "therapeutically effective amount," and "effective amount" refer to an amount of an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention that produces the desired pharmacological, therapeutic, or preventive result. For example, if a given clinical treatment is considered effective when a measurable parameter associated with a disease or condition is reduced by at least 10%, then the therapeutically effective amount of the agent for treating that disease or condition is the amount necessary to reduce that parameter by at least 10%. For example, a therapeutically effective amount of an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent can reduce HSD17B13 polypeptide levels by at least 10%.

[0270] effective dose

[0271] In some aspects, the methods of the present invention comprise contacting a cell with an effective amount of an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent to reduce HSD17B13 gene expression in the contacted cell. Certain embodiments of the methods of the present invention comprise administering to a subject an effective amount of an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent to effectively reduce HSD17B13 gene expression in the subject and treat an HSD17B13-related disease or condition. An "effective amount," as used with respect to reducing HSD17B13 expression and / or for treating an HSD17B13-related disease or condition, is an amount necessary or sufficient to achieve a desired biological effect. For example, an effective amount of an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent for treating an HSD17B13-related disease or condition can be an amount that (i) slows or stops the progression of the disease or condition; or (ii) reverses, alleviates, or eliminates one or more symptoms of the disease or condition. In some aspects of the invention, an effective amount is the amount of an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent that, when administered to a subject in need of treatment for an HSD17B13-associated disease or condition, results in a therapeutic response that prevents and / or treats the disease or condition. According to some aspects of the invention, an effective amount is the amount of an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent of the invention that, when combined with or co-administered with another therapeutic treatment for an HSD17B13-associated disease or condition, results in a therapeutic response that prevents and / or treats the disease or condition. In some embodiments of the invention, the biological effect of treating a subject with an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent of the invention can be the improvement and / or complete elimination of symptoms caused by an HSD17B13-associated disease or condition. In some embodiments of the present invention, the biological effect is complete elimination of an HSD17B13-associated disease or condition, as demonstrated, for example, by a diagnostic test that indicates the subject is free of the HSD17B13-associated disease or condition. A non-limiting example of a detectable physiological symptom includes a decrease in lipid accumulation in the liver of a subject following administration of an agent of the present invention. Additional art-known means of assessing the status of an HSD17B13-associated disease or condition can be used to determine the effect of the agents and / or methods of the present invention on an HSD17B13-associated disease or condition.

[0272] Typically, an effective amount of an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent, determined in a clinical trial to reduce HSD17B13 polypeptide activity to a level effective for treating an HSD17B13-associated disease or condition, is used to establish an effective dose in a test population relative to a control population in a blinded study. In some embodiments, an effective amount will be an amount that results in a desired response, such as a reduction in the amount of an HSD17B13-associated disease or condition in cells, tissues, and / or subjects suffering from the disease or condition. Thus, an effective amount of an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent that can treat an HSD17B13-associated disease or condition by reducing HSD17B13 polypeptide activity can be an amount that, when administered, reduces the amount of HSD17B13 polypeptide activity in a subject to less than the amount present in the cells, tissues, and / or subject in the absence of administration of the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent. In certain aspects of the invention, the level of HSD17B13 polypeptide activity and / or HSD17B13 gene expression present in cells, tissues, and / or subjects that have not been exposed to or administered an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent of the invention is referred to as a "control" amount. In some embodiments of the methods of the invention, the control amount in a subject is the amount in the subject prior to treatment. In other words, the level in the subject prior to administration of the HSD17B13 agent can be the control level for the subject and is compared to the level of HSD17B13 polypeptide activity and / or HSD17B13 gene expression in the subject after administration of the siRNA to the subject. In the case of treating an HSD17B13-related disease or condition, the desired response can be the reduction or elimination of one or more symptoms of the disease or condition in the cell, tissue, and / or subject. The reduction or elimination can be temporary or permanent. It will be appreciated that the status of an HSD17B13-associated disease or condition can be monitored using methods of determining HSD17B13 polypeptide activity, HSD17B13 gene expression, symptom assessment, clinical testing, etc. In some aspects of the invention, a desired response to treatment of an HSD17B13-associated disease or condition is delaying the onset of the disease or condition or even preventing the onset of the disease or condition.

[0273] The effective amount of a compound that modifies the activity of an HSD17B13 polypeptide can also be determined by evaluating the physiological effects of administering an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent on cells or subjects, such as the alleviation of an HSD17B13-related disease or condition after administration. Assays and / or symptom monitoring of subjects can be used to determine the efficacy of the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention, which can be administered in the context of the pharmaceutical compounds of the present invention, and to determine whether there is a response to treatment. Non-limiting examples are one or more tests known in the art for alanine transaminase (ALT) or aspartate transaminase (AST) profiles. Another non-limiting example is that one or more liver function tests known in the art can be used to determine the status of an HSD17B13-related liver disease or condition in a subject before and after treatment with an HSD17B13 dsRNA agent of the present invention.

[0274] Some embodiments of the present invention include methods for determining the efficacy of a dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention administered to a subject in treating an HSD17B13-related disease or condition by assessing and / or monitoring one or more "physiological characteristics" of an HSD17B13-related disease or condition in the subject. Non-limiting examples of physiological characteristics of an HSD17B13-related disease or condition are HSD17B13 mRNA levels, HSD17B13 protein levels, or HSD17B13 enzyme activity, or lipid levels in plasma or tissue samples, triglycerides, cholesterol levels (including LDL-C, HDL-C, VLDL-C, IDL-C, and total cholesterol), free fatty acid levels, or fat levels and / or lipid droplet levels in the liver, etc. Standard methods for determining such physiological characteristics are known in the art and include, but are not limited to, blood tests, imaging tests, physical examinations, etc.

[0275] It should be understood that the amount of HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent administered to a subject can be modified based, at least in part, on the subject's determined disease and / or condition state and / or physiological characteristics. The amount of treatment can be altered, for example, by increasing or decreasing the amount of HSD17B13-dsRNA agent or HSD17B13 antisense polynucleotide agent, by changing the composition of the HSD17B13-dsRNA agent or HSD17B13 antisense polynucleotide agent administered, by changing the route of administration, by changing the time of administration, etc.

[0276] The effective amount of an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent will vary depending on the specific condition being treated, the age and physical condition of the subject being treated, the severity of the condition, the duration of treatment, the nature of concurrent treatments (if any), the specific route of administration, and other factors within the knowledge and expertise of the healthcare practitioner. For example, the effective amount may depend on the desired level of HSD17B13 polypeptide activity and / or HSD17B13 gene expression to effectively treat an HSD17B13-related disease or condition. A skilled artisan can empirically determine the effective amount of a specific HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent of the invention for use in the methods of the invention without undue experimentation. In conjunction with the teachings provided herein, by selecting from the various HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents of the invention and weighing factors such as potency, relative bioavailability, patient weight, severity of adverse side effects, and preferred mode of administration, an effective prophylactic or therapeutic treatment regimen can be planned to effectively treat a specific subject. As used in embodiments of the present invention, an effective amount of the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention can be an amount that produces a desired biological effect in the cell when contacted with the cell.

[0277] It should be appreciated that HSD17B13 gene silencing can be determined constitutively or by genomic engineering in any cell expressing HSD17B13 and by any appropriate assay. In some embodiments of the invention, HSD17B13 gene expression is reduced by at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% by administering an HSD17B13 dsRNA agent of the invention. In some embodiments of the invention, HSD17B13 gene expression is reduced by between 5% and 10%, 5% and 25%, 10% and 50%, 10% and 75%, 25% and 75%, 25% and 100%, or between 50% and 100% by administering the HSD17B13 dsRNA agent of the invention.

[0278] dose

[0279] HSD17B13 dsRNA agents and HSD17B13 antisense polynucleotide agents are delivered in pharmaceutical compositions at a dose sufficient to inhibit HSD17B13 gene expression. In certain embodiments of the present invention, the dose of the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent is 0.01 to 200.0 mg / kg body weight of the recipient per day, typically 1 to 50 mg / kg body weight, 5 to 40 mg / kg body weight, 10 to 30 mg / kg body weight, 1 to 20 mg / kg body weight, 1 to 10 mg / kg body weight, 4 to 15 mg / kg body weight per day, inclusive. For example, an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent can be administered in an amount of about 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, 1.8 mg / kg per unit body weight as a single dose. kg,1.9mg / kg,2mg / kg,2.1mg / kg,2.2mg / kg,2.3mg / kg,2.4mg / kg,2.5mg / kg,2.6mg / kg,2.7mg / kg,2.8mg / kg,2.9mg / k g,3.0mg / kg,3.1mg / kg,3.2mg / kg,3.3mg / kg,3.4mg / kg,3.5mg / kg,3.6mg / kg,3.7mg / kg,3.8mg / kg,3.9mg / kg,4mg / kg ,4.1mg / kg,4.2mg / kg,4.3mg / kg,4.4mg / kg,4.5mg / kg,4.6mg / kg,4.7mg / kg,4.8mg / kg,4.9mg / kg,5mg / kg,5.1mg / kg ,5.2mg / kg,5.3mg / kg,5.4mg / kg,5.5mg / kg,5.6mg / kg,5.7mg / kg,5.8mg / kg,5.9mg / kg,6mg / kg,6.1mg / kg,6.2mg / kg, 6.3mg / kg, 6.4mg / kg, 6.5mg / kg, 6.6mg / kg, 6.7mg / kg, 6.8mg / kg, 6.9mg / kg, 7mg / kg, 7.1mg / kg, 7.2mg / kg, 7.3mg / kg, 7 .4mg / kg,7.5mg / kg,7.6mg / kg,7.7mg / kg,7.8mg / kg,7.9mg / kg,8mg / kg,8.1mg / kg,8.2mg / kg,8.3mg / kg,8.4mg / kg,8.5mg / kg,8.6mg / kg,8.7mg / kg,8.8mg / kg,8.9mg / kg,9mg / kg,9.1mg / kg,9.2mg / kg,9.3mg / kg,9.4mg / kg,9.5mg / kg,9.6mg / kg,9.7mg / kg,9 .8mg / kg, 9.9mg / kg, 10mg / kg, 11mg / kg, 12mg / kg, 13mg / kg, 14mg / kg, 15mg / kg, 16mg / kg, 17mg / kg, 18mg / kg, 19mg / kg, 20mg / kg, 21mg / kg, 22 mg / kg, 23mg / kg, 24mg / kg, 25mg / kg, 26mg / kg, 27mg / kg, 28mg / kg, 29mg / kg, 30mg / kg, 31mg / kg, 32mg / kg, 33mg / kg, 34mg / kg, 35mg / kg, 36mg / kg, 37mg / kg, 38mg / kg, 39mg / kg, 40mg / kg, 41mg / kg, 42mg / kg, 43mg / kg, 44mg / kg, 45mg / kg, 46mg / kg, 47mg / kg, 48mg / kg, 49mg / kg to 50mg / kg. .

[0280] A variety of factors can be considered when determining the dosage and delivery schedule of the HSD17B13 dsRNA agents of the present invention. The absolute amount of HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent delivered will depend on a variety of factors, including concurrent treatment, the number of doses, and individual subject parameters, including age, physical condition, body shape, and weight. These factors are well known to those of ordinary skill in the art and can be resolved using only routine experimentation. In some embodiments, a maximum dose, i.e., the highest safe dose based on sound medical judgment, can be used.

[0281] In some embodiments, the methods of the present invention may include administering 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more doses of HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents to a subject. In some cases, a pharmaceutical compound (e.g., comprising an HSD17B13 dsRNA agent or comprising an HSD17B13 antisense polynucleotide agent) may be administered to a subject at least daily, every other day, weekly, every other week, monthly, etc. The dosage may be administered once daily or more than once a day, for example, 2, 3, 4, 5 or more times within a 24-hour period. The pharmaceutical composition of the present invention may be administered once daily, or the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent may be administered in two, three or more divided doses at appropriate intervals throughout the day, or even by continuous infusion or delivery. Controlled release formulations. In some embodiments of the methods of the present invention, the pharmaceutical composition of the present invention is administered to a subject once daily or more, once weekly or more, once monthly or more, or once annually or more.

