SrRNA vaccine targeting multiple mutant p53 proteins, construction method and application

Abstract

The invention belongs to the technical field of nucleic acid vaccines, and particularly relates to an srRNA vaccine targeting multiple mutant p53 proteins, a construction method and application. The self-replicating srRNA vaccine comprises sialic acid modified lipid nanoparticles and srRNA, and the srRNA is encapsulated in the sialic acid modified lipid nanoparticles; the srRNA comprises a double-chain tandem micro-gene, and is obtained by carrying out PCR (Polymerase Chain Reaction) on a coding sequence which is formed by sequentially connecting a plurality of antigen extraction units containing p53 protein mutation sites in series and converting the antigen extraction units; the sialic acid modified lipid nanoparticles are prepared from the following raw materials: an ionizable lipid, distearoyl phosphatidylcholine, cholesterol, a sialic acid cholesterol derivative SA-AE-AC-CH and dimyristoyl glycerol-polyethylene glycol 2000. The problems that a traditional mRNA vaccine is short in duration time and inaccurate in targeting are solved.

Description

Technical Field

[0001] The present invention belongs to the technical field of nucleic acid vaccines, and specifically relates to an srRNA vaccine targeting multiple mutant p53 proteins, a construction method and an application thereof. Background Art

[0002] With the rapid growth and aging of the global population, cancer is becoming an increasingly prominent cause of death. Pancreatic cancer is a common gastrointestinal tumor. The most common and lethal type of pancreatic cancer is pancreatic ductal adenocarcinoma (PDAC), which has a very low five-year survival rate. A key characteristic of cancer is the presence of multiple genetic mutations. TP53 is one of the most commonly mutated genes across all cancer types. The vast majority of p53 mutations are missense mutations located within the protein's central 190 amino acids. These mutant proteins are often produced in high amounts in tumor cells, suggesting that mutant p53 proteins may serve as biomarkers of malignancy and therapeutic targets. Initial success has been reported in mouse tumor models using small molecule inhibitors and T cells targeting wild-type and mutant p53 tumors. Furthermore, evidence has shown that mutant TP53 can be recognized by peripheral blood T cells after in vitro stimulation and in vivo inoculation. Therefore, targeting mutant p53 proteins holds promise as a promising therapeutic target for pancreatic cancer.

[0003] Currently, developing cancer vaccines and harnessing the immune system to eliminate tumors has become a key approach to cancer prevention and treatment. However, while traditional vaccine technologies, such as inactivated and attenuated live pathogens and subunit vaccination, can provide long-lasting protection against life-threatening diseases, the current demands for low-cost, large-scale, and rapid development have become a major challenge for traditional vaccines. In recent years, the rapid development of mRNA vaccines has shown promise in addressing this issue. Unlike traditional vaccines, such as inactivated vaccines, mRNA vaccines aim to introduce the genetic information of an antigen into the body, rather than the antigen itself, to stimulate a subsequent immune response. This represents a revolutionary breakthrough in their mechanism of action. mRNA vaccines primarily consist of two components: mRNA encoding the antigen; and lipid nanoparticles (LNPs) that deliver the mRNA into target cells. While mRNA vaccines are safer than DNA vaccines and do not integrate into the genome, they also have a short half-life and are transiently expressed proteins. Furthermore, while traditional lipid nanoparticles can successfully deliver RNA into cells, they lack selectivity, which can affect T cell activation and further compromise the immunogenicity of RNA vaccines.

[0004] Therefore, it is necessary to construct a new mRNA vaccine targeting mutant p53 protein. Summary of the Invention

[0005] To solve the above problems, the present invention provides an srRNA vaccine targeting multiple mutant p53 proteins, a construction method and an application thereof.

[0006] The present invention is achieved through the following technical solutions:

[0007] A self-replicating srRNA vaccine targeting multiple mutant p53 proteins, wherein the self-replicating srRNA vaccine comprises sialic acid-modified lipid nanoparticles and srRNA, wherein the srRNA is encapsulated in the sialic acid-modified lipid nanoparticles;

[0008] The srRNA includes a double-stranded tandem minigene, which is obtained by PCR after converting a coding sequence of multiple antigen extraction units containing p53 protein mutation sites into a tandem sequence, wherein the multiple p53 protein mutation sites are R175H, R273H, H214R, R248Q, R273C, C238Y, G245S, R248W, Y163C, Y220C, G266E, R282W, G245D and R248L, and the antigen extraction unit containing the p53 protein mutation site refers to a polypeptide consisting of the p53 protein mutation site (the amino acid where it is located) and the 12 amino acids before and after it.

[0009] The sialic acid-modified lipid nanoparticles are prepared from the following raw materials: ionizable lipids, distearoylphosphatidylcholine, cholesterol, sialic acid cholesterol derivative SA-AE-AC-CH and dimyristoylglycerol-polyethylene glycol 2000, with a mass ratio of 5.8-6.1:1.1-1.4:2.4-2.7:0.6-0.8:0.5-0.7.

[0010] Preferably, the coding sequence of the srRNA is shown as SEQ ID NO.1.

[0011] Preferably, the srRNA further comprises an RNA replicase gene derived from Venezuelan equine encephalitis virus.

[0012] Preferably, the method specifically includes the following steps:

[0013] Synthesize srRNA.

[0014] Ionizable lipids, distearoylphosphatidylcholine, cholesterol, sialic acid cholesterol derivative SA-AE-AC-CH and dimyristoylglycerol-polyethylene glycol 2000 are dissolved in anhydrous ethanol to obtain an ethanol phase; srRNA is dissolved in a citric acid buffer solution to obtain an aqueous phase; the sialic acid-modified lipid nanoparticles contain ionizable lipids, distearoylphosphatidylcholine, cholesterol, sialic acid cholesterol derivative SA-AE-AC-CH and dimyristoylglycerol-polyethylene glycol 2000 and srRNA in a mass ratio of 5.8-6.1:1.1-1.4:2.4-2.7:0.6-0.8:0.5-0.7:180-210.

