Application of periplaneta americana polypeptide and periplaneta americana peptide B as immunologic adjuvant

Abstract

The invention belongs to the technical field of biomedicine, and particularly relates to application of periplaneta americana polypeptide and periplaneta americana peptide B serving as an immunologic adjuvant. The amino acid sequence of the periplaneta americana polypeptide and periplaneta americana peptide B is shown as SEQ ID NO.1. According to the invention, influenza virus H1N1RBD protein is combined with periplaneta americana peptide B, mice can be induced to generate an anti-RBD protein specific IgG antibody with higher titer, and the titer of the antibody can be increased along with the increase of immunization times. Meanwhile, the level of T subsets of lymphocytes of a mouse body can be changed, so that the T subsets can resist pathogen invasion to a certain extent. The periplaneta americana polypeptide periplaneta americana peptide B provided by the invention can be conveniently obtained through mass synthesis, can be used as a novel micromolecular immunologic adjuvant, and is beneficial to enhancing the specific immune response of an organism.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and particularly relates to an application of an American cockroach polypeptide, cockroach peptide B, as an immune adjuvant. Background Art

[0002] With the continuous advancement and rapid development of immunology and genetic engineering technologies, research on new vaccines such as DNA vaccines and subunit vaccines has reached new heights. However, these vaccines generally suffer from poor immunogenicity, necessitating the use of suitable adjuvants to enhance immune responses, improve protection, reduce vaccine dosage, and lower production costs. Currently, although hundreds of candidate vaccine adjuvants are under development, only seven—aluminum salt adjuvants, MF59, virus-like particles, AS04, AS03, AS01, and CpG1018—have been approved for marketing by the US Food and Drug Administration. Common aluminum adjuvants can cause local inflammatory reactions at the injection site, such as pain, redness, swelling, and induration. Certain adjuvants can also cause systemic adverse reactions, such as fever, fatigue, and headaches, which can mimic flu-like symptoms. While traditional vaccine adjuvants play an important role in enhancing the immune efficacy of vaccines, they also face numerous drawbacks and challenges. Therefore, there is an urgent need for novel adjuvants. Summary of the Invention

[0003] The present invention aims to provide an application of American cockroach polypeptide Blattarin B as an immune adjuvant for enhancing immune response.

[0004] The technical solution adopted in the present invention is:

[0005] The present invention provides an application of an American cockroach polypeptide, blattella peptide B, as an immune adjuvant. The amino acid sequence of the American cockroach polypeptide, blattella peptide B, is shown in SEQ ID NO.1.

[0006] The present invention also provides a vaccine preparation, which is prepared from the American cockroach polypeptide Blattarin B and influenza A virus protein.

[0007] Preferably, the influenza A virus protein is RBD protein, and the nucleotide sequence encoding the RBD protein is shown in SEQ ID NO.3.

[0008] Preferably, the influenza A virus is H1N1.

[0009] Preferably, the vaccine preparation further comprises a pharmaceutically acceptable excipient.

[0010] Preferably, the auxiliary material includes at least one of a preservative, an emulsifier, a stabilizer and a diluent.

[0011] Preferably, the preservative includes any one of benzoic acid, sorbic acid, methyl paraben and benzalkonium bromide.

[0012] Preferably, the emulsifier includes any one of sodium lauryl sulfate, benzalkonium chloride and sorbitan fatty acid.

[0013] Preferably, the stabilizer includes any one of sodium sulfite, sodium bisulfite, tocopherol and disodium edetate.

[0014] Preferably, the diluent includes any one of starch, lactose, sucrose and mannitol.

[0015] Preferably, the method for preparing the vaccine preparation comprises the following steps:

[0016] Prepare influenza A virus protein; prepare American cockroach polypeptide mesophagein B; and evenly mix the influenza A virus protein and the American cockroach polypeptide mesophagein B at a mass ratio of 3:5-15 to obtain the vaccine preparation.

[0017] Preferably, the mass ratio of the influenza A virus protein to the American cockroach polypeptide Blattarin B is 3:10.

[0018] The present invention also provides an immune inducer comprising the American cockroach polypeptide Blattarin B.

[0019] Preferably, the immune-inducing agent further comprises a pharmaceutically acceptable excipient.