[0282] In some aspects, the methods of the present invention include administering a pharmaceutical compound alone, in combination with one or more other HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents, and / or in combination with other administered drug therapies or therapeutic activities or regimens to a subject suffering from an HSD17B13-related disease or condition. The pharmaceutical compound can be administered in the form of a pharmaceutical composition. The pharmaceutical composition used in the methods of the present invention can be sterile and contain an amount of HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent that reduces the activity of the HSD17B13 polypeptide to a level sufficient to produce the desired response in a unit of weight or volume suitable for administration to the subject. The dosage of the pharmaceutical composition comprising an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent that reduces the activity of the HSD17B13 protein administered to the subject can be selected based on various parameters, particularly the mode of administration used and the condition of the subject. Other factors include the desired duration of treatment. In the event that the subject's response is inadequate at the initial dose administered, higher doses (or substantially higher doses by a different, more localized route of delivery) may be employed to the extent permitted by patient tolerance.

[0283] treat

[0284] The methods and HSD17B13 dsRNA agents of the present invention can be used to treat HSD17B13-related diseases and conditions, wherein a decrease in the level and / or activity of an HSD17B13 polypeptide is effective in treating the disease or condition to inhibit HSD17B13 expression. Examples of diseases and conditions that can be treated with the HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents of the present invention and the treatment methods of the present invention include, but are not limited to, hepatitis, liver fibrosis, non-alcoholic steatohepatitis (NASH), fatty liver disease (NAFLD), cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), HCV-related cirrhosis, drug-induced liver injury, hepatocellular necrosis, and HSD17B13-related obesity. Such diseases and conditions may be referred to herein as "HSD17B13-related diseases and conditions" and "diseases and conditions caused and / or regulated by HSD17B13."

[0285] In certain aspects of the invention, an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent of the invention can be administered to a subject at one or more times before or after diagnosis of an HSD17B13-related disease or condition. In some aspects of the invention, a subject is at risk of having or developing an HSD17B13-related disease or condition. A subject at risk of developing an HSD17B13-related disease or condition is a subject who has an increased likelihood of developing an HSD17B13-related disease or condition compared to a control risk of developing an HSD17B13-related disease or condition. In some embodiments of the invention, the risk level can be statistically significant compared to the control risk level. At-risk subjects may include, for example, subjects who are or will be: subjects with a pre-existing disease and / or genetic abnormality that renders the subject more susceptible to developing an HSD17B13-related disease or condition than a control subject without the pre-existing disease or genetic abnormality; subjects with a family and / or personal history of an HSD17B13-related disease or condition; and subjects who have been previously treated for an HSD17B13-related disease or condition. It should be understood that a pre-existing disease and / or genetic abnormality that renders a subject more susceptible to developing an HSD17B13-related disease or condition can be a disease and / or genetic abnormality that has been previously identified as being associated with a higher likelihood of developing an HSD17B13-related disease or condition when present.

[0286] It should be understood that an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent can be administered to a subject based on the individual subject's medical condition. For example, a healthcare provider providing healthcare to a subject can assess the HSD17B13 level measured in a sample obtained from the subject and determine the desire to reduce the subject's HSD17B13 level by administering the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention. In this example, the HSD17B13 level can be considered a physiological characteristic of an HSD17B13-related condition, even if the subject has not been diagnosed with an HSD17B13-related disease, such as a disease disclosed herein. A healthcare provider can monitor changes in the subject's HSD17B13 level as a measure of the efficacy of the administered HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention. In a non-limiting example, a biological sample, such as a liver or serum sample, can be obtained from the subject and the subject's HSD17B13 level determined in the sample. The HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent is administered to a subject, and after administration, a blood or serum sample is obtained from the subject, and lipid levels are determined using the sample, and the results are compared with those determined in a pre-administration (previous) sample from the subject. A decrease in the subject's HSD17B13 level in the later sample compared to the pre-administration level indicates efficacy of the administered HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent in reducing lipid levels, liver fat, or liver lipid droplets in the subject.

[0287] Certain embodiments of the methods of the present invention include regulating treatment, which comprises administering a dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention to a subject based, at least in part, on an assessment of changes in one or more of the physiological characteristics of an HSD17B13-related disease or condition in the subject resulting from the treatment. For example, in some embodiments of the present invention, the effect of an administered dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention on a subject can be determined and used to help regulate the amount of the dsRNA agent or HSD17B13 antisense polynucleotide agent subsequently administered to the subject. In a non-limiting example, a dsRNA agent or HSD17B13 antisense polynucleotide agent of the invention is administered to a subject, the subject's HSD17B13 level is determined after administration, and based at least in part on the determined level, a higher amount of the dsRNA agent or HSD17B13 antisense polynucleotide agent is determined to be desirable to enhance the physiological effect of the administered agent, such as to reduce or further reduce the subject's HSD17B13 level, to determine the desired agent or HSD17B13 antisense polynucleotide agent. In another non-limiting example, a dsRNA agent or HSD17B13 antisense polynucleotide agent of the invention is administered to a subject, the subject's HSD17B13 level is determined after administration, and based at least in part on the determined level, a lower amount of the dsRNA agent or HSD17B13 antisense polynucleotide agent is desired to be administered to the subject.

[0288] Thus, some embodiments of the present invention include assessing changes in one or more physiological characteristics resulting from a previous treatment of a subject to adjust the amount of the dsRNA agent or HSD17B13 antisense polynucleotide agent of the invention subsequently administered to the subject. Some embodiments of the methods of the present invention include performing 1, 2, 3, 4, 5, 6 or more assays for physiological characteristics of an HSD17B13-associated disease or condition to assess and / or monitor the efficacy of the administered HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent of the invention, and optionally using the assays to adjust one or more of the dose, administration regimen, and / or frequency of administration of the dsRNA agent or HSD17B13 antisense polynucleotide agent of the invention to treat an HSD17B13-associated disease or condition in the subject. In some embodiments of the methods of the invention, the desired outcome of administering an effective amount of a dsRNA agent or HSD17B13 antisense polynucleotide agent of the invention to a subject is a decrease in HSD17B13 mRNA levels, HSD17B13 protein levels, or HSD17B13 enzyme activity levels in the subject, or lipid levels, triglycerides, cholesterol levels (including LDL-C, HDL-C, VLDL-C, IDL-C, and total cholesterol), free fatty acid levels in plasma or tissue samples, or fat levels and / or lipid droplet levels in the liver, as compared to pre-treatment levels or control levels determined in the subject.

[0289] As used herein, the terms "treat," "treated," or "treating" when used in reference to an HSD17B13-associated disease or disorder may refer to prophylactic treatment to reduce the likelihood that a subject will develop an HSD17B13-associated disease or disorder, and may also refer to treatment after a subject has developed an HSD17B13-associated disease or disorder in order to eliminate or reduce the level of the HSD17B13-associated disease or disorder, prevent the HSD17B13-associated disease or disorder from becoming more advanced (e.g., more severe), and / or slow the progression of the HSD17B13-associated disease or disorder in the subject, compared to a subject in the absence of treatment that reduces the activity of the HSD17B13 polypeptide in the subject.

[0290] Certain embodiments of the reagents, compositions, and methods of the present invention can be used to inhibit HSD17B13 gene expression. As used herein, with respect to the expression of the HSD17B13 gene, the terms "inhibit," "silence," "reduce," "downregulate," and "knockdown" refer to a decrease in the expression of the HSD17B13 gene as measured by one or more of the following: the level of RNA transcribed from the gene, the level of activity of HSD17B13 expressed, or the level of HSD17B13 translated from mRNA, when the cell, cell group, tissue, organ, or subject is contacted with (e.g., treated with) an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent of the present invention, as compared to a control level of RNA transcribed from the HSD17B13 gene, the level of activity of HSD17B13 expressed, or the level of HSD17B13 polypeptide, protein, or protein subunit translated from mRNA, respectively. In some embodiments, the control level is the level in a cell, tissue, organ, or subject that has not been contacted with (eg, treated with) an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent.

[0291] Application method

[0292] A variety of administration routes of HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents can be used in the methods of the present invention. The specific delivery mode selected will depend at least in part on the specific condition being treated and the dosage required for therapeutic efficacy. In general, the methods of the present invention can be implemented using any medically acceptable mode of administration, meaning any mode that produces an effective therapeutic level for HSD17B13-related diseases or conditions without causing clinically unacceptable side effects. In some embodiments of the present invention, HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents can be administered via oral, enteral, mucosal, subcutaneous and / or parenteral routes. The term "parenteral" includes subcutaneous, intravenous, intrathecal, intramuscular, intraperitoneal and intrasternal injection or infusion techniques. Other routes include, but are not limited to, nasal (e.g., through a gastric-nasal tube), transdermal, vaginal, rectal, sublingual and inhalation. The delivery routes of the present invention may include intrathecal, intraventricular or intracranial. In some embodiments of the present invention, an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent can be placed in a sustained-release matrix and administered by placing the matrix in a subject. In some aspects of the present invention, an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent can be delivered to a subject's cells using nanoparticles coated with a delivery agent that targets specific cells or organelles. Various delivery methods, methods, and agents are known in the art. Non-limiting examples of delivery methods and delivery agents are also provided elsewhere herein. In some aspects of the invention, the term "delivery" in relation to an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent can refer to administering one or more "naked" HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent sequences to a cell or subject, and in certain aspects of the invention, "delivery" refers to administering to a cell or subject by transfection, delivering a cell comprising an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent to a subject, or delivering a vector encoding an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent to a subject. Delivering an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent using transfection can include administering a vector to a cell and / or subject.

[0293] In some methods of the present invention, one or more HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents can be administered in a formulation that can be administered in a pharmaceutically acceptable solution that typically contains pharmaceutically acceptable concentrations of salt, a buffer, a preservative, a compatible carrier, an adjuvant, and optionally other therapeutic ingredients. In some embodiments of the present invention, the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent can be formulated with another therapeutic agent for simultaneous administration. According to the methods of the present invention, the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent can be administered in a pharmaceutical composition. Generally speaking, a pharmaceutical composition comprises an HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent and an optional pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are well known to those of ordinary skill in the art. As used herein, a pharmaceutically acceptable carrier refers to a nontoxic material that does not interfere with the effectiveness of the biological activity of the active ingredient (e.g., the ability of an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent to inhibit HSD17B13 gene expression in a cell or subject). Various methods of administering and delivering dsRNA agents or HSD17B13 antisense polynucleotide agents for therapeutic use are known in the art and can be used in the methods of the present invention.

[0294] Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art. Exemplary pharmaceutically acceptable carriers are described in U.S. Patent No. 4,970,009. U.S. Patent No. 5,211,657 and other patents are known to those skilled in the art. Such formulations may typically contain salts, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. When used in pharmaceuticals, the salt should be a pharmaceutically acceptable salt, but non-pharmaceutically acceptable salts can be conveniently used to prepare pharmaceutically acceptable salts thereof and are not excluded from the scope of the present invention. These pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, succinic acid, and the like. In addition, pharmaceutically acceptable salts can be prepared as alkali metal salts or alkaline earth metal salts, such as sodium salts, potassium salts, or calcium salts.

[0295] Some embodiments of the methods of the present invention include administering one or more HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents directly to a tissue. In some embodiments, the tissue to which the compound is administered is a tissue in which an HSD17B13-related disease or condition exists or may occur, a non-limiting example of which is the liver or kidney. Direct tissue administration can be achieved by direct injection or other means. Many orally delivered compounds naturally travel to and pass through the liver and kidneys, and some embodiments of the treatment methods of the present invention include orally administering one or more HSD17B13 dsRNA agents to a subject. The HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent, alone or in combination with other therapeutic agents, can be administered once, or alternatively, they can be administered multiple times. If administered multiple times, the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent can be administered by different routes.

[0296] For example, although not intended to be limiting, a first (or first few) administrations may be subcutaneous, and one or more additional administrations may be oral and / or systemic.

[0297] For embodiments in which systemic administration of the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent of the present invention is desired, the HSD17B13 dsRNA agent or HSD17B13 antisense polynucleotide agent can be formulated for parenteral administration by injection (e.g., by bolus injection or continuous infusion). Formulations for injection can be in unit dosage form, for example, in ampoules or multidose containers, with or without preservatives. HSD17B13 dsRNA agent formulations (also referred to as pharmaceutical compositions) can take the form of suspensions, solutions, or emulsions in oily or aqueous vehicles and can contain preparatants, such as suspending agents, stabilizers, and / or dispersants.