[0015] The ethanol phase and the aqueous phase are mixed, and srRNA is encapsulated into sialic acid-modified lipid nanoparticles through microfluidic technology to obtain a self-replicating srRNA vaccine; the volume ratio of the ethanol phase to the aqueous phase is 2.5-3.3:0.5-1.5.

[0016] Preferably, the specific steps of synthesizing srRNA are:

[0017] The double-stranded tandem minigenes encoding various mutant p53 protein antigens were integrated into the T7-VEE plasmid to obtain the plasmid T7-VEE-TMG.

[0018] The plasmid T7-VEE-TMG was linearized using restriction enzymes.

[0019] The linearized plasmid T7-VEE-TMG was used as a template to synthesize srRNA, and srRNA was synthesized by in vitro transcription.

[0020] Preferably, the operation process of in vitro transcription synthesis of srRNA is:

[0021] Using HyperScribe TM The Co-transcription mRNA Synthesis Kit Plus was used, and EZ Cap Reagent AG reagent was used for co-transcriptional capping to enhance srRNA stability and translation efficiency.

[0022] The use of the self-replicating srRNA vaccine in the preparation of a drug for treating pancreatic cancer.

[0023] Preferably, the vaccine achieves the treatment of pancreatic cancer by inducing the body to produce a specific immune response against the mutant p53 protein.

[0024] The self-replicating srRNA vaccine is used in the preparation of drugs for preventing or treating other P53 mutation-related cancers, including but not limited to lung cancer, breast cancer, colorectal cancer and ovarian cancer.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The present invention provides a self-replicating srRNA vaccine targeting multiple mutant p53 proteins, wherein the self-replicating srRNA vaccine comprises sialic acid-modified lipid nanoparticles and srRNA, and the srRNA is encapsulated in the sialic acid-modified lipid nanoparticles; the srRNA comprises a double-stranded tandem minigene, which is obtained by PCR after converting a coding sequence converted from a plurality of antigen extraction units containing p53 protein mutation sites in series, wherein the plurality of p53 protein mutation sites are R175H, R273H, H214R, R248Q, R273C, C238Y, G245S, R248W, Y163C, Y220C, G266E, R282W, G245D and R248L, the antigen extraction unit containing the p53 protein mutation site refers to a polypeptide consisting of the p53 protein mutation site and the 12 amino acids before and after it; the sialic acid-modified lipid nanoparticles are prepared from the following raw materials: ionizable lipids, distearoylphosphatidylcholine, cholesterol, sialic acid cholesterol derivative SA-AE-AC-CH and dimyristoylglycerol-polyethylene glycol 2000, and the mass ratio thereof is 5.8-6.1:1.1-1.4:2.4-2.7:0.6-0.8:0.5-0.7. (1) The present invention uses multiple public databases and exon sequencing data from our center to calculate the 14 most common TP53 hotspot mutations in pancreatic cancer. A polypeptide segment consisting of 12 amino acid residues before and after the p53 protein mutation point, totaling 25 amino acid residues, is used as an antigen extraction unit containing the mutation site. All antigen extraction units are concatenated and converted into coding sequences to synthesize srRNA. Therefore, the srRNA contained in the present invention can translate multiple P53 hotspot mutation peptide segments, accounting for about 1 / 3 of p53 mutant pancreatic cancer, and has a wide range of applications. (2) The srRNA in the present invention contains the replicase gene of the non-structural proteins 1-4 derived from the Venezuelan equine encephalitis virus, which has the ability to self-replicate in host cells. Compared with simple mRNA vaccines, it can produce sufficient antigens to induce corresponding anti-tumor immune responses. (3) The core part of the present invention is srRNA. Compared with DNA vaccines with DNA as the core, while expressing the target antigen in large quantities, there is no risk of integration into the host genome. (4) The present invention has a targeting molecule, sialic acid (SA), which is used to enhance the targeting of LNPs to dendritic cells, allowing as many vaccines as possible to be taken up by dendritic cells to exert the vaccine's effect, thereby reducing ineffective vaccine injections and enhancing the vaccine's immunogenicity. (5) The present invention mainly induces an anti-mutant P53 tumor immune response by promoting the production of mutant P53-specific T cells. Therefore, its scope of use is not limited to pancreatic cancer, but is applicable to other solid tumors that express the mutant P53 peptide segments contained in the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0028] Figure 1 This is a structural diagram of the TMG-mut TP53 srRNA of the present invention.

[0029] Figure 2 This is a diagram of the components and microfluidic synthesis of the TMG-mut TP53 srRNA SA-LNPs vaccine of the present invention.

[0030] Figure 3 is a transfection efficiency diagram of the present invention; Figure 3 A is a graph showing the transfection efficiency of the SA-LNPs portion of the TMG-mut TP53srRNA SA-LNPs vaccine on MoDCs compared with traditional LNPs as shown by flow cytometry; B is a statistical graph corresponding to the transfection efficiency graph shown by flow cytometry; C is a graph showing the transfection efficiency of the SA-LNPs portion of the TMG-mut TP53srRNA SA-LNPs vaccine on dendritic cells in the mouse spleen compared with traditional LNPs.

[0031] Figure 4 This is a graph of the present invention using bioluminescence imaging to analyze the expression levels of luciferase (LUC) in various organs of mice to evaluate the targeting effect of SA-LNPs compared with traditional LNPs; Figure 4 In the figure, A is a targeting effect diagram of bioluminescence imaging analysis of luciferase (LUC) detection; B is a statistical diagram corresponding to bioluminescence imaging analysis of luciferase (LUC) detection.

[0032] Figure 5 The present invention displays the half-life graph of srRNA vaccine and mRNA vaccine by flow cytometry; Figure 5 In the figure, A is a half-life graph displayed by flow cytometry; B is a corresponding statistical graph of the half-life displayed by flow cytometry.

