EVB-IRES-based annular RNA for coding GLP-1-like polypeptide and application of EVB-IRES-based annular RNA

By optimizing the synthesis of circular RNA in the EVB-IRES-PIE system, the problems of short half-life and immune response of GLP-1 polypeptide drugs were solved, and the expression of long-acting GLP-1-like polypeptides was achieved, which was used to treat type II diabetes.

CN120464657APending Publication Date: 2025-08-12SHANGHAI JIAOTONG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510601816.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-09
Publication Date
2025-08-12

AI Technical Summary

Technical Problem

The existing GLP-1 polypeptide drugs have short half-life and require frequent injections, poor patient compliance, and the existing exon residues in the body of the ring RNA lead to an immune response, which affects clinical application.

Method used

The segmented EVB-IRES-PIE system was used to optimize the E2/E1 sequence, synthesize circular RNA, avoid exon residues, and achieve long-term expression of GLP-1-like polypeptides through nanoliposome delivery.

Benefits of technology

The long-term expression of GLP-1-like polypeptides is achieved in the body, effectively reducing the blood sugar and weight of type II diabetic mice, showing a long-term hypoglycemic effect of about a week and reducing immune response.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120464657A_ABST
    Figure CN120464657A_ABST
Patent Text Reader

Abstract

The invention provides an EVB-IRES-based annular RNA for coding a GLP-1 similar polypeptide and application of the annular RNA, and belongs to the technical field of molecular biology. The invention provides a circGLP1 recombinant plasmid and / or a circGLP1-FcBO recombinant plasmid based on EVB-IRES (Enterovirus Virus B-IRES). The circGLP1 recombinant plasmid comprises nucleotide sequences of Td-3, EVB-3, GLP1, 6xPolyAC, EVB-5 and Td-5, and the circGLP1 recombinant plasmid and the circGLP1-FcBO recombinant plasmid comprise nucleotide sequences of the Td-3, the EVB-3, the GLP1, the 6xPolyAC, the EVB-5 and the Td-5. The circGLP1-FcBO recombinant plasmid contains nucleotide sequences of Td-3, EVB-3, GLP1-FcBO, FcBO-6xPolyAC, EVB-5 and Td-5, and is characterized in that the nucleotide sequences of the circGLP1-FcBO recombinant plasmid are shown in the description. After the circular RNA-LNP is injected, the blood sugar of the mouse is continuously lower than the initial blood sugar within one week, which proves that the circular RNA-LNP can maintain the efficacy in vivo for at least one week.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to an EVB-IRES-based circular RNA encoding a GLP-1-like polypeptide and applications thereof. Background Art

[0002] Diabetes is a chronic, complex disease characterized by impaired glucose metabolism, caused by absolute or relative insulin deficiency or decreased insulin sensitivity in target cells. Type 2 diabetes is the result of a combination of peripheral insulin resistance and β-cell dysfunction. Diabetes is highly prevalent worldwide. Diabetes medications, ranging from insulin, metformin, α-glucosidase inhibitors, to DPP-4 inhibitors, all have a glucose-lowering effect for no more than 24 hours. Glucagon-like peptide-1 (GLP-1) peptides are the only incretin hormones proven to be clinically effective alone, with a duration of action of 5 to 7 days. Their discovery and application have revolutionized the treatment of obesity and diabetes, bringing new treatment options to countless diabetic patients.

[0003] GLP-1 is a 30-amino acid peptide hormone produced by proglucagon in the intestinal L cells. It is easily degraded in the body by dipeptidyl peptidase-4 (DPP4) and has a short half-life (1.5 minutes after intravenous administration in humans and 1.5 hours after subcutaneous administration). The receptor protein of GLP-1, GLP-1R, belongs to the Gs subclass of G protein-coupled receptors. It contains a 130-amino acid extracellular domain (ECD) and is a seven-transmembrane G protein-coupled receptor (GPCR) expressed in many tissues, including the pancreas, cardiovascular system, intestine, and brain. GLP-1 stimulates insulin secretion and inhibits glucagon secretion; promotes β-cell proliferation and inhibits β-cell apoptosis, thereby increasing insulin sensitivity; reduces hepatic glycogenolysis and inhibits endogenous glucose production; suppresses appetite and enhances satiety; delays gastric emptying; and protects heart function.

[0004] Currently, long-acting GLP-1R agonist hypoglycemic drugs are primarily peptide-based. In 2005, exenatide, a synthetic GLP-1 analog derived from lizard venom, received FDA approval for the treatment of type 2 diabetes. However, exenatide requires twice-daily injections, resulting in poor patient compliance. In 2010, the FDA approved liraglutide, developed by Novo Nordisk, the world's second GLP-1 drug, for the treatment of type 2 diabetes. The injection frequency was extended to once daily. In 2014, liraglutide was approved for the treatment of obesity, marking the beginning of the use of GLP-1 drugs in this area. In 2017, Novo Nordisk developed semaglutide, a once-weekly injection based on liraglutide, which was approved by the FDA for the treatment of diabetes. Semaglutide and telpotide were approved by the FDA for weight loss indications in 2021 and 2023, respectively. Currently, eight single-target GLP-1R new drugs have been approved for marketing, primarily for the treatment of type 2 diabetes. Some are also being developed for the treatment of obesity due to their low adverse reaction rates and high weight loss efficacy. Currently, long-acting GLP-1 receptor agonists such as extended-release exenatide, semaglutide, and albigglutide can all be administered once a week. Continuously improving half-life has become a pressing technical challenge in the development of GLP-1R agonist drugs and a driving force behind product updates.