[0020] Preferably, the pharmaceutically acceptable excipient is one or more of an excipient, a buffer, a stabilizer and a preservative.

[0021] Preferably, the excipient includes any one of calcium sulfate, calcium hydrogen phosphate and starch slurry.

[0022] Preferably, the buffer comprises any one of an acetic acid-sodium acetate buffer pair and a disodium hydrogen phosphate-sodium dihydrogen phosphate buffer pair.

[0023] Preferably, the stabilizer includes any one of sodium sulfite, sodium bisulfite, tocopherol and disodium edetate.

[0024] Preferably, the preservative includes any one of benzoic acid, sorbic acid, methyl paraben and benzalkonium bromide.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The present invention provides the use of the American cockroach polypeptide, blattem B, as an immune adjuvant. The amino acid sequence of the American cockroach polypeptide, blattem B, is shown in SEQ ID NO. 1. The present invention utilizes the influenza A virus (H1N1) RBD protein in combination with blattem B to induce mice to produce higher titers of anti-RBD protein-specific IgG antibodies, with the titers increasing with the number of immunizations. This alters the proportion of T lymphocyte subsets in mice and protects against pathogen invasion. This adjuvant not only enhances immunity but also facilitates mass production.

[0027] The present invention induces the purification of influenza virus H1N1 RBD protein and uses blattella peptide B as an adjuvant to conduct animal experiments. During the experiment, all mice showed no obvious changes in physical signs, and their diet, coat color and mental state were good, indicating that blattella peptide B had no toxic damage to mice. The influenza virus H1N1 RBD protein used in combination with blattella peptide B induced mice to produce higher titers of anti-RBD protein-specific IgG antibodies. In the RBD+blattella peptide B group of the present invention, after three immunizations, the titer of IgG antibodies specifically binding to RBD protein was higher than that of the RBD group; the RBD+blattella peptide B group was able to stimulate the CD3 + CD4 + T cells increased, and their CD3 + CD8 + The number of T cells decreased slightly; the RBD + Blattaria peptide B group also stimulated the body to produce a mixed Th1 / Th2 immune response, enhancing the body's Th1-biased immune response and, to a certain extent, strengthening the Th2-biased immune response. This enhanced immune response was comparable to or superior to that of the Hp91 positive control group, and significantly superior to that of the RBD group and the control group. The RBD + Blattaria peptide B group effectively reduced the H1N1 PR8 viral load in the lung tissue of mice; body weight did not decrease significantly compared to the PBS negative control group. The American cockroach polypeptide Blattaria peptide B of the present invention can be easily synthesized in large quantities and is preliminarily suspected to be a novel small molecule immune adjuvant to enhance specific immune responses. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Figure 2 is the results of RBD purification and Western Blot verification. A is the SDS-PAGE result of RBD protein after purification and ultrafiltration concentration; B is the Western Blot verification result of RBD protein.

[0029] Figure 2 This is the result of measuring the P / N value of specific IgG antibodies in the serum of mice after immunization.

[0030] Figure 3 This is the result of the determination of specific IgG antibody titer in the serum of mice after immunization.

[0031] Figure 4Figure 2 is the result of T cell subsets in immunized mice, A is the flow cytometry result, and B is the statistical result of A.

[0032] Figure 5 These are the results of cytokine determination in the spleen cells of immunized mice. A is the result of IFN-γ determination, B is the result of IL-2 determination, and C is the result of IL-4 determination.

[0033] Figure 6 The results are the weight changes of mice.

[0034] Figure 7 These are the results of viral load in mouse lung tissue.

[0035] Figure 8 These are the results of HE staining of mouse lung tissue sections. A to F are PBS+blattellarin B group, PBS group, RBD group, RBD+blattellarin B group, RBD+Hp91 group and normal mouse lung tissue, respectively. DETAILED DESCRIPTION

[0036] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified.

[0037] The inventive concept of the present invention is as follows:

[0038] The present invention provides the use of an American cockroach polypeptide, blattopeptin B, as an immune adjuvant. The amino acid sequence of the American cockroach polypeptide, blattopeptin B, is shown in SEQ ID NO. 1. As a natural small-molecule polypeptide, blattopeptin B has the advantages of low synthetic cost, rapid energy provision, high digestion and absorption efficiency, enhanced metabolism, low toxicity, and low immunogenicity. As a novel immune adjuvant, it has great potential for application.