[0298] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Some examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils (e.g., olive oil), and injectable organic esters (e.g., ethyl oleate). Aqueous carriers include water, alcohol / aqueous solutions, emulsions, or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, glucose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutritional supplements, electrolyte supplements (e.g., those based on Ringer's dextrose), etc. Preservatives and other additives, such as antimicrobials, antioxidants, chelating agents, and inert gases, etc., may also be present. Lower doses will result from other forms of administration, such as intravenous administration. In the case where the response of the subject is insufficient under the initial dose applied, higher doses (or actually higher doses by different, more localized delivery routes) may be used within the extent allowed by patient tolerance. Multiple daily doses may be used as needed to achieve appropriate systemic or local levels of one or more HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents and to achieve appropriate reduction in HSD17B13 protein activity.

[0299] In other embodiments, the methods of the present invention include the use of a delivery vehicle suitable for implantation into a recipient (e.g., a subject), such as a biocompatible microparticle, nanoparticle, or implant. Exemplary bioerodible implants useful according to the method are described in PCT Publication No. WO 95 / 24929 (incorporated herein by reference), which describes a biocompatible, biodegradable polymer matrix for containing biomacromolecules.

[0300] In the methods of the present invention, both non-biodegradable and biodegradable polymer matrices can be used to deliver one or more HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents to a subject. In some embodiments, the matrix can be biodegradable. The matrix polymer can be a natural or synthetic polymer. The polymer can be selected based on the desired release time, typically from about a few hours to a year or longer. Typically, release over a period of several hours to three to twelve months is used. The polymer is optionally in the form of a hydrogel that can absorb up to about 90% of its weight in water and is optionally cross-linked with multivalent ions or other polymers.

[0301] Typically, in some embodiments of the present invention, bioerodible implants can be used to deliver HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents in a diffusion manner or by degradation of a polymer matrix. Exemplary synthetic polymers for such purposes are well known in the art. Biodegradable polymers and non-biodegradable polymers can be used to deliver HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents using methods known in the art. Bioadhesive polymers (e.g., bioerodible hydrogels) (see HSSawhney, CPPathak and J.A.Hubell in Macromolecules, 1993, 26, 581-587, which teachings are incorporated herein by reference) can also be used to deliver HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents for the treatment of HSD17B13 related diseases or conditions. Other suitable delivery systems may include timed release, delayed release, or sustained release delivery systems. Such a system can avoid repeated administration of HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents, increasing the convenience of the subject and healthcare professionals. Many types of release delivery systems are available and known to those of ordinary skill in the art. (See, for example, U.S. Patent Nos. 5,075,109; 4,452,775; 4,675,189; 5,736,152; 3,854,480; 5,133,974; and 5,407,686 (each of which is incorporated herein by reference). In addition, pump-based hardware delivery systems can be used, some of which are suitable for implantation.

[0302] The use of long-term sustained-release implants is suitable for the prophylactic treatment of subjects and subjects at risk for developing recurrent HSD17B13-related diseases or conditions. As used herein, long-term release means that the implant is constructed and arranged to deliver therapeutic levels of an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent for at least up to 10 days, 20 days, 30 days, 60 days, 90 days, six months, one year, or longer. Long-term sustained-release implants are well known to those of ordinary skill in the art and include some of the release systems described above.

[0303] HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents can be prepared for storage by mixing the molecules or compounds having the desired purity with optional pharmaceutically acceptable carriers, excipients or stabilizers [Remington's Pharmaceutical Sciences 21st edition, (2006)] in the form of lyophilized formulations or aqueous solutions. Acceptable carriers, excipients or stabilizers are non-toxic to recipients at the dosages and concentrations used and include buffers such as phosphates, citrates and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (e.g., octadecyldimethylbenzyl ammonium chloride; hexamethylammonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol and m-cresol); low molecular weight (less than about 1% or 2% of the total weight of the compound); 10 residues) polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., Zn-protein complexes); and / or nonionic surfactants such as or polyethylene glycol (PEG).

[0304] Cells, subjects, and controls

[0305] The methods of the present invention can be used in conjunction with cells, tissues, organs, and / or subjects. In some aspects of the present invention, the subject is a human or a vertebrate mammal, including but not limited to dogs, cats, horses, cattle, sheep, mice, rats, and primates, such as monkeys. Thus, the present invention can be used to treat HSD17B13-related diseases or conditions in both human and non-human subjects. In some aspects of the present invention, the subject can be a farm animal, zoo animal, domestic animal, or non-domestic animal, and the methods of the present invention can be used in veterinary prevention and treatment protocols. In some embodiments of the present invention, the subject is a human and the methods of the present invention can be used in human prevention and treatment protocols.

[0306] Some non-limiting examples of subjects that can be applied to the present invention are subjects diagnosed with, suspected of having, or at risk of having a disease or condition associated with higher than desired expression and / or activity of HSD17B13 (also referred to as "elevated HSD17B13 expression levels"). Some non-limiting examples of diseases and conditions associated with higher than desired levels of HSD17B13 expression and / or activity are described elsewhere herein. The methods of the present invention can be applied to subjects who have been diagnosed with, or are believed to be at risk of having or developing a disease or condition associated with higher than desired expression and / or activity of HSD17B13 at the time of treatment. In some aspects of the present invention, the disease or condition associated with higher than desired levels of HSD17B13 expression and / or activity is an acute disease or condition, and in certain aspects of the present invention, the disease or condition associated with higher than desired levels of HSD17B13 expression and / or activity is a chronic disease or condition.

[0307] In one non-limiting example, an HSD17B13 dsRNA agent of the present invention is administered to a subject diagnosed with, suspected of having, or at risk for statin-resistant hypercholesterolemia, a condition in which reduction of HSD17B13 expression is desired. The methods of the present invention can be applied to subjects who have been diagnosed with, or are believed to be at risk for, the disease or condition at the time of treatment.

[0308] In another non-limiting example, an HSD17B13 dsRNA agent of the present invention is administered to a subject diagnosed with, suspected of having, or at risk of having hyperlipidemia, a condition for which reduction of HSD17B13 expression is desired. The methods of the present invention can be applied to subjects who have been diagnosed with, or are believed to be at risk of having or developing, such a disease or condition at the time of treatment.

[0309] The cells applicable to the methods of the present invention include cells that are in vitro, in vivo, or in vitro cells. The cells can be in an object, in a culture, and / or in a suspension, or in any other suitable state or condition. The cells applicable to the methods of the present invention can be hepatocytes (liver cell), hepatocytes (hepatocyte), cardiomyocytes, pancreatic cells, cardiovascular cells, kidney cells, or other types of vertebrate cells, including human and non-human mammalian cells. In some aspects of the present invention, the cells applicable to the methods of the present invention are healthy normal cells that are not known to be disease cells. In some embodiments of the present invention, the cells applied to the methods and compositions of the present invention are hepatocytes (liver cell), hepatocytes (hepatocyte), cardiomyocytes, pancreatic cells, cardiovascular cells, and / or kidney cells. In some aspects of the present invention, control cells are normal cells, but it should be understood that cells with a disease or illness can also be used as control cells in certain cases, for example, to compare the results of treated cells with untreated cells with a disease or illness, etc.

[0310] According to the methods of the present invention, the level of HSD17B13 polypeptide activity can be determined and compared to a control level of HSD17B13 polypeptide activity. The control can be a predetermined value, which can take a variety of forms. It can be a single cutoff value, such as a median or mean. It can be established based on comparison groups, such as a group with normal levels of HSD17B13 polypeptide and / or HSD17B13 polypeptide activity and a group with elevated levels of HSD17B13 polypeptide and / or HSD17B13 polypeptide activity. Another non-limiting example of a comparison group can be a group that has one or more symptoms of, or has been diagnosed with, an HSD17B13-related disease or condition; a group that does not have one or more symptoms of, or has not been diagnosed with, an HSD17B13-related disease or condition; a group that has been treated with an siRNA of the present invention; or a group that has not been treated with an siRNA of the present invention. Typically, the control can be based on apparently healthy normal individuals of an appropriate age range or apparently healthy cells. It should be understood that the control according to the present invention can also be a sample of material tested in parallel with the experimental material, in addition to a predetermined value. Examples include samples from a control population or control samples generated by manufacturing to be tested in parallel with experimental samples. In some embodiments of the present invention, the control may include cells or subjects that have not been contacted or treated with the HSD17B13 dsRNA agents of the present invention, and in such cases, the control levels of HSD17B13 polypeptides and / or HSD17B13 polypeptide activity can be compared to the levels of HSD17B13 polypeptides and / or HSD17B13 polypeptide activity in cells or subjects contacted with the HSD17B13 dsRNA agents or HSD17B13 antisense polynucleotide agents of the present invention.

[0311] In some embodiments of the present invention, the HSD17B13 polypeptide level determined for a subject can be a control level to which the HSD17B13 polypeptide level determined for the same subject at a different time is compared. In a non-limiting example, the HSD17B13 level is determined from a biological sample obtained from a subject who has not yet been administered an HSD17B13 treatment according to the present invention. In some embodiments, the biological sample is a serum sample. In some embodiments, the biological sample is a liver sample. The HSD17B13 polypeptide level determined in a sample obtained from a subject can be used as a baseline or control value for the subject. In the treatment methods of the present invention, after one or more administrations of an HSD17B13 dsRNA agent to a subject, one or more additional serum samples can be obtained from the subject, and the HSD17B13 polypeptide level in the subsequent one or more samples can be compared to the subject's control / baseline level. Such a comparison can be used to assess the onset, progression, or regression of an HSD17B13-related disease or condition in a subject. For example, a level of HSD17B13 polypeptide in a baseline sample obtained from a subject that is higher than the level obtained from the same subject after administration of an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent of the invention to the subject indicates regression of an HSD17B13-associated disease or disorder and indicates efficacy of the administered HSD17B13 dsRNA agent of the invention for treating an HSD17B13-associated disease or disorder.

[0312] In some aspects of the invention, one or more values of the level of HSD17B13 polypeptide and / or HSD17B13 polypeptide activity determined for a subject can be used as a control value for later comparison of the level of HSD17B13 polypeptide and / or HSD17B13 activity in the same subject, thereby allowing assessment of changes in "baseline" HSD17B13 polypeptide activity in a subject. Thus, an initial HSD17B13 polypeptide level and / or an initial HSD17B13 polypeptide activity level can be present in a subject and / or determined in a subject, and the methods and compounds of the invention can be used to reduce the level of HSD17B13 polypeptide and / or HSD17B13 polypeptide activity in a subject, wherein the initial level serves as a control level for the subject.

[0313] Using the methods of the present invention, HSD17B13 dsRNA agents and / or HSD17B13 antisense polynucleotide agents of the present invention can be administered to a subject. The efficacy of the administration and treatment of the present invention can be assessed when the level of the HSD17B13 polypeptide in a serum sample obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more compared to the pre-administration level of the HSD17B13 polypeptide in a serum sample obtained from the subject at a previous time point, or compared to a non-contact control level (e.g., the level of the HSD17B13 polypeptide in a control serum sample). It should be understood that both the level of the HSD17B13 polypeptide and the level of HSD17B13 polypeptide activity are correlated with the level of HSD17B13 gene expression. Certain embodiments of the methods of the invention comprise administering to a subject an amount of an HSD17B13 dsRNA and / or an HSD17B13 antisense agent of the invention effective to inhibit HSD17B13 gene expression, and thereby reduce HSD17B13 polypeptide levels and reduce HSD17B13 polypeptide activity levels in the subject.

[0314] Some embodiments of the present invention include determining the presence, absence, and / or amount (also referred to herein as level) of an HSD17B13 polypeptide in one or more biological samples obtained from one or more subjects. This assay can be used to assess the effectiveness of the therapeutic methods of the present invention. For example, the methods and compositions of the present invention can be used to determine the level of an HSD17B13 polypeptide in a biological sample obtained from a subject previously treated with an HSD17B13 dsRNA agent and / or an HSD17B13 antisense agent of the present invention. A level of an HSD17B13 polypeptide determined in a serum sample obtained from a treated subject that is at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more lower than the pre-treatment level of the HSD17B13 polypeptide determined for the subject, or compared to the level in an untreated control biological sample, indicates the effectiveness of the treatment administered to the subject.