[0033] Figure 6 To analyze the half-life of srRNA and mRNA vaccines in mice by using bioluminescence imaging; Figure 6 In the figure, A is a half-life graph of bioluminescence imaging analysis; B is a corresponding statistical graph of the half-life of bioluminescence imaging analysis.

[0034] Figure 7The pancreatic cancer P53 mutation database map referenced by the present invention; Figure 7 Figure A is the P53 mutation frequency map of pancreatic cancer from the Queensland Medical Genomics Centre (QCMG); Figure B is the P53 mutation frequency map of pancreatic cancer from The Cancer Genome Atlas (TCGA); Figure C is the P53 mutation frequency map of pancreatic cancer from the Clinical Proteomic Tumor Analysis Consortium (CPTAC); and Figure D is the P53 mutation frequency map of pancreatic cancer from the University of Texas Southwestern Medical Center (UTSW).

[0035] Figure 8 This is the middle picture of the M-TP53 antigen sequence in the TMG-mut TP53 srRNA SA-LNPs vaccine of the present invention. Figure 8 In the figure, Figure A is the amino acid sequence diagram of the M-TP53 antigen; Figure B is the CDS of the M-TP53 antigen.

[0036] Figure 9 : is the mass spectrum analysis diagram of the SA-AE-AC-CH component in the present invention; Figure 9 Figure A shows the mass spectrum of SA-AE-AC-CH and the mass spectrum fragments of each component; Figure B shows the mass spectrum of CH, SA, and SA-AE-AC-CH.

[0037] Figure 10 This is a characterization diagram of the TMG-mut TP53 srRNA SA-LNPs vaccine of the present invention. Figure 10 In the figure, Figure A is the polydispersity index (PDI) of the M-TP53 srRNA vaccine; Figure B is the image of the M-TP53 srRNA vaccine under a scanning electron microscope (SEM); Figure C is the ζ potential of the M-TP53 srRNA vaccine; Figure D shows the encapsulation efficiency of the M-TP53 srRNA vaccine; Figure E shows the concentration of srRNA in the M-TP53 srRNA vaccine. DETAILED DESCRIPTION

[0038] To facilitate understanding of the present invention, the present invention will be described more fully below, along with preferred embodiments of the present invention. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a more thorough and comprehensive understanding of the disclosure of the present invention.

[0039] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0040] The inventive concept of the present invention is as follows:

[0041] While mRNA vaccines are safer than DNA vaccines and do not integrate into the genome, mRNA has a short half-life and is a transient protein. Furthermore, while traditional lipid nanoparticles can successfully deliver RNA into cells, they are not selective, which can affect T cell activation and further compromise the immunogenicity of RNA vaccines. Therefore, it is necessary to construct a novel mRNA vaccine targeting mutant p53 proteins.

[0042] Based on this, the present invention provides a self-replicating srRNA vaccine targeting multiple mutant p53 proteins. The present invention uses multiple public databases and exon sequencing data from our center to calculate the 14 most common TP53 hotspot mutations in pancreatic cancer. A CDS that can express a 25-amino acid peptide containing the mutated amino acid was designed for each mutation site, and the 14 CDSs were connected to obtain double-stranded tandem mini-genes (TMG-mut TP53) by PCR. In order to be able to express TMG-mut TP53 more effectively, TMG was integrated into the T7-VEE plasmid, which contains the RNA replicase gene of the Venezuelan equine encephalitis (VEE) virus, to obtain the plasmid T7-VEE-TMG, and a self-replicating RNA (TMG-mut TP53 srRNA) was constructed by synthesizing srRNA through in vitro transcription, such as Figure 1 and Figure 8 As shown. The present invention integrates the RNA replicase gene derived from Venezuelan equine encephalitis (VEE) virus, namely non-structural protein 1-4 (NSP 1-4). By embedding the antigen sequence into the srRNA construct, the mRNA segment can be replicated using the host cell's mechanism. Once srRNA enters the host cell, it can amplify autonomously and significantly increase the expression of the antigen portion embedded therein. In order to ensure the effective expression of the mutant region, a subgenomic promoter is introduced upstream of the complementary coding sequence. In order to enhance the stability and translation efficiency of srRNA, the present invention utilizes EZ Cap TM Reagent AG performs co-transcriptional capping to promote the formation of the key Cap 1 structure - m7G(5')ppp(5')(2'OMeA)pG, which is crucial for improving translation initiation.TM The Poly(A)Tailing Kit performs enzymatic polyadenylation of srRNA to further enhance the priming process. In addition, to minimize the body's immune activation, Pseudo-UTP is used instead of traditional UTP to enhance srRNA stability and prolong its presence in cells. Figure 1 shown.

[0043] In order to effectively deliver chemically modified srRNA into target cells, the present invention uses a powerful microfluidic self-assembly method to encapsulate srRNA into sialic acid-modified lipid nanoparticles, such as Figure 2 As shown in Figure 2, sialic acid-modified lipid nanoparticles are composed of a mixture of ionizable lipids, DSPC, cholesterol, SA-AE-AC-CH, and DMG-PEG2000. These are called sialic acid (SA)-modified LNPs, or SA-LNPs for short. Sialic acid (SA) is grafted onto cholesterol to achieve the purpose of targeting dendritic cells (DCs).

[0044] The present invention uses human pancreatic cancer cell lines, pancreatic cancer patient tissues, and pancreatic cancer patient's own dendritic cells (DCs) and T lymphocytes as experimental subjects to verify the transfection efficiency and durability of TMG-mut TP53 srRNA SA-LNPs in cells and mice. The results show that it has a high transfection efficiency that lasts longer. The use of TMG-mut TP53 srRNA SA-LNPs to vaccinate cells and animals can make RNA expressed for a long time and can better target dendritic cells. It solves the problems of short duration and inaccurate targeting of traditional mRNA vaccines. It lays an important preliminary foundation for the subsequent relevant clinical trials. The successful construction of TMG-mut TP53srRNA may not only benefit pancreatic cancer patients, but also bring hope of treatment to patients with various types of cancer. TP53 is the most common mutated gene in all types of cancer. At the same time, the method of the present invention for screening and constructing TMG-mut TP53 srRNA SA-LNPs targeting multiple mutant p53 proteins can be used to target other high-value mutant tumor neoantigens present in a large number of patients with different types of cancer, such as KRAS, CDKN2A and EGFR.