[0039] Many natural peptides possess unique physiological activities and can serve as a direct basis for drug development. For example, some natural peptides possess antibacterial and antiviral properties. Antimicrobial peptides, for example, can inhibit bacterial growth by disrupting bacterial cell membranes, offering potential applications in combating bacterial infections and potentially becoming a new generation of antibiotics to address the current clinical challenge of bacterial resistance. Other natural peptides regulate blood pressure, such as atrial natriuretic peptide (ANP), a member of the natriuretic peptide family. Atrial natriuretic peptide (ANP) promotes sodium and water excretion, lowering blood pressure and potentially allowing for further development as a treatment for hypertension. Furthermore, some natural peptides demonstrate potential in anti-tumor activities, exerting their anti-cancer effects through various mechanisms, including inducing tumor cell apoptosis, inhibiting tumor angiogenesis, and modulating the immune response, offering new hope for cancer treatment. Furthermore, natural peptides can be used as vaccine adjuvants to enhance the immune response to vaccines. They can improve the immunogenicity of vaccines, promote the production of higher levels of specific antibodies and stronger cellular immune responses, thereby enhancing the protective efficacy of vaccines. These peptides are of great significance in vaccine development and improvement. Furthermore, due to its good safety and low toxicity, it is an ideal adjuvant choice for developing vaccines that require multiple immunizations or for special populations such as children, the elderly, and the immunocompromised. Related active substances such as saponins, medicinal mushrooms, and propolis have been shown to have certain anti-inflammatory, antioxidant, anti-tumor, and immunomodulatory effects, and have been proven to have a certain adjuvant effect.

[0040] In order to enable those skilled in the art to better understand and implement the technical solution of the present invention, the present invention is further described below with reference to specific embodiments and drawings.

[0041] In the following examples, the PBS used was configured as follows: 0.2 g / L KCl, 8 g / L NaCl, 0.27 g / L KH2PO4, 1.42 g / L Na2HPO4, the solvent was water, and the pH was 7.4.

[0042] The amino acid sequence of the American cockroach polypeptide Blattarin B provided by the present invention is shown in SEQ ID NO.1; the amino acid sequence of the polypeptide Hp91 provided by the present invention is shown in SEQ ID NO.2.

[0043] SEQ ID NO. 1: DDLRGDND.

[0044] SEQ ID NO. 2:DPNAPPKRPPSAFFLFCSE.

[0045] Example 1

[0046] The application of American cockroach polypeptide Blattarin B as an immune adjuvant includes the following:

[0047] 1. Expression and purification of RBD protein:

[0048] 1.1. Construct the prokaryotic expression recombinant plasmid pET-21a-RBD as follows:

[0049] The nucleotide sequence encoding the RBD protein is shown in SEQ ID NO.3.

[0050] SEQ ID NO.3:

[0051] GGATCC ATGATATTTCCCAAAGAAAGCTCATGGCCCAACCACAACACAAACGGAGTAACGGCAGCATGCTCCCATGAGGGGAAAAGCAGTTTTTACAGAAATTTGCTATGGCTGACGGAGAAGGAGGGCTCATACCCAAAGCTGAAAAATTCTTATGTGAACAAAAAAGGGAAAGAAGTCCTTGTACTGTGGGGTATTCATCACCCGCCTAACAGTAAG GAACAACAGAATCTCTATCAGAATGAAAATGCTTATGTCTCTGTAGTGACTTCAAATTATAACAGGAGATTTACCCCGGAAATAGCAGAAAGACCCAAAGTAAGAGATCAAGCTGGGAGGATGAACTATTACTGGACCTTGCTAAAACCCGGAGACACAATAATATTTGAGGCAAATGGAAATCTAATAGCACCAATGTATGCTTTCGCACTG GAATTC .

[0052] The underlined portions are the recognition sites for the restriction endonucleases added to the vector: GGATCC for BamH I and GAATTC for EcoR I. The RBD sequence was synthesized by Shanghai Sangon Co., Ltd. and inserted into the prokaryotic expression vector pET-21a to construct the prokaryotic expression recombinant plasmid pET-21a-RBD.