[0315] In some embodiments of the present invention, a physiological characteristic of an HSD17B13-related disease or condition determined for a subject can be a control determination for a physiological characteristic determined for the same subject at a different time. In non-limiting examples, a physiological characteristic such as HSD17B13 mRNA level, HSD17B13 protein level, or HSD17B13 enzyme activity in a subject, or lipid levels, triglycerides, cholesterol levels, free fatty acid levels in a plasma or tissue sample, or fat levels and / or lipid droplet levels in the liver, determined in a biological sample (e.g., a liver or serum sample) obtained from a subject not treated with HSD17B13 of the present invention can be used as a baseline or control value for the subject. After one or more administrations of an HSD17B13 dsRNA agent to a subject in the therapeutic methods of the present invention, one or more additional liver or serum samples can be obtained from the subject, and the HSD17B13 mRNA levels and / or HSD17B13 protein levels in the subsequent samples or samples can be compared to the control / baseline levels and / or ratios of the subject, respectively. Such comparisons can be used to assess the onset, progression, or regression of an HSD17B13-associated disease or condition in a subject. For example, after administration of an HSD17B13 dsRNA agent or an HSD17B13 antisense polynucleotide agent of the present invention to a subject, an HSD17B13 mRNA level in a baseline sample obtained from the subject that is higher than the HSD17B13 mRNA level determined in a sample obtained from the same subject indicates regression of an HSD17B13-associated disease or condition, and indicates the efficacy of the administered HSD17B13 dsRNA agent of the present invention in treating an HSD17B13-associated disease or condition.

[0316] In some aspects of the invention, the values of one or more physiological characteristics of an HSD17B13-associated disease or condition determined for a subject can serve as control values for later comparisons of the physiological characteristics in the same subject, thereby allowing assessment of changes in the subject's "baseline" physiological characteristics. Thus, an initial physiological characteristic can be present in a subject and / or determined in a subject, and the methods and compounds of the invention can be used to reduce HSD17B13 polypeptide levels and / or HSD17B13 polypeptide activity in a subject, wherein the initial physiological characteristic determination serves as a control for that subject.

[0317] Using the methods of the present invention, the HSD17B13 dsRNA agents and / or HSD17B13 antisense polynucleotide agents of the present invention can be administered to a subject in an effective amount to treat an HSD17B13 disease or condition. The efficacy of the administration and treatment of the present invention can be assessed by determining changes in one or more physiological characteristics of an HSD17B13 disease or condition. In a non-limiting example, the HSD17B13 mRNA level in a serum sample obtained from a subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more compared to pre-administration lipids in a serum sample obtained from the subject at a previous time point, or compared to a non-contact control level (e.g., HSD17B13 mRNA level in a control serum sample). It is understood that the level of HSD17B13 mRNA, HSD17B13 protein, or HSD17B13 enzymatic activity in a subject, or the level of lipids, triglycerides, cholesterol, free fatty acids in plasma or tissue samples, or the level of fat and / or lipid droplets in the liver are each correlated with the level of HSD17B13 gene expression. Certain embodiments of the methods of the present invention comprise administering to a subject an effective amount of an HSD17B13 dsRNA agent and / or an HSD17B13 antisense agent of the present invention to effectively inhibit HSD17B13 gene expression and thereby reduce the level of HSD17B13 mRNA, HSD17B13 protein, or HSD17B13 enzymatic activity in the subject, or otherwise positively affect the physiological characteristics of an HSD17B13-associated disease or condition in the subject.

[0318] Some embodiments of the present invention include determining the presence, absence, and / or changes in physiological characteristics of an HSD17B13-associated disease or condition using, for example, but not limited to, the following methods: (1) evaluating physiological characteristics of one or more biological samples obtained from one or more subjects; (2) imaging the subject (for example, but not limited to, obtaining liver images); and (3) or physical examination of the subject. This determination can be used to evaluate the efficacy of the treatment methods of the present invention.

[0319] medicine box

[0320] The present invention also includes kits comprising one or more HSD17B13 dsRNA agents and / or HSD17B13 antisense polynucleotide agents and instructions for use in the methods of the present invention. The kits of the present invention may include one or more HSD17B13 dsRNA agents, HSD17B13 sense polynucleotides, and HSD17B13 antisense polynucleotide agents useful for treating HSD17B13-associated diseases or conditions. Kits comprising one or more HSD17B13 dsRNA agents, HSD17B13 sense polynucleotides, and HSD17B13 antisense polynucleotide agents may be prepared for use in the therapeutic methods of the present invention. The components of the kits of the present invention may be packaged in an aqueous medium or in a lyophilized form. The kits of the present invention may include a carrier that is partitioned into a hermetically sealed container housing one or more container devices or a series of container devices, such as test tubes, vials, flasks, bottles, syringes, and the like. The first container means or a series of container means may contain one or more compounds, such as HSD17B13 dsRNA agents and / or HSD17B13 sense or antisense polynucleotide agents. The second container means or a series of container means may contain a targeting agent, a labeling agent, a delivery agent, etc., which may be included as part of the HSD17B13 dsRNA agent and / or HSD17B13 antisense polynucleotide to be administered in one embodiment of the treatment method of the present invention.

[0321] The kit of the present invention may also include instructions. The instructions are typically in written form and provide guidance for performing the treatment achieved by the kit and making decisions based on the treatment.

[0322] The following examples are provided to illustrate specific examples of the practice of the present invention and are not intended to limit the scope of the invention. It will be apparent to those skilled in the art that the present invention will be applied in a variety of compositions and methods. Specific embodiments

[0324] Example 1. Preparation of Intermediate-A and Intermediate-B.

[0325] As shown in Scheme 1 below, intermediate A is synthesized by treating commercially available galactosamine pentaacetate with trimethylsilyl trifluoromethanesulfonate (TMSOTf) in dichloromethane (DCM). Subsequently, glycosylation is performed with Cbz-protected 2-(2-aminoethoxy)ethane-1-ol to obtain compound II. The Cbz protecting group is removed by hydrogenation to obtain intermediate A as a trifluoroacetic acid (TFA) salt. Intermediate B is synthesized based on the same scheme except that Cbz-protected 2-(2-(2-aminoethoxy)ethoxy)ethane-1-ol is used as the starting material.

[0326]

[0327] Option 1

[0328] To a solution of compound I (20.0 g, 51.4 mmol) in 100 mL of 1,2-dichloroethane (DCE) was added TMSOTf (17.1 g, 77.2 mmol). The resulting reaction solution was stirred at 60° C. for 2 hours and then at 25° C. for 1 hour. 2-(2-aminoethoxy) ethane-1-alcohol (13.5g, 56.5mmol) of the Cbz protection in DCE (100mL) of powdered molecular sieve (10g) drying is at N Under atmosphere, dropwise add in above-mentioned reaction solution at 0 ℃.With gained reaction mixture at N Under atmosphere, stirred 16 hours at 25 ℃.Reaction mixture is filtered and with saturated NaHCO (200mL), water (200mL) and saturated brine (200mL) washing.With organic layer through anhydrous Na SO Drying, filter and under reduced pressure concentrate, to obtain crude product, it is ground 2 hours together with 2-methyltetrahydrofuran / heptane (5 / 3, v / v, 1.80L).Gained mixture is filtered and dried, to obtain Compound II (15.0g, 50.3% productive rate) as white solid.

[0329] 10% Pd / C (1.50 g) was carefully added to a dried and argon-purged hydrogenation bottle, followed by 10 mL of tetrahydrofuran (THF), and then a solution of compound II (15.0 g, 26.4 mmol) in THF (300 mL) and TFA (trifluoroacetic acid, 3.00 g, 26.4 mmol). The resulting mixture was degassed and purged three times with H2 and stirred at 25 ° C for 3 hours under an atmosphere of H2 (45 psi). Thin-layer chromatography (TLC, solvent: DCM: MeOH = 10: 1) showed that compound II was completely consumed. The reaction mixture was filtered and concentrated under reduced pressure. The residue was dissolved in anhydrous DCM (500 mL) and concentrated. The process was repeated 3 times to obtain intermediate A (14.0 g, 96.5% yield) as a foamy white solid. 1H NMR (400MHz DMSO-d6): δppm 7.90 (d, J=9.29Hz, 1H), 7.78 (br s, 3H), 5.23 (d, J = 3.26Hz, 1H), 4.98 (dd, J = 11.29, 3.26Hz, 1H), 4.56 (d, J = 8. 53Hz,1H),3.98-4.07(m,3H),3.79-3.93(m,2H),3.55-3.66(m,5H),2.98(br d,J=4.77Hz,2H),2.11(s,3H),2.00(s,3H),1.90(s,3H),1.76(s,3H).

[0330] Intermediate B was synthesized using a similar procedure as used for the synthesis of Intermediate A. 1 H NMR(400MHzDMSO-d6): δppm 7.90(br d,J=9.03Hz,4H),5.21(d,J=3.51Hz,1H),4.97(dd,J=11.1Hz,1H),4.54(d,J=8.53Hz,1H), 3.98-4.06(m,3H),3.88(dt,J=10.9Hz,1H),3.76-3.83(m,1H),3.49-3.61(m,9H),2.97(br s,2H),2.10(s,3H),1.99(s,3H),1.88(s,3H),1.78(s,3H).Mass calc.for C 20 H 34 N2O 11 :478.22; found:479.3(M+H + ).

[0331] Example 2. Synthesis of GalNAc ligand cluster phosphoramidites GLPA1, GLPA2, and GLPA15.

[0332] GLPA1 and GLPA2 were prepared according to Scheme 2 below. Starting from benzyl-protected propane-1,3-diamine, it was alkylated with tert-butyl 2-bromoacetate to give the triester compound I. The benzyl protecting group was removed by hydrogenation to give the secondary amine compound II. The amide was coupled with 6-hydroxyhexanoic acid to give compound III. The tert-butyl protecting group was then removed after treatment with HCl in dioxane to produce the triacid compound IV. An amide coupling was performed between the triacid compound IV and intermediate A or intermediate B to give compound Va or Vb. The phosphoramidite GLPA1 or GLPA2 was synthesized by phosphorylating compound Va or Vb with 2-cyanoethyl N,N-diisopropylchlorophosphoramidite and a catalytic amount of 1H-tetrazole.

[0333]

[0334] Option 2

[0335] To a solution of N-benzyl-1,3-propanediamine (5.00 g, 30.4 mmol) in dimethylformamide (DMF, 100 mL) was added tert-butyl 2-bromoacetate (23.7 g, 121 mmol), followed by the dropwise addition of diisopropylethylamine (DIEA, 23.61 g, 182 mmol). The resulting reaction mixture was stirred at 25°C to 30°C for 16 hours. LCMS showed that N-benzyl-1,3-propanediamine had been completely consumed. The reaction mixture was diluted with H2O (500 mL) and extracted with EtOAc (500 mL x 2). The combined organics were washed with saturated brine (1 L), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to give the crude product, which was purified by silica gel column chromatography (gradient: petroleum ether:ethyl acetate 20:1 to 5:1). Compound I (12.1 g, 78.4% yield) was obtained as a colorless oil. 1 HNMR (400MHz, CDCl3): δppm 7.26-7.40(m,5H),3.79(s,2H),3.43(s,4H),3.21(s,2H),2.72(dt,J=16.9,7.34Hz,4H),1.70(quin,J=7.2Hz,2H),1.44-1.50(m,27H).

[0336] The dried hydrogenation bottle was purged with argon three times. Pd / C (200mg, 10%) was added, followed by MeOH (5mL), and then a solution of compound I (1.00g, 1.97mmol) in MeOH (5mL) was added. The reaction mixture was degassed under vacuum and refilled with H2. The process was repeated three times. The mixture was stirred at 25°C for 12 hours under an H2 (15psi) atmosphere. LCMS showed that compound I was completely consumed. The reaction mixture was filtered under reduced pressure under an N2 atmosphere. The filtrate was concentrated under reduced pressure to obtain compound II (655mg, 79.7% yield) as a yellow oil, which can be used in the next step without further purification. 1 H NMR (400MHz, CDCl3): δppm 3.44 (s, 4H), 3.31 (s, 2H), 2.78 (t, J = 7.1Hz, 2H), 2.68 (t, J = 6.9Hz, 2H), 1.88 (br s, 1H), 1.69 (quin, J = 7.03Hz, 2H), 1.44-1.50 (s, 27H).