[0045] The beneficial effects of the present invention are described below by means of specific embodiments:

[0046] The materials and instruments used in the present invention are as follows:

[0047] 1. Experimental Materials

[0048] 1. Cell lines

[0049] Human monocyte-derived dendritic cells (MoDCs) were generated from monocytes isolated from human peripheral blood mononuclear cells. The KG-1 cell line was purchased from Nanjing Kebai Biotechnology Co., Ltd. These cell lines were rigorously tested to eliminate the possibility of mycoplasma contamination. All cells were cultured at 37°C in 5% CO2 in appropriate culture medium supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin (penicillin / streptomycin (100×) was used at a concentration of 1×).

[0050] 2. Experimental Animals

[0051] BALB / C mice were purchased from Beijing Huafukang Biotechnology Co., Ltd. All animal experiments were approved by the Animal Ethics Committee of Fujian Medical University (IACUC FJMU 2023-0087). All mice were housed in an SPF-grade animal facility at the Wushan Campus of Fujian Medical University.

[0052] 3. Commonly used consumables for experiments

[0053] 6cm and 10cm cell culture dishes were purchased from Thermo, 6-well plates, 24-well plates, and 96-well cell culture plates were purchased from Thermo, 200μl, 1ml, and 5ml EP tubes, 15ml and 50ml sterile centrifuge tubes, 384-well plates were purchased from Thermo, 10μl, 200μl, and 1ml pipette tips, and 3ml sterile soft pipettes were purchased from Thermo.

[0054] 4. Experimental reagents are shown in Table 1 below.

[0055] Table 1 Experimental reagents

[0056]

[0057]

[0058] 5. The main instruments are shown in Table 2 below.

[0059] Table 2 Main instruments

[0060]

[0061] Example 1: Construction of a self-replicating srRNA vaccine targeting multiple mutant p53 proteins

[0062] 1. In vitro synthesis of srRNA

[0063] 1. Sequence design

[0064] 1) Antigen amino acid sequence design: Through comprehensive analysis of pancreatic cancer gene mutations in four databases, namely the Queensland Medical Genomics Centre (QCMG), The Cancer Genome Atlas (TCGA), the Clinical Proteomic Tumor Analysis Consortium (CPTAC), and the University of Texas Southwestern Medical Center (UTSW), 14 important TP53 hotspot mutations associated with pancreatic cancer were identified and integrated. These mutations include R175H, R273H, H214R, R248Q, R273C, C238Y, G245S, R248W, Y163C, Y220C, G266E, R282W, G245D and R248. Figure 7 Based on the 14 mutation sites of TP53, 14 25-amino acid peptide sequences were designed, each containing the mutation site. Each sequence was centered on the mutation site and connected to 12 WT P53 amino acid sequences.

[0065] 2) CDS design: Based on the 14 antigen amino acid sequences, a CDS encoding the peptide segment is designed. The 14 CDS segments are sequentially linked to obtain a CDS encoding the P53 mutant peptide segment containing the 14 mutation sites.

[0066] 2. Synthesize double-stranded DNA template

[0067] 1) Primer design: 38 synthetic primers and one pair of amplification primers were designed based on the CDS sequence.

[0068] 2) PCR amplification of double-stranded tandem mini-genes, also known as TMG: using HyperFusion TM A high-fidelity PCR Kit was used for template synthesis and amplification.

[0069] ① Dilute each primer to 10 μM and place on ice for later use.

[0070] ② First round of PCR: Use synthetic primers for PCR. After purifying the PCR product, a double-stranded tandem minigene, namely TMG-mut TP53, can be obtained.

[0071] ③Second round of PCR: PCR is performed using TMG-mut TP53 as a template to amplify TMG-mut TP53.

[0072] The coding sequence of the double-stranded tandem micro-gene is shown in SEQ ID NO.1 as follows: TACAAGCAGTCACAGCACATGACGGAGGTTGTGAGGCACTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTAGTGGTAATCTACTGGGACGGAACAGCTTTGAGGTGCATGTTTGTGCCTGTCCTGGGAGAGACCGGCGCACAGAGCGTGTGGAGTATTTGGATGACAGAAACACTTTTCGACGTAGTGTGGTGGTGCCCTATGAGCCGCCTGAGGTTGGCTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCAGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCTGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCGGCTCTGACTGTACCACCATCCACTACAACTACATGTATAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCAGCATGAACCGGAGGCCCATCCTCACCATCATCACACTGTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACTGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCCCCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTGCAAGCAGTCACAGCACATGACGGAGGTTGTGAGGCGCGACAGAAACACTTTTCGACATAGTGTGGTGGTGCCCTGTGAGCCGCCTGAGGTTGGCTCTGACTGTACCACCATCATCATCACACTGGAAGACTCCAGTGGTAATCTACTGGAACGGAACAGCTTTGAGGTGCGTGTTTGTGCCTGTCCTCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGACATGAACCGGAGGCCCATCCTCACCATCATCACACTG。

[0073] 3. Synthesize srRNA

[0074] 1) Integrate TMG-mut TP53 into plasmid T7-VEE to obtain plasmid T7-VEE-TMG.

[0075] 2) Linearize the plasmid T7-VEE-TMG using restriction enzymes.