[0053] 1.2. RBD protein expression, the method is as follows:

[0054] S1: Plasmid transformation: Take out the competent Escherichia coli BL-21 (DE3) from the -80℃ freezer and slowly thaw on ice. Take 1μL pET-21a-RBD recombinant plasmid, gently add it to the competent cells, and place on ice for 30 minutes. Heat shock at 42℃ for 2 minutes, and immediately transfer to an ice bath for 2 minutes. Add 900μL LB liquid medium without antibiotics, and shake and culture at 37℃ and 200rpm for 1 hour to recover. Centrifuge at 5000rpm for 1 minute, discard the supernatant, and resuspend the bacteria with the remaining culture medium. Spread the bacterial solution evenly on LB solid culture medium containing 100μg / mL ampicillin, and culture inverted at 37℃ for 16 hours. Pick a single colony grown on the plate and activate and culture it in LB liquid culture medium containing ampicillin resistance at 200rpm for 12 hours to obtain a bacterial solution expressing RBD.

[0055] S2: Protein expression induction: Inoculate the bacterial suspension into fresh LB medium containing ampicillin at a ratio of 1:100. Incubate at 37°C, 200 rpm, and shake until the OD600 reaches approximately 0.6. Add 0.5 mM IPTG and induce expression at 37°C for 18 hours. Collect the cells by centrifugation at 10,000 rpm and 4°C for 5 minutes.

[0056] Protein Extraction and Detection: Wash the cells twice with pre-chilled PBS and thoroughly remove the supernatant. Resuspend the cells in 40 mL of PBS. Disrupt the cells by sonication on ice, setting the ultrasonic disruptor to 5 seconds on, 8 seconds off, for a total of 45 minutes. Centrifuge at 10,000 rpm and 4°C for 10 minutes, collecting the supernatant and precipitate. Perform SDS-PAGE analysis to determine RBD protein expression.

[0057] S3: Inclusion body protein washing and solubilization, as follows:

[0058] The ultrasonically disrupted precipitate was resuspended with PBS, centrifuged at 4°C, 10,000 rpm for 10 min, the inclusion bodies were collected, and the washing was repeated once; the inclusion bodies were dissolved with LE Buffer, and low-temperature ultrasound was used to promote the dissolution of the inclusion bodies. The parameters were working time of 3 s and interval of 5 s. After ultrasonic disruption for 15 min, the precipitate was centrifuged at 4°C, 10,000 rpm for 30 min, and the supernatant was collected for Ni-NTA affinity chromatography column.

[0059] S4: Column attachment, renaturation, and purification, as follows:

[0060] Step 1: Take 2 mL of Ni-NTA affinity chromatography medium nickel column, add it to the chromatography column, drain the original preservation solution, add 5 times the column volume of LE Buffer and equilibrate for 5 minutes, then circulate the supernatant of S3 through the column at a constant flow rate of 1 mL / min for 8 hours.

[0061] Step 2: Use the urea-containing refolding solution to slowly circulate through the column. The urea concentration is from high to low: refolding solution I, refolding solution II, refolding solution III and refolding solution IV.

[0062] Step 3: Wash the nickel column with 5 column volumes of wash buffer containing 10 mM imidazole.

[0063] Step 4: Elute the protein with 5 column volumes of elution buffer containing 250 mM imidazole.

[0064] Step 5: Select appropriate ultrafiltration tube to concentrate the protein based on the target protein's 17kDa.

[0065] Step 6: Samples from each stage were verified by SDS-PAGE gel electrophoresis.

[0066] The results are as follows Figure 1 As shown, Figure 1 Figure A is the SDS-PAGE of the purified and concentrated RBD protein. The results show that the RBD protein was induced to express in large quantities, and a target band appeared at a molecular weight of approximately 17 kDa. The target band was relatively single and had high purity.

[0067] S5: Western Blot analysis of the purified protein samples is as follows:

[0068] The RBD protein renatured product was subjected to SDS-PAGE and the protein bands in the gel were transferred by Western Blot. The results are shown in Figure 1 B, the results showed that the molecular weight of the RBD inclusion body purification product was 17kD, proving that the present invention has successfully induced the expression of RBD protein.