[0337] By compound II (655mg, 1.57mmol), 6-hydroxyhexanoic acid (249mg, 1.89mmol), DIEA (1.02g, 7.86mmol), 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDCI, 904mg, 4.72mmol) and 1-hydroxybenzotriazole (HOBt, 637mg, 4.72mmol) in DMF (6mL) mixture degassed and with N purge 3 times, and then under N atmosphere at 25 DEG C, stirred 3 hours.LCMS shows desired product.Reactant mixture is diluted with H o (10mL) and extracted with EtOAc 20mL (10mL×2). The organics were combined and washed with saturated brine (20 mL), dried over anhydrous Na2SO4, filtered, and concentrated to give the crude product, which was purified by silica gel column chromatography (Gradient: petroleum ether:ethyl acetate 5:1 to 1:1) to give Compound III (650 mg, 77.8% yield) as a yellow oil. 1 H NMR (400MHz, CDCl3): δppm3.90-3.95(s,2H),3.63(t,J=6.40Hz,2H),3.38-3.45(m,6 H),2.72(t,J=6.65Hz,2H),2.40(t,J=7.28Hz,2H),1.55-1.75(m,8H),1.44(s,27H).C 27 H 50 Calculated mass of N2O8: 530.36; Found: 531.3 (M+H + ).

[0338] A mixture of compound III (5.5 g, 10.3 mmol) in HCl / dioxane (2 M, 55 mL) was stirred at 25 ° C for 3 hours. LCMS showed complete consumption of compound III. The reaction mixture was filtered, washed with EtOAc (50 mL), and dried under reduced pressure to obtain a crude product. It was dissolved in CH3CN (50 mL) and volatiles were removed under vacuum. The process was repeated 3 times to obtain compound IV (2.05 g, 54.5% yield) as a white solid. 1H NMR (400MHz, D2O): δppm 4.21(s,1H),4.07(d,J=4.5Hz,4H),3.99(s,1H),3.45-3.52(m,3H),3. 42(t,J=6.5Hz,1H),3.32-3.38(m,1H),3.24-3.31(m,1H),2.37(t,J=7 .4Hz,1H),2.24(t,J=7.4Hz,1H),1.99(dt,J=15.5,7.53Hz,1H),1.85-1.94(m,1H),1.85-1.94(m,1H),1.39-1.56(m,4H),1.19-1.31(m,2H).

[0339] A mixture of compound IV (500mg, 1.05mmol), intermediate A (2.02g, 3.67mmol), DIEA (813mg, 6.30mmol), EDCI (704mg, 3.67mmol) and HOBt (496mg, 3.67mmol) in DMF (10mL) is degassed and purged with N2 3 times, and then the mixture is stirred at 25 DEG C under N2 atmosphere for 3 hours.LCMS shows the desired product. The reaction mixture is quenched by adding H2O (10mL), extracted with DCM (10mL×2). The combined organic matter is extracted with 10% citric acid (20mL). The aqueous phase is neutralized with saturated NaHCO3 solution and extracted again with DCM (10mL×2). The organic matter is dried over sodium sulfate, filtered and concentrated under reduced pressure to obtain compound Va (570mg, 0.281mmol, 26.8% yield) as a white solid. 1 H NMR: (400MHz, CDCl3)ppmδ7.84-8.12(m,3H),6.85-7.15(m,2H),6.66-6.81(m,1H),5.36(br d,J=2.7Hz,3H),5.11-5.27(m,3H),4.63-4.85(m,3H),3.90-4.25(m,18H),3.37-3.75(m,28H),3.15-3.28(m,4H),2.64(br d,J=6.53Hz,2H),2.30-2.46(m,2H),2.13-2.18(m,9H),2.05(s,9H),1.94-2.03(m,18H),1.68(br s,2H),1.45(br s,2H),1.12(br t,J=7.0Hz,2H).

[0340] At ambient temperature under N2, diisopropylammonium tetrazolate (30.3 mg, 0.177 mmol) was added to a solution of compound Va (260 mg, 0.161 mmol) in anhydrous DCM (5 mL), followed by dropwise addition of 3-bis(diisopropylamino)phosphonooxypropionitrile (194 mg, 0.645 mmol). The reaction mixture was stirred at 20 to 25 ° C for 2 hours. LCMS showed that compound Va was completely consumed. After being cooled to -20 ° C, the reaction mixture was added to the stirred salt water / saturated NaHCO3 aqueous solution (1: 1, 5 mL) at 0 ° C. After stirring for 1 minute, DCM (5 mL) was added. Separating layer. Organic matter was washed with salt water / saturated NaHCO3 aqueous solution (1: 1, 5 mL), dried over Na2SO4, filtered and concentrated to approximately 1 mL volume. Under stirring, the residue solution was added dropwise to 20 mL methyl tert-butyl ether (MTBE). This resulted in a white solid precipitate. The mixture was centrifuged and the solid collected. The solid was redissolved in 1 mL of DCM and precipitated by adding MTBE (20 mL). The solid was isolated again by centrifugation. The collected solid was dissolved in anhydrous CH3CN. Volatiles were removed. This process was repeated two more times to obtain the GalNAc ligand phosphoramidite compound GLPA1 (153 mg, 84.4 μmol) as a white solid. 1 H NMR (400MHz, CDCl3): ppmδ7.71-8.06(m,2H),6.60-7.06(m,3H),5.37(br d,J=3.0Hz,3H),5.18-5.32(m,3H),4.70-4.86(m,3H),3.92-4.25(m,18H),3.42-3.85(m,30H),3.25(m ,4H),2.59-2.75(m,4H),2.27-2.44(m,2H),2.15-2.20(s,9H)2.07(s,9H),1.96-2.03(m,18H),1.65(br s,4H),1.44(brd,J=7.28Hz,2H),1.14-1.24(m,12H). 31 P NMR (CDCl3): ppmδ147.15.

[0341] The GalNAc ligand phosphoramidite compound GLPA2 was synthesized using the same procedure except that intermediate B was used. 1H NMR (400MHz, CDCl3): ppmδ7.94-8.18(m,1H),7.69(br s,1H),6.66-7.10(m,3H),5.35(d,J=3.5Hz,3H),5.07-5.25(m,3H),4.76-4 .86(m,3H),4.01-4.31(m,10H),3.91-4.01(m,8H),3.74-3.86(m,4H),3.52- 3.71(m,30H),3.42-3.50(m,6H),3.15-3.25(m,4H),2.52-2.70(m,4H),2.2 2-2.45(m,2H),2.15-2.22(s,9H),2.06(s,9H),1.95-2.03(m,18H),1.77(br s,2H),1.58-1.66(m,4H),1.40(m,2H),1.08-1.24(m,12H). 31 P NMR (CDCl3): ppmδ147.12.

[0342] GLPA15 was prepared according to the following protocol 3:

[0343]

[0344] Option 3

[0345] Starting with secondary amine compound I (compound II in Scheme 2), Cbz protection is introduced to yield compound II. The tert-butyl group of compound II is removed by acid treatment to yield triacid compound III. Compound III undergoes amide coupling with intermediate A to yield compound IV. The Cbz protecting group of compound IV is removed by hydrogenation to yield secondary amine compound V, which reacts with glutaric anhydride to yield carboxyl compound VI. Compound VI reacts with piperidin-4-ol under amide coupling reaction conditions to yield compound VII. Phosphoramidite compound GLPA15 is synthesized by treating compound VII with 2-cyanoethyl N,N-diisopropylchlorophosphoramidite and a catalytic amount of 1H-tetrazole.

[0346] 1H NMR (400MHz in DMSO-d6): δppm 8.05(br d,J=6.50Hz,2H),7.81(br d,J=9.01Hz,3H),5.22(d,J=3.25Hz,3H),4.98(dd,J=11.26,3.25Hz,3H),4.55(br d,J=8.50Hz,3H),4.03(s,9H),3.64-3.97(m,12H),3.55-3.63(m,6H),3.50(br s,5H),3.40(brd,J=6.13Hz,6H),3.17-3.30(m,9H),3.07(br d,J=14.26Hz,4H),2.76(t,J=5.82Hz,2H),2.18-2.47(m,6H),2.10(s,9H),1.9 9(s,9H),1.89(s,9H),1.78(s,9H),1.52-1.74(m,6H),1.12-1.19(m,12H).31P NMR (DMSO-d6): ppm δ 145.25.

[0347] In certain studies, methods for attaching a targeting group comprising GalNAc (also referred to herein as a GalNAc delivery compound) to the 5' end of the sense strand include using a synthetic process using a GalNAc phosphoramidite (GLPA1) in the final coupling step of a solid phase synthesis, for example, if an oligonucleotide chain extension process is performed to add nucleotides to the 5' end of the sense strand.

[0348] In some studies, methods for attaching a targeting group comprising GalNAc to the 3' end of the sense strand include using a solid support (CPG) comprising GLO-n. In some studies, methods for attaching a targeting group comprising GalNAc to the 3' end of the sense strand include attaching the GalNAc targeting group to a CPG solid support via an ester bond and using the resulting CPG with the attached GalNAc targeting group when synthesizing the sense strand, resulting in the GalNAc targeting group being attached to the 3' end of the sense strand.

[0349] Example 3. Phosphoramidite Compound 2

[0350]

[0351] 4,4'-Dimethoxytriphenylmethane chloride (DMTrCl, 232 g, 684 mmol, 1.0 eq) in pyridine (400 mL) was added to a solution of Compound A (isomannitol, 100 g, 684 mmol, 1.0 eq) in pyridine (600 mL), and the mixture was stirred at 25°C for 16 hours. LC-MS showed complete consumption of Compound A, and a major peak with the desired mass was detected. The resulting reaction mixture was diluted with water (500 mL) and extracted with dichloromethane (500 mL x 2). The combined organic phases were washed with brine (500 mL), dried over Na2SO4, and concentrated in vacuo to obtain a residue. The residue was purified by column chromatography (DCM / MeOH = 100 / 1 to 50 / 1, 0.1% Et3N) to obtain Compound B (150 g, 48.9% yield) as a yellow solid.

[0352] 1 H NMR: EC4783-404-P1B1_C (400MHz, DMSO-d6) δppm 7.46 (br d, J=7.63Hz, 2H) 7.28-7.37 (m, 6H) 7.19-7.25 (m, 1H) 6.90 (br d,J=7.88Hz,4H)4.70(d,J=6.50Hz,1H)3.99-4.09(m,6H)3.88-3.96(m,2H)3.83(br dd,J=7.82,6.94Hz,1H)3.74(s,6H)3.41(brt,J=8.13Hz,1H)3.05(t,J=8.44Hz,1H)2.85(br t,J=7.50Hz,1H).

[0353] To a solution of compound B (80.0 g, 178 mmol, 1.0 eq) in dichloromethane (5.0 mL) under N2 atmosphere was added dropwise 2H-tetrazole (0.45 M, 436 mL, 1.1 eq) at 25°C, followed by the addition of a solution of compound C (2-cyanoethyldiisopropylchlorophosphoramidite, 80.6 g, 267 mmol, 85.0 mL, 1.5 eq) in dichloromethane (200 mL); the reaction mixture was stirred at 25°C for 1.0 h; LC-MS showed that compound B was completely consumed, and a major peak with the desired mass was detected. The resulting reaction mixture was cooled to -20°C and poured into ice-cold saturated NaHCO₃ (500 mL), extracted with dichloromethane (500 mL * 3), and the combined organic layers were washed with NaHCO₃ / brine = 1:1 (300 mL / 300 mL), dried over Na₂SO₄, and concentrated in vacuo (35°C) to obtain a residue (100 mL). The residue was purified by column chromatography (Al₂O₃, DCM / MeOH = 100 / 1 to 50 / 1, 0.1% Et₃N) to give isomannitol phosphoramidite compound 2 (77 g, 119 mmol, 66.5% yield) as a white solid.

[0354] 1 H NMR: EC4783-423-P1B1_C (400MHz, DMSO-d6) δppm 7.22 (br d, J=7.50Hz, 2H) 7.05-7.14 (m, 6H) 6.96-7.02 (m, 1H) 6.67 (br dd,J=8.82,1.81Hz,4H)3.95-4.07(m,2H)3.73-3.83(m,1H)3.62-3.72(m,2H)3.48-3.53(m ,6H)3.27-3.37(m,3H)3.11(s,6H)2.82(td,J=8.54,2.31Hz,1H)2.47-2.63(m,3H)2.28(br d,J=1.63Hz,3H)0.82-1.00(m,13H).