[0076] 3) The linearized plasmid T7-VEE-TMG was used as a template to transcribe TMG-mutTP53 srRNA that can translate the mutant peptide: using HyperScribe TM Co-transcription mRNA Synthesis Kit Plus (EZ CapReagentAG (3'OMe), 5-moUTP, T7) was used to synthesize srRNA in vitro.

[0077] ① Thaw reagents on ice.

[0078] ② Prepare the capped srRNA synthesis reaction system as shown in Table 3 below.

[0079] Table 3 Capping srRNA synthesis reaction system

[0080]

[0081]

[0082] ③ Mix thoroughly and incubate at 37℃ for 2 hours.

[0083] ④Finally, add 2μl DNase I (RNase-free) to the 20μL system, mix thoroughly and incubate at 37°C for 15 minutes.

[0084] 4. Synthesis of sialic acid cholesterol derivatives SA-AE-AC-CH

[0085] 1) Dissolve 386 mg of cholesterol (CH) in 15 mL of dichloromethane. Stir and add 3 mmol of triethylamine dropwise in an ice bath. Continue stirring for 20 min. Add 3 mmol of acetyl chloride (AC) under nitrogen. Stir in an ice bath for 1 h. Then, allow to stand at room temperature with stirring and continue the reaction for 24 h.

[0086] 2) After the reaction is completed, the solvent is removed under reduced pressure, and the dispersion is dissolved with a small amount of ethanol. The pH of the system is adjusted to 7.0 with dilute hydrochloric acid, and the ethanol is removed by dialysis. AC-CH is obtained after freeze-drying.

[0087] 3) Dissolve 220 mg of AC-CH in anhydrous ethanol at 60°C, add 154 mg of aminoethanol (AE) under nitrogen protection, and stir at room temperature for 12 h.

[0088] 4) After removing the solvent under reduced pressure, the dispersion was dissolved with a small amount of ethanol, the pH of the system was adjusted to 7.0 with dilute hydrochloric acid, the ethanol was removed by dialysis (molecular weight cut-off of 1 kDa), and AE-AC-CH was obtained after lyophilization.

[0089] 5) Dissolve 186 mg of SA in 0 mL of dimethylformamide (DMF) at room temperature. Then add 342 mg of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC·HCl) and 210 mg of N-hydroxysuccinimide (NHS). Activate the mixture with magnetic stirring at room temperature for 1 h.

[0090] 6) After activation, 103 mg of AE-AC-CH was added to the reaction system and stirred at 60° C. for 12 h under nitrogen protection.

[0091] 7) After the reaction is completed, the reaction system is diluted to 4 times the volume with distilled water, dialyzed to remove ethanol, and lyophilized to obtain the sialic acid cholesterol derivative SA-AE-AC-CH.

[0092] 8) High-resolution mass spectrometry (HRMS) was used to determine the molecular weight and structure of SA-AE-AC-CH.

[0093] 5. Synthesis of self-replicating srRNA vaccines targeting multiple mutant p53 proteins

[0094] 1) Turn on the ultrasonic instrument and preheat the water to 50°C;

[0095] 2) Weigh and dissolve:

[0096] 5.8 μg of ionizable lipid, 1.1 μg of distearoylphosphatidylcholine, 2.4 μg of cholesterol, 0.6 μg of sialic acid cholesterol derivative SA-AE-AC-CH and 0.5 μg of dimyristoylglycerol-polyethylene glycol 2000 were dissolved in anhydrous ethanol to obtain an ethanol phase, thereby obtaining sialic acid-modified lipid nanoparticles SA-LNPs; 180 μg of srRNA was dissolved in citric acid buffer solution to obtain an aqueous phase.

[0097] 3) Using NanoDispatcher TM The L nanomixer microfluidics mixed the ethanol phase with the aqueous phase, encapsulated the srRNA into sialic acid-modified lipid nanoparticles, and obtained a self-replicating srRNA vaccine targeting multiple mutant p53 proteins, which was recorded as TMG-mut TP53 srRNA SA-LNPs; the volume ratio of the ethanol phase to the aqueous phase was 2.5:0.5.

[0098] Example 2: Construction of a self-replicating srRNA vaccine targeting multiple mutant p53 proteins

[0099] 6.1 μg of ionizable lipid, 1.4 μg of distearoylphosphatidylcholine, 2.7 μg of cholesterol, 0.8 μg of sialic acid cholesterol derivative SA-AE-AC-CH and 0.7 μg of dimyristoylglycerol-polyethylene glycol 2000 were dissolved in anhydrous ethanol to obtain an ethanol phase, i.e., sialic acid-modified lipid nanoparticles SA-LNPs; 210 μg of srRNA was dissolved in citric acid buffer solution to obtain an aqueous phase. The remaining steps were exactly the same as in Example 1 to prepare a self-replicating srRNA vaccine targeting multiple mutant p53 proteins, which was recorded as TMG-mut TP53srRNA SA-LNPs.

[0100] Example 3: Construction of a self-replicating srRNA vaccine targeting multiple mutant p53 proteins

[0101] The volume ratio of the ethanol phase to the aqueous phase was 3.3:1.5, and the remaining steps were exactly the same as in Example 1 to prepare a self-replicating srRNA vaccine targeting multiple mutant p53 proteins, which was recorded as TMG-mut TP53 srRNA SA-LNPs.

[0102] Experimental Example 1: Characterization of TMG-mut TP53 srRNA SA-LNPs

[0103] The particle size and polymer dispersion index (PDI) of the TMG-mutTP53 srRNA SA-LNPs in Example 1 were measured on a particle size analyzer; photographed using a transmission electron microscope (TEM); the morphology and size of the TMG-mutTP53 srRNA SA-LNPs were observed under a scanning electron microscope; the zeta potential of the TMG-mutTP53srRNA SA-LNPs was measured using a nanoparticle size and zeta potential analyzer; and the RediPlate TM 96 RiboGreen TM The RNA quantification kit was used and the TMG-mut TP53srRNA SA-LNPs encapsulation efficiency and srRNA concentration were measured using a microplate reader.