[0069] 2. Mouse immunization and serological testing, the process is as follows:

[0070] Animal experiments were conducted using the induced and purified RBD protein combined with blattrapin B. Six-week-old female BALB / c mice, eight per group, were immunized via multiple intradermal injections. Two negative control groups were used: PBS and PBS plus 50 μg blattrapin B. Two experimental groups were used: 15 μg RBD and 15 μg RBD plus 50 μg blattrapin B. The positive control consisted of 15 μg RBD plus 30 μg Hp91. Immunizations were performed three times at weeks 0, 2, and 4, with a total volume of 200 μL. Blood was collected from the orbital venous plexus 10 days after each immunization. The immunization groups and procedures are shown in Table 1.

[0071] Table 1 Mouse immunization grouping and flow chart

[0072]

[0073] Note: “—” in Table 1 means there is no such item.

[0074] 2.1. The RBD+blattella peptide B group can induce the production of higher titer specific binding antibodies. The results are as follows:

[0075] To verify the titer of each group of antibodies, the following operations were performed:

[0076] Antigen coating: dilute RBD to 3 μg / mL with coating solution, 100 μL / well, and coat at 4°C overnight.

[0077] Blocking: Discard the coating solution and wash three times with 1% PBST (200 μL / well, 5 min each time). Incubate with 5% skim milk blocking solution prepared with 1% PBST (200 μL / well) and block at 37°C for 2 hours.

[0078] Primary antibody incubation: Discard the blocking solution and wash three times with 1% PBST (200 μL / well, 5 min each time). Add 50 μL / well of mouse serum diluted in 1% PBST and incubate at 37°C for 2 hours.

[0079] Secondary antibody incubation: Discard the primary antibody and wash three times with PBST (200 μL / well, 5 min each time). Add 50 μL / well of goat anti-mouse IgG-HRP antibody diluted 1:3000 in PBST and incubate at 37°C for 2 hours.

[0080] Color development: Remove the secondary antibody and wash three times with PBST (200 μL / well, 5 min each time). Add 100 μL / well of the color development substrate TMB and develop at room temperature in the dark for 20 min.

[0081] Stop reading: Add 100 μL / well of 10% dilute sulfuric acid to stop color development and measure absorbance at OD450 nm. A blank well without primary antibody incubation is designated as the cutoff value. A value 2.1 times greater than the blank well's OD value is designated as the cutoff value. The highest serum dilution exceeding the cutoff value is the titer.

[0082] Data were analyzed using Graphad Prism 9.5. Means between two groups were compared using the unpaired Mann-Whitney test, and between multiple groups were compared using one-way analysis of variance. P ≤ 0.05 was considered statistically significant. In the graphs, "*": P ≤ 0.05; "**": P ≤ 0.01; "***": P ≤ 0.001; "****": P ≤ 0.0001. ELISA-derived IgG antibody titers were calculated using the geometric mean method, and error bars represent within-group standard deviations.

[0083] Figure 2The P / N ratio of specific IgG antibodies in mouse immune sera was determined. The results showed that the levels of specific IgG antibodies in mouse serum gradually increased with increasing immunization frequency. In the experimental groups, the RBD + Blattaria pylori B group showed an increase in specific IgG antibody levels compared to the RBD group. The RBD + Blattaria pylori B group showed a significant increase after the second boost, a trend consistent with and similar to the positive control group (RBD + HP91 group).

[0084] Figure 3 The titer of specific IgG antibodies in mouse immune serum was determined. The results showed that after three immunizations, the titers of RBD protein-specific binding IgG antibodies in the RBD group, RBD+50μg cockroach peptide B group, and RBD+HP91 group could reach 1:6400, 1:25600, and 1:25600, respectively.

[0085] 2.2. Blattodea peptide B can promote higher T lymphocyte and B lymphocyte transformation. The results are as follows:

[0086] In order to explore the effect of cockroach peptide B on the proportion of T lymphocyte subsets, spleen cells of each group of mice were collected ten days after the second booster immunization to determine the level of spleen lymphocyte transformation.