[0355] Phosphoramidite compound 1:

[0356]

[0357] Under 0-5 ℃ of N2 atmosphere, to a solution of compound B (500 mg, 1.11 mmol, 1.0 equivalent) in DCM (5.0 mL) was added compound D (607 mg, 3.34 mmol, 3.0 equivalent) and DIEA (432 mg, 3.34 mmol, 582 μL, 3.0 equivalent), and the mixture was stirred at 25 ℃ for 1.0 hour. LC-MS showed complete consumption of compound B, several new peaks were shown on LC-MS, and about 70.9% of the desired compound was detected. The resulting reaction mixture was cooled to -20 ℃ and poured into a cold (0-5 ℃) saturated NaHCO3 (5.0 mL) solution, extracted with DCM (5.0 mL*2), and the combined organic layers were washed with cold (0-5 ℃) saturated NaHCO3 / brine = 1: 1 (5.0 mL / 5.0 mL). It was dried over Na2SO4 and concentrated in vacuo to obtain a residue (about 5 mL). The residue was purified by column chromatography (basic Al2O3, petroleum ether / ethyl acetate = 10 / 1 to 5 / 1, 0.1% Et3N ) Purification afforded compound 1 as a white solid (280 mg, 471 μmol, yield 42.3%).

[0358] 1 H NMR: EC10615-49-P1N (400MHz, DMSO-d6) δppm 7.44 (br d, J=7.63Hz, 2H), 7.31 (br t,J=7.94Hz,6H),7.18-7.26(m,1H),6.89(brd,J=8.00Hz,4H),4.08-4.13(m,1H),3.95-4 .03(m,1H),3.84-3.93(m,1H),3.77-3.83(m,1H),3.74(s,6H),3.43-3.53(m,3H),3.38(br d,J=6.75Hz,1H),2.94-3.04(m,1H),2.70-2.85(m,1H),1.09-1.15(m,12H),1.07(br s,3H).

[0359] Other phosphoramidites can be prepared according to the procedures described herein and / or prior art, such as, but not limited to, US 426,220 and WO 02 / 36743.

[0360] Example 4. Preparation of a solid support comprising the phosphoramidite monomer of the present invention

[0361] Represents the macroporous amine methyl polyethylene resin support portion.

[0362] Place a 50L glass kettle under nitrogen protection, add dichloromethane (19.50kg) to the glass kettle, and start stirring. Control the temperature at 20-30°C, add DMTr-imann (1.47kg) to the glass kettle, add triethylamine (1.50kg), 4-dimethylaminopyridine (0.164kg), and add succinic anhydride (1.34kg) to the reactor. Keep the system warm at 20-30°C for 18 hours, then take a sample and terminate the reaction. Add saturated sodium bicarbonate solution (22.50kg) to the reaction system, stir for 10-20 minutes, and then let it stand until it separates. Transfer the lower organic phase to, extract the upper aqueous phase twice with dichloromethane, combine the organic phases, dry with anhydrous sodium sulfate, filter the filtrate, and then transfer to rotary evaporation to concentrate until there is no fraction, forming 1.83kg of solid gray to off-white solid.

[0363] Add N,N-dimethylformamide (23.50 kg) to a 100 L glass kettle and start stirring. Control the temperature at 20-30°C. Under nitrogen protection, add the product from the previous step, O-benzotriazole-tetramethyluronium hexafluorophosphate (0.33 kg), and N,N-diisopropylethylamine (0.13 kg) to the 100 L glass kettle via a solid addition funnel. After stirring for 10-30 minutes, pour the mixture into a 50 L galvanized bucket for later use. Add macroporous amine methyl resin (3.25 kg) (purchased from Tianjin Nankai Hecheng Technology Co., Ltd., batch number HA2X1209, loading 0.48 mmol / g) to the 100 L solid phase synthesis reactor via a solid addition funnel. Control the temperature at 20-30°C. Add N,N-dimethylformamide (21.00 kg + 21.00 kg) and the reaction solution from the previous galvanized bucket for later use. The system was kept warm and monitored until the solid loading reached ≥250 μmol / g. UV loading was used for detection. The system was filtered under nitrogen pressure, and the filter cake was rinsed three times with N,N-dimethylformamide (26.00 kg + 26.10 kg + 26.00 kg), leaving the filter cake in the reactor. CAP.A (50% acetonitrile and 50% acetic acid, 4.40 kg + 4.42 kg + 4.30 kg) and CAP.B (20% pyridine and 30% N-methylimidazole and 50% acetonitrile, 4.40 kg + 4.40 kg + 4.47 kg) were added to an 80-L glass reactor. Stir for 3-8 minutes and set aside. This operation was repeated three times to cap the reactor. Acetonitrile (18.00 kg + 18.00 kg + 18.00 kg + 17.50 kg + 17.50 kg) was added to the solid-phase synthesis reactor and nitrogen was bubbled through for 10-30 minutes before filter pressure filtration. Repeat this operation four times, and transfer the filter cake to a 50L filter press after nitrogen purge in the solid phase synthesis reactor for 2 to 4 hours, control the temperature at 15 to 30°C, and continue drying to obtain a yellow to white solid product with a weight of 3.516 kg.

[0364] Example 5. Synthesis of HSD17B13 RNAi Agent.

[0365] The HSD17B13 RNAi reagent duplexes shown in Tables 2-3 above were synthesized according to the following general procedure:

[0366] The sense and antisense strands of siRNA were synthesized on an oligonucleotide synthesizer using a well-established solid-phase synthesis method based on phosphoramidite chemistry. Oligonucleotide chain growth was achieved through a four-step cycle: deprotection, condensation, capping, and oxidation or sulfurization steps for each nucleotide addition. The synthesis was performed on a controlled pore glass (CPG, 1000 ) is carried out on a solid support made of. Monomeric phosphoramidites can be purchased from commercial sources or can be the phosphoramidite compounds described in Example 3 and WO2016 / 028649. The phosphoramidite compounds herein can be attached to the 3'-end as monomeric phosphoramidites and further attached to a CPG solid support. In the case of 5'-end attachment, the phosphoramidite compound can be used for the final coupling reaction and can be further conjugated to the target ligand if desired.

[0367] Phosphoramidites with GalNAc ligand clusters (GLPA1, GLPA2, and GLPA15 as non-limiting examples) were synthesized according to the procedures of Examples 1-2 herein. Synthesis was performed on a 2 μmol scale for siRNAs used for in vitro screening (Table 2), and on a 5 μmol or larger scale for siRNAs used for in vivo testing (Table 3). In the case where the GalNAc ligand (GLO-0 as a non-limiting example) was attached to the 3' end of the sense strand, a CPG solid support to which the GalNAc ligand was attached was used. When the GalNAc ligand (GLS-5 or GLS-15 as non-limiting examples) was attached to the 5' end of the sense strand, a GalNAc phosphoramidite (GLPA1, GLPA2, or GLPA15 as non-limiting examples) was used for the final coupling reaction.

[0368] The sense and antisense strands were synthesized via a four-step cyclic solid-phase synthesis method. The detailed steps are as follows: 3% trichloroacetic acid (TCA) in dichloromethane or 10% dichloroacetic acid (DCA) in toluene was used for deprotection of the 4,4'-dimethoxytrityl protecting group (DMT). 5-Ethylthio-1H-tetrazole was used as an activating agent in the coupling step. Capping was performed using Capping Agent A (acetic anhydride in acetonitrile) / Capping Agent B (pyridine / NMI / acetonitrile) (v / v, 1:1). I2 in Py / H2O and phenylacetyl disulfide (PADS) in pyridine / MeCN or dithiothreitol hydride (DDTT) in pyridine were used for oxidation and sulfidation, respectively.

[0369] After the final solid phase synthesis step, the solid support-bound oligomer is cut and the protecting group is removed by treating with a 40wt.% methylamine aqueous solution and 28% ammonium hydroxide solution with a 1:1 volume. The solid support-bound oligomer containing a phosphonate mimetic is treated with MeCN:TMSI:pyridine=50:2:2 (v / v / v) before cutting and protecting if necessary. In order to synthesize siRNA for in vitro screening, the crude mixture is concentrated. The remaining solid is dissolved in 1.0M NaOAc, and ice-cold EtOH is added to precipitate a single-stranded product as a sodium salt, which can be used for annealing without further purification. In order to synthesize siRNA for in vivo testing, the crude single-stranded product is further purified by ion pair reversed phase HPLC (IP-RP-HPLC). The purified single-stranded oligonucleotide product from IP-RP-HPLC is converted into a sodium salt by being dissolved in 1.0M NaOAc and precipitated by adding ice-cold EtOH. Annealing of equimolar complementary sense and antisense oligonucleotides was performed in water to form a double-stranded siRNA product, which was lyophilized to yield a fluffy white solid.

[0370] Example 6. In vitro screening of HSD17B13 siRNA duplexes

[0371] Huh7 cells were trypsinized and adjusted to the appropriate density before being seeded into 96-well plates. Simultaneously with seeding, cells were transfected with test or control siRNA using Lipofectamine RNAiMax (Invitrogen-13778-150) according to the manufacturer's recommendations. siRNAs were tested in triplicate at various concentrations (5 nM, 1 nM, 0.05 nM, and 0.005 nM).

[0372] Day 0, psiCHECK(TM)-2 vector transfection (one plate)

[0373] (1) Transfer 2.5 μg of psiCHECK(TM)-2 vector plasmid to an RNASE-free Eppendorf tube (solution mixture #1)

[0374] (2) Add trypsin to one flask to dissociate Huh7 cells, count the cells using a Vi-Cell counter, and adjust the cell density to 1*10^5 / ml.

[0375] (3) Transfer 7.5 μL of Fugene-HD to the solution mix #1 tube and mix thoroughly.

[0376] (4) Add the solution in step 3 to the cell suspension, mix well, and dispense the suspension into 96-well plates (100 μl / well).

[0377] Day 1, siRNA transfection

[0378] (1) Using Opti-MEM Dilute Lipofectamine in culture medium RNAiMAX reagent.

[0379] (2) Dilute siRNA with RNA-free water to make a 12× stock solution.

[0380] (3) Mix equal volumes of diluted RNAiMax and siRNA. Incubate the mixture at room temperature for 15 minutes to allow complex formation.

[0381] (4) Add 45 μl / well of Lipofectamine The RNAiMAX (Opti-MEM) mixture was added to 225 μl / well of fresh DMEM medium, the supernatant in the assay plate was discarded, and 120 μl / well of the compound mixture was added to a 96-well plate.

[0382] (5) The no-compound control wells were defined as cells transfected with psiCHECK™-2 vector and not treated with siRNA; the blank control wells were cells alone.

[0383] Day 2, Dual-Glo Luciferase assay

[0384] (1) Add the reagents to the assay plate and wait 10 minutes for cell lysis to occur.

[0385] (2) Transfer 100 μl of cell lysate to a plate and measure firefly luminescence.

[0386] (3) 50 μl Dual-Glo Stop&Glo Reagent was added to the assay plate and mixed, and Renilla luminescence was measured after waiting 10 minutes.

[0387] (4) Calculate relative expressions

[0388] Data Analysis

[0389] Sample well ratio = (Renilla luminescence sample - background blank) / ((fluorescence luminescence sample - background blank)

[0390] Ratio of no compound control wells = (control Renilla luminescence - background blank) / (control fluorescence luminescence - background blank)

[0391] % inhibition rate = 100-(ratio of sample wells / average ratio of no compound control) x 100%

[0392] Table 4 provides experimental results of in vitro studies using various HSD17B13 RNAi agents to inhibit HSD17B13 expression. The duplex sequences used correspond to those shown in Table 2.

[0393]

[0394]

[0395]

[0396] Table 5 provides experimental results of in vitro studies using various HSD17B13 RNAi drugs to inhibit HSD17B13 expression. The duplexes used correspond to the sequences shown in Table 2.

[0397]

[0398] Table 6 provides experimental results of in vitro studies using various HSD17B13 RNAi drugs to inhibit HSD17B13 expression. The duplexes used correspond to the sequences shown in Table 2.

[0399]

[0400]

[0401] Table 7 provides experimental results of in vitro studies using various HSD17B13 RNAi drugs to inhibit HSD17B13 expression. The duplexes used correspond to the sequences shown in Table 2.