[0104] High-resolution mass spectrometry (HRMS) was used to determine the molecular weight and structure of the compound, which confirmed that SA-AE-AC-CH was successfully synthesized. Figure 9 As shown. Various lipids were dissolved in anhydrous ethanol to obtain the optimal conditions for srRNA encapsulation. Statistical evaluation of the polydispersity index (PDI) showed that the TMG-mut TP53 srRNA loaded in SA-LNPs exhibited a low PDI value (0.11), indicating a uniform particle size distribution, as shown in Figure 2. Figure 10As shown in Figure A. Based on this, it was observed that the engineered TMG-mutTP53 srRNA SA-LNPs had an average diameter of approximately 100 nm and exhibited excellent stability under physiological conditions, as shown in Figure 4. Figure 10 As shown in Figure A. In addition, scanning electron microscopy (SEM) images showed that the prepared TMG-mut TP53 srRNA SA-LNPs also exhibited a uniform spherical morphology with an average size of approximately 50 nm, as shown in Figure 3. Figure 10 As shown in Figure B. In addition, the ζ potential of TMG-mut TP53 srRNA SA-LNPs was approximately -4.298 mV, as shown in Figure 4 Figure 10 As shown in Figure C, the reliability of the formulation method for the effective delivery of srRNA is demonstrated. The encapsulation efficiency of SA-LNP loaded TMG-mut TP53 srRNA is approximately 97.8%, as shown in Figure 4. Figure 10 As shown in D. The concentration of TMG-mut TP53 srRNA in SA-LNPs was approximately 199.86 μg / ml. Figure 10 As shown in E.

[0105] Experimental Example 2: Verification of the transfection efficiency and durability of TMG-mut TP53 srRNA SA-LNPs in cells and mice in Example 1

[0106] 1. Experimental Methods

[0107] 1. Cell culture

[0108] (1) Induction and differentiation of human monocyte-derived dendritic cells (moDCs)

[0109] 1) Use EDTA anticoagulant tube purple head tube to collect patient blood

[0110] 2) First, add lymphocyte separation solution to the centrifuge tube, with a volume approximately twice that of the blood sample. Use a Pasteur pipette to slowly add the blood sample to the centrifuge tube, so that the separation solution and blood can be clearly separated.

[0111] 3) Use a gradient centrifuge and centrifuge at 2000 rpm for 20 minutes at 4°C with the brake turned off.

[0112] 4) Aspirate the cells from the lymphocyte layer into a new centrifuge tube, and then add PBS containing 2% FBS to wash the cells. The volume should not be less than the volume of the harvested cells.

[0113] 5) Centrifuge at 1000 rpm for 10 minutes at room temperature. Because the cell suspension contains lymphocyte separation medium, the centrifugation time should be increased to ensure that the PBMCs are fully centrifuged.

[0114] 6) Discard the supernatant and add 2 ml of 1640 complete medium to resuspend the PBMCs.

[0115] 7) Each patient's PBMC was cultured in a six-well plate. The number of cells per well was 1×10 6 , fill the culture medium to 2 ml

[0116] 8) After culturing for about 5 hours until the mononuclear cells adhere to the wall, separate the suspended cells and freeze them for future use.

[0117] 9) The adherent cells were cultured continuously, and 12.8 IU / ng GM-CSF and 16.1 IU / ng IL-4 were added to each well to a final concentration of 100 IU / ml.

[0118] 10) Two days later, replace half of the medium and supplement with 100 IU / ml of 12.8 IU / ng GM-CSF and 16.1 IU / ng IL-4.

[0119] 11) After another two days, replace half of the medium and supplement with 100 IU / ml of 12.8 IU / ng GM-CSF and 16.1 IU / ng IL-4.

[0120] 12) MoDCs were harvested on the sixth day for subsequent experiments.

[0121] 2. Induction and differentiation of KG-1-derived DCs

[0122] 1) KG-1 was cultured in DMEM high-glucose medium supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin (penicillin + streptomycin double antibody (100×) was used at a concentration of 1×) in an incubator at 37° C. and 5% CO 2 .

[0123] 2) After KG-1 cells have stabilized, collect the cells, remove the old culture medium by centrifugation, and resuspend in 2 ml of culture medium.

[0124] 3) Cell counting

[0125] 4) KG-1 cells were cultured in six-well plates with 1×10 cells per well. 6 , 2ml of culture medium.

[0126] 5) 10 ng / ml PMA and 100 ng / ml ionomycin were added to each well, and KG-1-derived-DCs were harvested after 24 hours of stimulation for subsequent experiments.

[0127] 3. In vitro evaluation of the transfection efficiency of TMG-mut TP53 srRNA SA-LNPs

[0128] 1) RNA dosage: 0.5 μg RNA / cm per well 2 , this experiment was conducted using a 12-well plate. The RNA dosage was 2.25 μg per well.

[0129] 2) Seed plate: 12-well plate, inoculate 2×10 5 MoDCs.

[0130] 3) Grouping: Divide into two groups, with 3 holes in each group.

[0131] ①EGFP TMG-mut TP53 srRNA SA-LNPs group.

[0132] ②EGFP mRNA SA-LNPS group.

[0133] 4) The next day, after MoDCs stabilized, 2.25 μg of EGFP TMG-mut TP53 srRNA SA-LNPs were added to MoDCs in the TMG-mut TP53 srRNA SA-LNPs group, and 2.25 μg of EGFP mRNA SA-LNPs were added to MoDCs in the mRNA SA-LNPs group. The cells were cultured for 24 h.

[0134] 5) After 24 hours, harvest MoDCs, centrifuge, and discard the old culture medium. Wash the cells with PBS and centrifuge at 400g at 4°C, discarding the PBS. Repeat this process twice.

[0135] 6) Resuspend MoDCs in 350 μl loading buffer and detect the number of EGFP-positive cells using flow cytometry.