[0087] The determination method is as follows: Soak the spleen in 75% alcohol for 10 minutes, dissect and separate the spleen under sterile conditions, and obtain spleen cells. The specific steps are as follows:

[0088] Spleen cell grinding: Add an appropriate amount of flow cytometry solution to rinse the other half of the spleen, place it on a 200-mesh nylon mesh, aseptically cut it into pieces in a small dish containing flow cytometry solution, and grind it with a syringe piston until there is no obvious tissue. Rinse the residual cells on the nylon mesh with flow cytometry solution.

[0089] Lyse red blood cells: collect spleen cell suspension, centrifuge at 1200 rpm for 5 min and discard the supernatant; resuspend the cells in 1 mL of flow cytometry wash buffer, add 4 mL of red blood cell lysis buffer, lyse on ice for 2 min, and then add 5 mL of flow cytometry wash buffer to terminate the reaction.

[0090] Cell counting: centrifuge at 1200 rpm for 5 min and discard the supernatant; adjust the concentration of spleen cell suspension to 1×10 7 / mL, and take 100 μL of each into a labeled flow cytometry tube.

[0091] Antibody incubation: Add mixed antibodies CD8-PerCP / CD45R-PE to each tube. For the negative group, set up a blank tube and a single-stained tube at the same time. Incubate at room temperature in the dark for 30 minutes.

[0092] Add 2 mL of sheath fluid and centrifuge at 1200 rpm for 5 min to wash the cells. Repeat the operation once, resuspend the spleen cells in 500 μL of sheath fluid, and detect on the instrument.

[0093] Figure 4 The results show that the proportion of T lymphocyte subsets in spleen cells of mice after three immunizations. + The proportion of T cells in the RBD group increased compared with the PBS group (p<0.05); the CD4 + T cells increased, p < 0.05. + T cells, RBD group, compared with PBS group, there was no significant difference, p>0.05; RBD + Blatt peptide B group compared with RBD group, CD8 + The number of T cells decreased, and the difference was statistically significant, p<0.05.

[0094] 2.3. Blatta peptide B induced a stronger Th1 / Th2 mixed immune response. The results are as follows:

[0095] To investigate the immune type and response induced by cockroach peptide B, spleen cells from each group of mice were collected 10 days after the second booster immunization and the expression levels of IFN-γ, IL-2, and IL-4 cytokines were measured by ELISA using RBD protein as a specific stimulator. The experimental steps are as follows:

[0096] Step 1: Obtain mouse spleen cells using the same method as in step 2.2.

[0097] Step 2: Splenocyte stimulation: The obtained splenocytes were resuspended in 1640 cell culture medium and plated to a cell concentration of 5×10 6 cells / mL were plated in a six-well plate in a volume of 2 mL, stimulated with RBD protein at a final concentration of 10 μg / mL, and cultured in a 37°C, 5% CO2 incubator for 24 hours.

[0098] Step 3: Cytokine indirect ELISA assay: After the stimulation, cells were collected, the cell suspension was centrifuged at 1500rpm for 5 minutes, and the supernatant was taken. The secretion of spleen lymphocyte-specific INF-γ, IL-2 and IL-4 cytokines was detected according to the instructions of the cytokine assay kit of Beijing Sizhengbai Biotechnology Co., Ltd. to evaluate the type and level of immune response enhanced by cockroach peptide B.

[0099] Figure 5 The results of cytokine determination in mouse immune spleen cells showed that after stimulation with RBD protein, the levels of IFN-γ and IL-2 expressed by spleen cells in the RBD+blattellarin B group were significantly higher than those in the RBD group, and the difference was statistically significant. This indicates that blattellarin B can enhance the body's Th1-biased immune response. Figure 5 A and B. Figure 5 C represents the IL-4 cytokine expression in splenocytes from each group of mice after stimulation with RBD protein. The results showed that the RBD+blattrapin B group showed a statistically significant increase in IL-4 expression compared to the RBD group, indicating that blattrapin B can enhance the body's Th2-biased immune response to a certain extent.

[0100] 3. Evaluation of the protective effect of immune serum: The process is as follows:

[0101] 3.1. Determination of A / PR / 8 / 34 virus.

[0102] 3.1.1 Determination of hemagglutinin HA agglutination titer.