[0402]

[0403]

[0404] Table 8 provides experimental results of in vitro studies using various HSD17B13 RNAi drugs to inhibit HSD17B13 expression. The duplexes used correspond to the sequences shown in Table 2.

[0405]

[0406] Table 9 provides experimental results of in vitro studies using various HSD17B13 RNAi drugs to inhibit HSD17B13 expression. The duplexes used correspond to the sequences shown in Table 2.

[0407]

[0408] Example 7. In vivo testing of HSD17B13 siRNA duplexes

[0409] On day 1, female C57BL / 6J mice (4 per group) were infected by intravenous injection of an adeno-associated virus 8 (AAV8) vector solution encoding human HSD17B13 and luciferase genes. On day 8, mice were subcutaneously administered a single 4 mg / kg dose of HSD17B13 siRNA or PBS. Blood samples were collected on day 8, before siRNA administration, on day 15, and finally on day 22. Serum samples were separated and the luciferase activity of the serum samples was measured according to the manufacturer's recommended protocol. Since the expression level of human HSD17B13 is related to the expression level of luciferase, the percentage of remaining HSD17B13 was calculated by comparing the luciferase activity in the siRNA-treated group samples before and after treatment, and normalized by the change in luciferase activity in the control group samples during the same time period.

[0410] Table 10 provides experimental results of in vivo studies using various HSD17B13 RNAi agents to inhibit HSD17B13 expression. The duplex sequences used correspond to those shown in Table 3.

[0411]

[0412]

[0413] Table 11 provides experimental results of in vivo studies using various HSD17B13 RNAi agents to inhibit HSD17B13 expression. The duplex sequences used correspond to those shown in Table 3.

[0414]

[0415] Table 12 provides experimental results of in vivo studies using various HSD17B13 RNAi agents to inhibit HSD17B13 expression. The duplex sequences used correspond to those shown in Table 3.

[0416]

[0417]

[0418] Table 13 provides experimental results of in vivo studies using various HSD17B13 RNAi drugs to inhibit HSD17B13 expression. The duplex sequences used correspond to those shown in Table 3.

[0419]

[0420] Table 14 provides experimental results of in vivo studies using various HSD17B13 RNAi drugs to inhibit HSD17B13 expression. The duplex sequences used correspond to those shown in Table 3.

[0421]

[0422] Equivalent plan

[0423] Although several embodiments of the present invention have been described and illustrated herein, a person of ordinary skill in the art will readily appreciate a variety of other ways and / or structures for performing the functions described herein and / or obtaining the results and / or one or more advantages described herein, and each such variation and / or modification is considered to be within the scope of the present invention. More generally, it will be readily understood by those skilled in the art that all parameters, dimensions, materials, and configurations described herein are intended to be exemplary, and that actual parameters, dimensions, materials, and / or configurations will depend on one or more specific applications in which the teachings of the present invention are used. Those skilled in the art will recognize or be able to determine many equivalents to the specific embodiments of the present invention described herein using only routine experimentation. Therefore, it should be understood that the foregoing embodiments are presented by way of example only, and within the scope of the appended claims and their equivalents, the present invention may be implemented in a manner other than that specifically described and claimed. The present invention relates to each individual feature, system, article, material, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, and / or methods is included within the scope of the present invention if such features, systems, articles, materials, and / or methods are not inconsistent with each other.

[0424] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0425] Unless explicitly stated to the contrary, as used herein in the specification and claims, nouns without quantifiers should be understood to mean "at least one".

[0426] The term "or" is used herein to mean "and / or" and is used interchangeably with the latter, unless expressly excluded from the context. As used herein in the specification and claims, the phrase "and / or" should be understood to mean "one or both" of the elements so connected, i.e., the elements are present in conjunction in some cases and separately in other cases. If there are two or more elements and they are separated by commas, the comma before "and / or" has the same meaning as "and" or "or", indicating "and" or "or" respectively. Unless expressly stated to the contrary, other elements may optionally be present in addition to the elements explicitly identified by the "and / or" phrase, whether related or unrelated to these explicitly identified elements.

[0427] All references, patents and patent applications, and publications cited or referenced in this application are hereby incorporated by reference in their entirety.

Claims

1. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13), wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 2 by no more than 3 nucleotides.

2. The dsRNA agent of claim 1 , wherein the sense strand comprises at least 15 consecutive nucleotides that differ from any one of the nucleotide sequences of SEQ ID NO: 1 by 0, 1, 2, or 3 nucleotides.

3. The dsRNA agent of claim 1 , wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region of at least 15, 16, or 17 nucleotides in length, wherein the sense strand comprises at least 15, 16, 17, 18, 19, or 20 consecutive nucleotides that differ from any one of the 45-65, 46-66, 47-67, 48-68, 49-69, 50-70, 51-71, 52-72, 53-73, 54-74, 55-75, 56-76, 57-77, 58-78, 59-79, 60-80, 61-81, 62-82, 63-83, 64-84, or 65-85 nucleotide sequences in SEQ ID NO: 1 by 0, 1, 2, or 3 nucleotides, and the antisense strand comprises at least 15, 16, 17, 18, 19, or 20 consecutive nucleotides that differ from any one of the 45-65, 46-66, 47-67, 48-68, 49-69, 50-70, The corresponding nucleotide sequences of NO: 2 differ by 0, 1, 2 or 3 nucleotides over at least 15 contiguous nucleotides.

4. The dsRNA agent of claim 1 , wherein the antisense strand of the dsRNA comprises the nucleotide sequence SI: 5′-z1AGAAGCAGAAGGAUUUz2-3′, wherein z1 and z2 each independently represent a nucleotide sequence of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length, wherein the nucleotide sequence SI is substantially or completely complementary to a portion of an HSD17B13 mRNA transcript.

5. The dsRNA agent of claim 4, wherein the dsRNA further comprises a sense strand comprising the nucleotide sequence SII: 5'-z3AAAUCCUUCUGCUUCUz4-3', wherein z3 and z4 each independently represent a nucleotide sequence of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length, wherein the nucleotide sequence S1 is substantially or completely complementary to the nucleotide sequence SII.

6. The dsRNA agent of claim 1 , wherein the antisense strand of the dsRNA comprises the nucleotide sequence SIII: 5′-z5GUGAUCAGAAGCAGAAz6-3′, wherein z5 and z6 each independently represent a nucleotide sequence of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length, wherein the nucleotide sequence SIII is substantially or completely complementary to a portion of an HSD17B13 mRNA transcript.

7. The dsRNA agent of claim 6, wherein the dsRNA further comprises a sense strand comprising the nucleotide sequence SIV: 5'-z7UUCUGCUUCUGAUCACz8-3', wherein z7 and z8 each independently represent a nucleotide sequence of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length, wherein the nucleotide sequence SIII is substantially or completely complementary to the nucleotide sequence SIV.

8. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13), wherein the dsRNA agent comprises a sense strand and an antisense strand, nucleotide positions 2 to 18 in the antisense strand comprising a region complementary to an HSD17B13 RNA transcript, wherein the complementary region comprises at least 15 consecutive nucleotides that differ from one of the antisense sequences listed in one of Tables 1-3 by 0, 1, 2 or 3 nucleotides, and optionally comprises a targeting ligand.

9. The dsRNA agent of claim 8, wherein the region complementary to the HSD17B13 RNA transcript comprises at least 15, 16, 17, 18 or 19 consecutive nucleotides that differ by no more than 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3.

10. The dsRNA agent according to any one of claims 1 to 9, wherein the antisense strand of the dsRNA is at least substantially complementary or fully complementary to any one of the target regions of SEQ ID NO: 1, and preferably the dsRNA agent comprises an antisense strand sequence listed in any one of Tables 1 to 3.

11. The dsRNA agent of any one of claims 1-10, wherein the sense strand sequence is at least substantially complementary or fully complementary to the antisense strand sequence in the dsRNA agent, preferably, wherein the dsRNA agent comprises a sense strand sequence listed in any one of Tables 1-3.

12. The dsRNA agent of claim 1, wherein the dsRNA agent comprises a sequence listed as a duplex sequence in any one of Tables 1-3.

13. The dsRNA of any one of claims 1-12, wherein the dsRNA agent comprises at least one modified nucleotide.

14. The dsRNA agent of any one of claims 1-13, wherein all or substantially all nucleotides of the sense strand and / or antisense strand are modified nucleotides.

15. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13), wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to a portion of an mRNA encoding HSD17B13, wherein each strand is about 14 to about 30 nucleotides in length, wherein the sense strand sequence can be represented by formula (I): 5′-(N′ L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ L N′ F N′ L N′ N4 N′ N5 N′ N6 N′ L N′ L N′ L (N′ L ) m′ -3′ (I) in: Each N′ F represents 2'-fluorine-modified nucleotides; Each N′ N1 ,N′ N2 ,N′ N3 ,N′ N4 ,N′ N5 , and N′ N6 independently represent modified or unmodified nucleotides; N′ N1 N′ N2 N′ N3 and N′ N4 N′ N5 N′ N6 Each independently represents a motif comprising at least two differently modified nucleotides; Each N′ L independently represents modified or unmodified nucleotides, but does not represent 2'-fluoro-modified nucleotides; m' and n' are each independently an integer from 0 to 7.

16. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13), wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to a portion of an mRNA encoding HSD17B13, wherein each strand is about 14 to about 30 nucleotides in length, wherein the antisense strand sequence can be represented by formula (II): 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5′(II) in: Each N F represents 2'-fluorine-modified nucleotides; Each N M1 ,N M2 ,N M3 ,N M4 ,N M5 ,N M6 ,N M7 and N M8 independently represents a modified or unmodified nucleotide, preferably, N M2 ,N M3 and N M6 Each independently represents a 2'-fluoro-modified nucleotide; Each N L independently represents modified or unmodified nucleotides, but does not represent 2'-fluoro-modified nucleotides; n is an integer from 0 to 7.

17. The dsRNA agent according to claim 16, wherein the antisense strand sequence can also be represented by formula (II'): 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N Z -5′(II') in: N Z is a vinylphosphonate modified nucleotide, preferably, N Z V Pu *, its structure is:

18. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13), wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to an mRNA encoding HSD17B13, wherein the complementary region comprises at least 15 consecutive nucleotides, wherein the dsRNA duplex is represented by formula (III): Sense strand: 5′-(N′ L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ L N′ F N′ L N′ N4 N′ N5 N′ N6 N′ L N′ L N′ L (N′ L ) m′ -3′ Antisense strand: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L ​ (III) in: Each strand is about 17 to about 30 nucleotides in length; Each N F and N′ F independently represent 2'-fluoro-modified nucleotides; N M1 ,N M2 ,N M3 ,N M4 ,N M5 ,N M6 ,N M7 ,N M8 ,N′ N1 ,N′ N2 ,N′ N3 ,N′ N4 ,N′ N5 , and N′ N6 Each independently represents a modified or unmodified nucleotide; Each N L and N′ L independently represents a modified or unmodified nucleotide, but not a 2'-fluoro-modified nucleotide; And m', n' and n are each independently an integer from 0 to 7.

19. The dsRNA agent according to claim 18, wherein the dsRNA duplex can also be represented by formula (III'): Sense strand: 5′-(N′ L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ L N′ F N′ L N′ N4 N′ N5 N′ N6 N′ L N′ L N′ L (N′ L ) m′ -3′ Antisense strand: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N Z -5′ (III') in, N Z is a vinylphosphonate modified nucleotide, preferably, N Z V Pu *, its structure is:

20. The dsRNA agent of any one of claims 1-19, wherein the one or more modified nucleotides are independently selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2'3'-seco nucleotide mimics, locked nucleotides, unlocked nucleic acid nucleotides (UNA), diol nucleic acid nucleotides (GNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides, isomannose nucleotides, inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, and 3'-OMe nucleotides, nucleotides comprising a 5'-phosphorothioate group, a 5'-phosphate modified nucleotide, or a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a 2'-amino modified nucleotide, a phosphoramidate, or a nucleotide comprising an unnatural base.

21. The dsRNA agent of any one of claims 1-20, wherein the antisense strand comprises an E-vinylphosphonate nucleotide at the 5' end.

22. The dsRNA agent of any one of claims 1-21, wherein the dsRNA agent comprises at least one phosphorothioate internucleoside linkage.