[0136] 4. In vivo evaluation of the transfection efficiency of TMG-mut TP53 srRNA SA-LNPs

[0137] 1) The mice used were 10-week-old BALB / C mice, each weighing approximately 25 g.

[0138] 2) RNA dosage: 1 μg / g RNA per mouse.

[0139] 3) Grouping: Divided into four groups:

[0140] ①EGFP TMG-mut TP53 srRNA SA-LNPs group.

[0141] ②EGFP mRNA SA-LNPS group.

[0142] ③LUC TMG-mut TP53 srRNA SA-LNPs group.

[0143] ④LUC mRNA SA-LNPS group.

[0144] 4) RNA vaccine inoculation: RNA SA-LNPs were injected via the tail vein.

[0145] 5) After 24 hours, the mouse was sacrificed by dislocation and immersed in 75% alcohol for 5 minutes. The animal was placed on a dissecting table with its limbs fixed. The peritoneal wall was scrubbed with 75% alcohol. Under sterile conditions, the abdominal wall was cut open. Using forceps, the skin of the mouse was pulled to the sides to expose the peritoneum. The heart, liver, spleen, lungs, and kidneys of the mouse were carefully removed.

[0146] 6) Carefully remove the fat and connective tissue from the organs and wash away any remaining blood with PBS.

[0147] 7) The expression levels of EGFP and luciferase (LUC) in the heart, liver, spleen, lung, and kidney of mice were analyzed by bioluminescence imaging.

[0148] 5. In vitro evaluation of the half-life of TMG-mut TP53 srRNA SA-LNPs

[0149] 1) RNA dosage: 0.5 μg RNA / cm per well 2 This experiment was conducted in a 12-well plate. The amount of RNA used was 2.25 μg per well.

[0150] 2) Seed plate: 12-well plate, inoculate 2×10 5 KG-1-derived-DCs.

[0151] 3) Grouping: Divide into two groups, each further divided into 24h, 48h, 72h, 5d, and 7d groups, with 3 wells in each group. Total: 15 wells per group.

[0152] ①EGFP TMG-mut TP53 srRNA SA-LNPs group.

[0153] ②EGFP mRNA SA-LNPS group.

[0154] 4) The next day, after KG-1-derived DCs stabilized, 2.25 μg of EGFP TMG-mut TP53 srRNA SA-LNPs were added to MoDCs in the TMG-mut TP53 srRNA SA-LNPs group, and 2.25 μg of EGFP mRNA SA-LNPs were added to MoDCs in the mRNA SA-LNPs group, and the cells were cultured for 24 h.

[0155] 5) After 24 hours, 48 hours, 72 hours, 5 days, and 7 days, sample three wells of KG-1-derived DCs from each of the ①EGFP TMG-mut TP53 srRNA SA-LNPs group and ②EGFP mRNA SA-LNPs group. Centrifuge and discard the old culture medium. Wash the cells with PBS and centrifuge at 400g at 4°C, discarding the PBS. Repeat this cycle twice.

[0156] 6) Resuspend MoDCs in 350 μl loading buffer and detect the number of EGFP-positive cells using flow cytometry.

[0157] 6. In vivo evaluation of the half-life of TMG-mut TP53 srRNA SA-LNPs

[0158] 1) The mice used were 9-week-old BALB / C mice, each weighing approximately 25 g.

[0159] 2) RNA dosage: 1 μg / g RNA per mouse.

[0160] 3) Grouping: Divided into four groups:

[0161] ①LUC TMG-mut TP53 srRNA SA-LNPs group.

[0162] ②LUC mRNA SA-LNPS group.

[0163] 4) RNA vaccine administration: RNA SA-LNPs were injected through the tail vein.

[0164] 5) At 12 h, 24 h, 3 d, 6 d, 9 d, 12 d, 15 d, 18 d, 21 d, and 24 d after inoculation, mice were anesthetized by intraperitoneal injection of sodium pentobarbital, and the expression level of luciferase (LUC) in mice was analyzed using bioluminescence imaging.

[0165] 7. Statistical analysis

[0166] Statistical analysis was performed using GraphPad Prism 8.0 (GraphPad Software). Results are presented graphically and expressed as mean ± SD (standard deviation). Comparisons between groups were performed using the Student's t-test. A two-sided P value of less than 0.05 was considered statistically significant.

[0167] 2. Results

[0168] After the design and characterization of the synthetic TMG-mut TP53 srRNA SA-LNPs, a comprehensive validation was performed to evaluate the performance of TMG-mut TP53 srRNA SA-LNPs. In order to explore the targeting ability of the formulation, the efficacy of SA-LNPs in dendritic cells (APCs) was analyzed. First, the uptake of two LNPs by human monocyte-derived dendritic cells (MoDCs) was compared: one group of MoDCs received EGFP mRNA LNPs that were not modified with SA, while the other group of MoDCs received EGFP mRNA SA-LNPs that were modified with SA. Flow cytometric analysis showed that the proportion of positive cells in MoDCs that received EGFP mRNA SA-LNPs increased significantly to 57.0%, while the proportion of positive cells in MoDCs that received EGFP mRNA LNPs was only 38.8%, as shown in Figure 2. Figure 3 As shown in A and B. Subsequently, the targeting effect of SA-LNPs was tested in vivo. Compared with the EGFP mRNA LNPs group without SA modification, the proportion of EGFP-positive dendritic cells in the spleen of mice vaccinated with EGFP mRNA SALNPs was significantly higher, as shown in Figure 3 As shown in C. The expression levels of luciferase (LUC) mRNA in various tissues of mice, such as liver and spleen, were also analyzed by bioluminescence imaging. Compared with the LUC mRNA LNPs group without SA modification, the LUC mRNA SA-LNPs group showed stronger bioluminescence signals in the spleen of mice, as shown in Figure 4 shown.