[0103] Select a 96-well "U"-shaped microplate, place it horizontally, take 50 μL of PBS and add it to wells 2 to 12 of rows A to H respectively; add 100 μL of A / PR / 8 / 34 virus to the first column of each row A to G, and add 100 μL of PBS to well H1 as a negative control; take 50 μL from each well in the first column and then dilute it in multiples to the 12th well, and discard 50 μL from the last column; add 50 μL of 1% chicken red blood cell suspension by volume to each well, and add it in sequence from low concentration to high concentration; gently flick the microplate to mix, so that the red blood cells and virus are fully mixed, let it stand at room temperature for 30 minutes, observe the red blood cell agglutination phenomenon and record the results.

[0104] Results: The reciprocal of the highest dilution that results in complete hemagglutination is the hemagglutination titer. Complete agglutination is designated as "+," incomplete agglutination is designated as "+ / -," and no agglutination is designated as "-." The hemagglutination titer is 1:256.

[0105] 3.1.2 TCID of half the infected tissues 50 Dosimetry.

[0106] MDCK cells were pre-cultured with DMEM, 10% fetal bovine serum and 1% penicillin-streptomycin. When the cell density reached 90%, the cells were digested with trypsin and counted. The cells were counted according to the concentration of 1.5×10 4 100 μL of each cell was added to a 96-well plate and cultured in a 37°C, 5% CO2 incubator for 24 hours until the cells grew into a monolayer. The supernatant was discarded and the cells were washed twice with 100 μL of HanK's solution. The virus to be tested was diluted by half-logarithmic dilution method and the virus was diluted with virus diluent to a concentration of 10 -2 , 10 -2.5 , 10 -3 , ... until 10 -7Add 100 μL of the virus solution labeled with eight serial dilutions from A to H to each well and incubate at 35°C in a 5% CO2 incubator for 1 hour, shaking the cell plate every 20 minutes. Remove the virus to be tested, add 100 μL of virus culture solution containing TPCK trypsin at a final concentration of 2 μg / mL to each well, and incubate at 35°C in a 5% CO2 incubator for approximately 5 days. Observe the pathological changes and calculate the TCID using the Reed-Muench method. 50 , TCID 50 Half of the tissues are infected by the virus.

[0107] The formula is:

[0108] 3.2. Mouse challenge and protection experiment.

[0109] 10TCID was used on the 14th day after the second booster immunization 50 The mice were challenged with A / PR / 8 / 34 virus nasal drops at a rate of 50 μL per mouse. The clinical symptoms, survival rate, and body weight of each group of mice were observed and recorded every day after the challenge. The observation period was 12 days.

[0110] The results are as follows Figure 6 As shown, no mice in any group died. Compared with the negative control group, the body weight of mice in the RBD, RBD + Blattodea peptide B, and RBD + Hp91 groups did not change significantly after challenge, but rather showed an upward trend. Lung tissue was aseptically removed from three mice in each group on day 7 after challenge for viral load detection and HE staining.

[0111] 3.2.1 Lung tissue viral load detection.

[0112] The extracted lung tissue was weighed, and 1 mL of TRNzol was added to every 50 mg of lung tissue, and the sample was ground into a tissue homogenate. The homogenate sample was placed at room temperature for 5 minutes. 0.2 mL of chloroform was added to each sample, and the sample was shaken vigorously for 15 seconds and placed at room temperature for 3 minutes. The sample was centrifuged at 12,000 rpm at 4°C for 15 minutes. The sample will separate into three layers: a pink organic phase, an intermediate layer, and an upper colorless aqueous phase. The RNA is mainly in the aqueous phase. The aqueous phase was transferred to a new centrifuge tube. The aqueous phase was about 500 μL. An equal volume of isopropanol was added, mixed thoroughly, and placed at room temperature for 10 minutes. The sample was centrifuged at 12,000 rpm at 4°C for 10 minutes, the supernatant was removed, and 75% ethanol was added to wash the precipitate. The sample was centrifuged at 10,000 rpm at 4°C for 5 minutes, and the liquid was poured out, taking care not to pour out the precipitate. The sample was allowed to dry at room temperature, and 30 μL of RNase-free ddH2O was added and mixed repeatedly. The obtained RNA was transcribed into cDNA according to the cDNA transcription instructions. Viral load detection was performed using a q-PCR kit. The primer sequences are shown in Table 2; the amplification system is shown in Table 3; and the q-PCR reaction procedure is shown in Table 4. After amplification, the viral load in lung tissue was calculated using the ΔΔct method.