23. The dsRNA agent of any one of claims 1-22, wherein the sense strand comprises at least one phosphorothioate internucleoside linkage, preferably, at least one phosphorothioate (PS) linkage is introduced at the 5' end, the 3' end, or both ends of the sense strand.

24. The dsRNA agent of any one of claims 1-22, wherein the antisense strand comprises at least one phosphorothioate internucleoside linkage, preferably, at least one phosphorothioate (PS) linkage is introduced at the 5' end, the 3' end, or both ends of the antisense strand.

25. The dsRNA agent of any one of claims 1-22, wherein the sense strand comprises 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages, preferably, 1, 2, 3, 4, 5, or 6 phosphorothioate (PS) linkages are introduced at the 5' end, the 3' end, or both ends of the sense strand.

26. The dsRNA agent of any one of claims 1-22, wherein the antisense strand comprises 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages, preferably, 1, 2, 3, 4, 5, or 6 phosphorothioate (PS) linkages are introduced at the 5' end, the 3' end, or both ends of the antisense strand.

27. The dsRNA agent according to any one of claims 1 to 26, wherein the modified sense strand is modified according to the pattern shown in formula (I) of claim 15.

28. The dsRNA agent according to any one of claims 1 to 26, wherein the modified antisense strand is modified according to the pattern shown in formula (II) of claim 16 or formula (II') of claim 17.

29. The dsRNA agent of any one of claims 1-26, wherein the modified sense strand is a modified sense strand sequence listed in one of Tables 2-3.

30. The dsRNA agent of any one of claims 1-26, wherein the modified antisense strand is a modified antisense strand sequence listed in one of Tables 2-3.

31. The dsRNA agent of any one of claims 1-30, wherein the sense strand is complementary or substantially complementary to the antisense strand, and the region of complementarity is between 16 and 23 nucleotides in length.

32. The dsRNA agent of any one of claims 1-30, wherein the region of complementarity is 19-21 nucleotides in length.

33. The dsRNA agent of any one of claims 1-32, wherein each strand is no more than 30 nucleotides in length.

34. The dsRNA agent of any one of claims 1-32, wherein each strand is no more than 25 nucleotides in length.

35. The dsRNA agent of any one of claims 1-32, wherein each strand is no more than 23 nucleotides in length.

36. The dsRNA agent of any one of claims 1-35, wherein the dsRNA agent comprises at least one modified nucleotide and further comprises one or more targeting groups or linking groups.

37. The dsRNA agent of claim 36, wherein the one or more targeting groups or linking groups are conjugated to the sense strand.

38. The dsRNA agent of claim 36 or 37, wherein the targeting group or linker group comprises N-acetyl-galactosamine (GalNAc).

39. The dsRNA agent of claim 37 or 38, wherein the targeting group has the structure:

40. The dsRNA agent of any one of claims 1-39, wherein the dsRNA agent comprises a targeting group conjugated to the 5'-end of the sense strand.

41. The dsRNA agent of any one of claims 1-39, wherein the dsRNA agent comprises a targeting group conjugated to the 3'-end of the sense strand.

42. The dsRNA agent of any one of claims 1-39, wherein the antisense strand comprises an inverted abasic residue at the 3'-end.

43. The dsRNA agent of any one of claims 1-39, wherein the sense strand comprises one or two inverted abasic residues or imann residues at the 3' or / and 5' termini.

44. The dsRNA agent of any one of claims 1-43, wherein the dsRNA agent has two blunt ends.

45. The dsRNA agent of any one of claims 1-43, wherein at least one strand comprises a 3' overhang of at least 1 nucleotide.

46. The dsRNA agent of any one of claims 1-43, wherein at least one strand comprises a 3' overhang of at least 2 nucleotides.

47. A composition comprising the dsRNA agent of any one of claims 1-46.

48. The composition of claim 47, further comprising a pharmaceutically acceptable carrier.

49. The composition of claim 48, further comprising one or more additional therapeutic agents.

50. The composition of claim 49, wherein the composition is packaged in a kit, container, wrapper, dispenser, prefilled syringe, or vial.

51. The composition of any one of claims 47-50, wherein the composition is formulated for subcutaneous administration or is formulated for intravenous (IV) administration.

52. A cell comprising the dsRNA agent of any one of claims 1-46, optionally wherein the cell is a mammalian cell, optionally a human cell.

53. A method for inhibiting HSD17B13 gene expression in a cell, the method comprising: (i) preparing a cell comprising an effective amount of the double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1 to 46 or the composition of any one of claims 37 to 51.

54. The method of claim 53, further comprising: (ii) maintaining the cell prepared according to claim 53(i) for a period of time sufficient to achieve degradation of the mRNA transcript of the HSD17B13 gene, thereby inhibiting the expression of the HSD17B13 gene in the cell.

55. The method of claim 53, wherein the cells are located in a subject and the dsRNA agent is administered subcutaneously to the subject.

56. The method of claim 53, wherein the cell is located in a subject and the dsRNA agent is administered to the subject by IV administration.

57. The method of claim 55 or 56, further comprising assessing inhibition of the HSD17B13 gene after administering the dsRNA agent to the subject, wherein the means for assessing comprises: (i) determining one or more physiological characteristics of an HSD17B13-associated disease or condition in the subject, and (ii) comparing the determined physiological characteristic to a pre-treatment baseline physiological characteristic of the HSD17B13-associated disease or disorder and / or a control physiological characteristic of the HSD17B13-associated disease or disorder, wherein the comparison indicates one or more of the presence or absence of inhibition of HSD17B13 gene expression in the subject.

58. The method of claim 57, wherein the physiological characteristic determined is one or more of: HSD17B13 mRNA level, HSD17B13 protein level, or HSD17B13 enzyme activity in the subject, or lipid level, triglyceride level, cholesterol level, or free fatty acid level in plasma or a tissue sample, or fat level and / or lipid droplet level in the liver.

59. The method of claim 58, wherein a decrease in one or more of HSD17B13 mRNA levels, HSD17B13 protein levels, or HSD17B13 enzymatic activity in the subject, and / or a decrease in one or more of lipids, triglycerides, cholesterol (including LDL-C, HDL-C, VLDL-C, IDL-C, and total cholesterol), or free fatty acids in a plasma or tissue sample, and / or a decrease in fat accumulation and / or expansion of lipid droplets in the liver indicates a decrease in HSD17B13 gene expression in the subject.

60. A method of inhibiting HSD17B13 gene expression in a subject, the method comprising administering to the subject an effective amount of the double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-46 or the composition of any one of claims 47-51.

61. The method of claim 60, wherein the dsRNA agent is administered subcutaneously to the subject.

62. The method of claim 60, wherein the dsRNA agent is administered to the subject by IV.

63. The method of any one of claims 60-62, further comprising assessing inhibition of the HSD17B13 gene after administration of the dsRNA agent, wherein the means for assessing comprises: (i) determining one or more physiological characteristics of an HSD17B13-associated disease or condition in the subject, and (ii) comparing the determined physiological characteristic to a pre-treatment baseline physiological characteristic for the HSD17B13-related disease or disorder and / or to a physiological characteristic control for the HSD17B13-related disease or disorder, wherein the comparison indicates one or more of the presence or absence of inhibition of HSD17B13 gene expression in the subject.

64. The method of claim 63, wherein the physiological characteristic determined is one or more of: HSD17B13 mRNA level, HSD17B13 protein level, or HSD17B13 enzyme activity in the subject, or lipid level, triglyceride level, cholesterol level, or free fatty acid level in plasma or a tissue sample, or fat level and / or lipid droplet level in the liver.

65. The method of claim 54, wherein a decrease in one or more of HSD17B13 mRNA levels, HSD17B13 protein levels, or HSD17B13 enzymatic activity in the subject, and / or a decrease in lipids, triglycerides, cholesterol (including LDL-C, HDL-C, VLDL-C, IDL-C, and total cholesterol), or free fatty acids in plasma or a tissue sample, and / or a decrease in fat accumulation and / or expansion of lipid droplets in the liver indicates a decrease in HSD17B13 gene expression in the subject.

66. A method of treating a disease or condition associated with the presence of HSD17B13 protein, the method comprising administering to a subject an effective amount of the double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-46, or the composition of any one of claims 47-51, for inhibiting HSD17B13 gene expression.

67. The method of claim 66, wherein the disease or condition is one or more of: hepatitis, liver fibrosis, nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), HCV-related cirrhosis, drug-induced liver injury, hepatocellular necrosis, and HSD17B13-related obesity.

68. The method of claim 66, further comprising administering an additional therapeutic regimen to the subject.

69. The method of claim 68, wherein the additional treatment regimen comprises: One or more HSD17B13 antisense polynucleotides of the present invention are administered to the subject, a non-HSD17B13 dsRNA agent is administered to the subject, and the behavior of the subject is altered.

70. The method of claim 69, wherein the non-HSD17B13 dsRNA agent is one or more of the following: pyridoxine, an ACE inhibitor (angiotensin converting enzyme inhibitor), such as benazepril (Lotensin); an angiotensin II receptor antagonist (ARB) (such as losartan potassium, such as Merck & Co. Such as candesartan (Atacand); HMG-CoA reductase inhibitors (such as statins); calcium binders, such as sodium cellulose phosphate (Calcibind); diuretics, such as thiazide diuretics, such as hydrochlorothiazide (Microzide); insulin sensitizers such as the PPARγ agonist pioglitazone, GLP-1R agonists such as liraglutide, vitamin E, SGLT2 inhibitors, DPPIV inhibitors, and kidney / liver transplantation; or a combination of any of the foregoing.

71. The method of any one of claims 66-70, wherein the dsRNA agent is administered subcutaneously to the subject.

72. The method of any one of claims 66-70, wherein the dsRNA agent is administered to the subject by IV.

73. The method of any one of claims 66-70, further comprising determining the efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject.

74. The method of claim 73, wherein determining the efficacy of the treatment in the subject comprises: (i) determining one or more physiological characteristics of an HSD17B13-associated disease or condition in the subject, and (ii) comparing the determined physiological characteristics to the baseline physiological characteristics before treatment of the HSD17B13-related disease or condition wherein the comparison indicates one or more of the presence, absence, and level of efficacy of the double-stranded ribonucleic acid (dsRNA) agent administered to the subject.

75. The method of claim 74, wherein the determined physiological characteristic is: HSD17B13 mRNA level, HSD17B13 protein level, or HSD17B13 enzyme activity in the subject, or lipid level, triglyceride level, cholesterol level, free fatty acid level in plasma or tissue sample, or fat level and / or lipid droplet level in the liver.

76. The method of claim 75, wherein a decrease in one or more of HSD17B13 mRNA levels, HSD17B13 protein levels, or HSD17B13 enzymatic activity in the subject, and / or a decrease in one or more of lipids, triglycerides, cholesterol (including LDL-C, HDL-C, VLDL-C, IDL-C, and total cholesterol), or free fatty acids in plasma or a tissue sample, and / or a decrease in fat accumulation and / or expansion of lipid droplets in the liver indicates the presence of efficacy of administering a double-stranded ribonucleic acid (dsRNA) agent to the subject.

77. A method of reducing the level of HSD17B13 protein in a subject compared to a pre-treatment baseline level of HSD17B13 protein in the subject, the method comprising administering to the subject an effective amount of the double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-46 or the composition of any one of claims 47-51 to reduce the level of HSD17B13 gene expression.

78. The method of claim 77, wherein the dsRNA agent is administered to the subject subcutaneously or by IV.

79. A method of altering a physiological characteristic of an HSD17B13-related disease or condition in a subject compared to a pre-treatment baseline physiological characteristic of the HSD17B13-related disease or condition in the subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-46 or a composition of any one of claims 47-51 to alter a physiological characteristic of the HSD17B13-related disease or condition in the subject.

80. The method of claim 79, wherein the dsRNA agent is administered to the subject subcutaneously or by IV.

81. The method of claim 79, wherein the physiological characteristic is one or more of: HSD17B13 mRNA level, HSD17B13 protein level, or HSD17B13 enzyme activity in the subject, or lipid level, triglyceride level, cholesterol level, free fatty acid level in plasma or tissue sample, or fat level and / or lipid droplet level in the liver.

Citation Information

Patent Citations

  • Drug delivery product and methods

    US20050281781A1

  • Display device

    US2140804A

  • Drug-delivery system

    US3854480A

  • Seal-lock

    US426220A

  • Cholesterol matrix delivery system for sustained release of macromolecules

    US4452775A