[0169] To further elucidate the transfection efficiency of srRNA, the proportion of EGFP-positive cells at various time points after inoculation was evaluated. KG-1-derived-DCs were divided into two groups: TMG-mut TP53 srRNA SA-LNPs and conventional mRNA SA-LNPs, both of which encode EGFP. At 24 and 48 hours after transfection, KG-1-derived-DCs inoculated with conventional mRNA SA-LNPs exhibited green fluorescence; however, by 72 hours, the fluorescence was significantly reduced, as shown in Figure 2. Figure 5 In contrast, TMG-mutTP53 srRNA SA-LNPs showed sustained strong fluorescence throughout the seven-day observation period, indicating that srRNA has a longer-lasting high transfection efficiency, as shown in Figure 2. Figure 5 shown.

[0170] To verify the function of srRNA in vivo, TMG-mutTP53 srRNA SA-LNPs encoding the luciferase gene (LUC TMG-mut TP53 srRNA SA-LNPs) were injected into mice via tail vein injection, and conventional luciferase-encoding mRNA SA-LNPs (LUC mRNA SA-LNPs) were used as a control. Bioluminescence imaging confirmed that the administration of LUC srRNA successfully promoted the expression of luciferase in vivo, as shown in Figure 3. Figure 6 As shown. Notably, luciferase expression driven by LUC srRNA persisted for 21 days, likely due to its self-replication mechanism, whereas expression driven by LUC mRNA lasted only 3 days. Furthermore, luciferase expression levels were 10- to 100-fold higher in mice vaccinated with LUC TMG-mut TP53 srRNA SA-LNPs than in mice vaccinated with LUC mRNA SA-LNPs. This evidence confirms the efficacy and persistence of srRNA-LNPs in vivo.

[0171] In summary, inoculation of cells and animals with TMG-mut TP53 srRNA SA-LNPs resulted in prolonged RNA expression and improved targeting of dendritic cells. This addresses the short duration and inaccurate targeting of traditional mRNA vaccines. This may also address the poor immunogenicity commonly associated with tumor vaccines.

[0172] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0173] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.

Claims

1. A self-replicating srRNA vaccine targeting multiple mutant p53 proteins, characterized in that: The self-replicating srRNA vaccine comprises sialic acid-modified lipid nanoparticles and srRNA, and the srRNA is encapsulated in the sialic acid-modified lipid nanoparticles; The srRNA comprises a double-stranded tandem minigene, which is obtained by PCR after converting a coding sequence converted by sequentially concatenating multiple antigen extraction units containing p53 protein mutation sites, wherein the multiple p53 protein mutation sites are R175H, R273H, H214R, R248Q, R273C, C238Y, G245S, R248W, Y163C, Y220C, G266E, R282W, G245D and R248L, and the antigen extraction unit containing the p53 protein mutation site refers to a polypeptide consisting of the p53 protein mutation site and the 12 amino acids before and after it; The sialic acid-modified lipid nanoparticles are prepared from the following raw materials: ionizable lipids, distearoylphosphatidylcholine, cholesterol, sialic acid cholesterol derivative SA-AE-AC-CH and dimyristoylglycerol-polyethylene glycol 2000, with a mass ratio of 5.8-6.1:1.1-1.4:2.4-2.7:0.6-0.8:0.5-0.

7.

2. The srRNA vaccine according to claim 1, characterized in that The coding sequence of the srRNA is shown in SEQ ID NO.

1.

3. The self-replicating srRNA vaccine according to claim 1, characterized in that The srRNA also includes an RNA replicase gene derived from Venezuelan equine encephalitis virus.

4. The method for preparing the self-replicating srRNA vaccine according to claim 1, wherein The specific steps include: Synthesize srRNA; The ionizable lipid, distearoylphosphatidylcholine, cholesterol, sialic acid cholesterol derivative SA-AE-AC-CH and dimyristoylglycerol-polyethylene glycol 2000 are dissolved in anhydrous ethanol to obtain an ethanol phase; srRNA is dissolved in a citric acid buffer solution to obtain an aqueous phase; the sialic acid-modified lipid nanoparticles contain the ionizable lipid, distearoylphosphatidylcholine, cholesterol, sialic acid cholesterol derivative SA-AE-AC-CH and dimyristoylglycerol-polyethylene glycol 2000 and srRNA in a mass ratio of 5.8-6.1:1.1-1.4:2.4-2.7:0.6-0.8:0.5-0.7:180-210; The ethanol phase and the aqueous phase are mixed, and srRNA is encapsulated into sialic acid-modified lipid nanoparticles through microfluidic technology to obtain a self-replicating srRNA vaccine; the volume ratio of the ethanol phase to the aqueous phase is 2.5-3.3:0.5-1.

5.

5. The method for preparing the self-replicating srRNA vaccine according to claim 4, characterized in that The specific steps of synthesizing srRNA are: Integrating the double-stranded tandem minigene into the T7-VEE plasmid to obtain the plasmid T7-VEE-TMG; The plasmid T7-VEE-TMG was linearized using restriction enzymes; The linearized plasmid T7-VEE-TMG was used as a template to synthesize srRNA, and srRNA was synthesized by in vitro transcription.

6. The self-replicating srRNA vaccine according to claim 5, characterized in that The operation process of in vitro transcription synthesis of srRNA is as follows: Using HyperScribe TM Co-transcription mRNA Synthesis Kit Plus was used, and EZCap Reagent AG reagent was used for co-transcriptional capping.

7. Use of the self-replicating srRNA vaccine according to claim 1 in the preparation of a medicament for treating pancreatic cancer.

8. The use according to claim 7, characterized in that The vaccine achieves the treatment of pancreatic cancer by inducing the body to produce a specific immune response against the mutant p53 protein.

9. Use of the self-replicating srRNA vaccine according to claim 8 in the preparation of a drug for preventing or treating other P53 mutation-related cancers, characterized in that: Such cancers include, but are not limited to, lung cancer, breast cancer, colorectal cancer, and ovarian cancer.

Images