[0113] Figure 7 These are the results of viral load in mouse lung tissue. The results showed that the viral load in the lung tissue of mice in the RBD group was lower than that in the negative control group, and the difference was statistically significant; the viral load in the RBD+blattellarin B group was lower than that in the RBD group, and the difference was statistically significant.

[0114] Table 2 q-PCR primer sequences

[0115] name serial number sequence Primer1 SEQ ID NO.4 5'-CTTCTAACCGAGGTCGAAAC-3' Primer2 SEQ ID NO.5 5'-CGTCTACGCTGCAGTCCTC-3'

[0116] Note: In Table 2, Primer1 is the forward primer and Primer2 is the reverse primer.

[0117] Table 3 q-PCR amplification system

[0118]

[0119]

[0120] Note: “ / ” in Table 3 indicates that this item does not exist.

[0121] Table 4 q-PCR reaction procedure

[0122]

[0123] 3.2.2 HE staining of lung tissue after infection.

[0124] Lung tissue was fixed with a 4% formaldehyde solution by volume, suspended in the formaldehyde solution, and stored at 4°C. Once the tissue was well fixed, it was dehydrated with a gradient of alcohol, cleared with xylene, immersed in wax, and embedded in wax to prepare paraffin blocks. The embedded paraffin blocks were sectioned, and the prepared sections were stained with hematoxylin and eosin. The sections were dewaxed and rehydrated, then stained with hematoxylin and eosin. After dehydration and mounting, they were examined under a microscope.

[0125] Figure 8 HE staining results for each group show clear alveolar structure in the lung tissue of the RBD+blattrapin B group, with only mild thickening of the alveolar wall and a small amount of inflammatory cell infiltration. This result is similar to that of the positive RBD+Hp91 group and the alveolar structure of normally grown mice. In contrast, the lung tissue of the PBS group and the PBS+blattrapin B group showed more pronounced pathological changes, including extensive inflammatory cell infiltration and less distinct alveolar structure. These changes were primarily distributed in the cytoplasm of alveolar epithelial cells and in the bronchial lumen. This suggests that when mice are vaccinated with RBD protein combined with blattrapin B adjuvant, they can reduce inflammatory cell infiltration and morphological changes in lung tissue when challenged with the same virus, effectively inhibiting viral replication.

[0126] The present invention proves that the American cockroach polypeptide Blattarin B can enhance the body's production of anti-RBD antibodies, effectively inhibit the replication of the same virus, and the immune effect is enhanced with increasing dosage, thus inferring that it has immune adjuvant activity.

[0127] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0128] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. The use of the American cockroach polypeptide Blattarin B as an immune adjuvant, characterized in that: The amino acid sequence of the American cockroach polypeptide Blattarin B is shown in SEQ ID NO.

1.

2. A vaccine preparation, characterized in that The vaccine preparation is prepared from the American cockroach polypeptide Blattarin B according to claim 1 and influenza A virus protein.

3. The vaccine preparation according to claim 2, characterized in that The protein of influenza A virus is RBD protein, and the nucleotide sequence encoding the RBD protein is shown in SEQ ID NO.

3.

4. The vaccine preparation according to claim 2, characterized in that The influenza A virus is H1N1 。 5. The vaccine preparation according to claim 2, characterized in that The vaccine preparation also includes pharmaceutically acceptable excipients.

6. The vaccine preparation according to claim 5, characterized in that The auxiliary materials include at least one of a preservative, an emulsifier, a stabilizer and a diluent.

7. The vaccine preparation according to claim 2, characterized in that The preparation method of the vaccine preparation comprises the following steps: Preparation of influenza A virus proteins; Preparation of American cockroach polypeptide Blattarin B; The influenza A virus protein and the American cockroach polypeptide Blattarin B are evenly mixed in a mass ratio of 3:5-15 to obtain the vaccine preparation.

8. The vaccine preparation according to claim 7, characterized in that The mass ratio of the influenza A virus protein to the American cockroach polypeptide Blattarin B is 3:

10.

9. An immune inducer comprising the American cockroach polypeptide Blattarin B according to claim 1.

Images