[0005] Since the success of mRNA vaccines, nucleic acid drugs, including small interfering RNA (siRNA) and mRNA vaccines, have become a hot topic in the industry. Circular RNA is a single-stranded, covalently closed, non-coding RNA found in eukaryotic cells. Compared to linear messenger mRNA, circular RNA is more stable, has a longer half-life, and can produce higher protein yields within cells. In recent years, translatable circular RNAs (circRNAs) have emerged as an important vector for transient protein expression, showing great potential to replace linear messenger mRNA and reshape the RNA pharmaceutical industry.

[0006] Circular RNA can be used for protein expression, typically driven by an internal ribosome entry site (IRES) sequence to drive target gene expression. Spacer sequences are often present between the IRES and the target gene to regulate protein translation efficiency. Currently, IRESs capable of efficient protein translation from circular RNA in vivo include those from Coxsackievirus B3 (CVB3), human rhinovirus (HRV), and human enterovirus B (EVB), as well as synthetic IRESs engineered and optimized based on these viral IRESs.

[0007] The use of the permutated intron-exon (PIE) system of the T4 phage thymidylate synthase (Td) gene for in vitro synthesis and self-splicing of linear RNA transcripts is an effective method for RNA circularization. Taking the PIE of the Td gene as an example, this type I PIE structure can be used to synthesize mRNA transcribed from the T7 / T3 promoter in vitro in the presence of GTP and Mg. 2+ Under the action of the intron homology arms on both sides, RNA splicing and circularization are mediated by the intron homology arms. The circularized RNA contains the IRES and the target protein encoding RNA. In addition, this splicing usually retains part of the exon splicing sequence E1 / E2 (E1, TTGGGT; E2, CTACCGTTTAATATTGCGTCACC, SEQ ID NO. 32). This residual E2 / E1 sequence can still induce a certain immune response in the body, which has an adverse impact on related clinical trials.

[0008] Currently, there are no nucleic acid drugs for diabetes, especially those encoding GLP-1 polypeptides, developed in this field. Based on this, the present invention provides the world's first published long-acting glucose-lowering circular RNA drug structure. Summary of the Invention

[0009] The purpose of the present invention is to provide an EVB-IRES-based circular RNA encoding a GLP-1-like polypeptide and its application.

[0010] The present invention optimizes the degenerate E2 / E1 sequences required for the PIE system of the Td gene and integrates them into the IRES sequence structure of the human enterovirus EVB. This divides the EVB-IRES into two segments, the left and right. RNA synthesized by this IRES-split PIE system eliminates excess exon E2 / E1 sequences after circularization, resulting in a highly efficient circular RNA synthesis system that significantly reduces cellular immune responses.

[0011] Based on the core exon splicing sequence (E2-E1) of the rearranged intron-exon (PIE) of T4 bacteriophage, the present invention introduces a point mutation at base 676 after the VI secondary domain of the EVB virus ribosome re-entry sequence (IRES), resulting in the E1 sequence TTGGGT. Simultaneously, bases 679-683 are mutated to obtain the E2 sequence CTAC, which is compatible with the core E2 splicing sequence. The EVB-IRES is thus divided into 3' and 5' ends. The left 3' EVB-IRES is attached to the 3' intron homology arm, with the target sequence and the 6×PolyAC translation termination sequence inserted in the middle. The right 5' EVB-IRES and the 5' intron arm are then attached. This PIE structure, mediated by the nuclease's autocatalytic splicing ability, self-circularizes in vitro or in vivo, retaining only the clean fragments of the EVB-IRES, target cDNA, and the protein translation termination sequence 6×PolyAC, enabling high-level protein translation in cells. This strategy is applicable to the circularization of any target gene RNA.

[0012] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0013] In a first aspect, the present invention provides an EVB-IRES-based circGLP1 recombinant plasmid and / or a circGLP1-FcBO recombinant plasmid, wherein the circGLP1 recombinant plasmid comprises the nucleotide sequences of Td-3, EVB-3, GLP1, 6xPolyAC, EVB-5, and Td-5; the circGLP1-FcBO recombinant plasmid comprises the nucleotide sequences of Td-3, EVB-3, GLP1-FcBO, FcBO-6xPolyAC, EVB-5, and Td-5;

[0014] The Td-3 was obtained by amplifying the Td intron 3'arm gene fragment shown in SEQ ID NO.1 as a template using the primer combination Td-3-F / R shown in SEQ ID NO.8 and SEQ ID NO.9;

[0015] The EVB-3 was obtained by amplifying the EVB-IRES 3'arm gene fragment as shown in SEQ ID NO.2 using the primer combination EVB-3-F / R as shown in SEQ ID NO.10 and SEQ ID NO.11;

[0016] The GLP1 was amplified using the GLP1 cDNA shown in SEQ ID NO. 4 as a template and the primer combination GLP1-F / R shown in SEQ ID NO. 12 and SEQ ID NO. 13;

[0017] The GLP1-FcBO was amplified using the GLP1-FcBO cDNA shown in SEQ ID NO. 5 as a template and the primer combination GLP1-F / GLP1-FcBO-R shown in SEQ ID NO. 12 and SEQ ID NO. 14;

[0018] The 6xPolyAC was amplified using the 6xPolyAC shown in SEQ ID NO.6 as a template and the primer combination 6xPolyAC-F / R shown in SEQ ID NO.15 and SEQ ID NO.16;

[0019] The FcBO-6xPolyAC was amplified using 6xPolyAC as shown in SEQ ID NO. 6 as a template and the primer combination FcBO-6xPolyAC-F / 6xPolyAC-R as shown in SEQ ID NO. 17 and SEQ ID NO. 16;

[0020] The EVB-5 was amplified using the EVB-IRES 5'arm gene fragment shown in SEQ ID NO.3 as a template and the primer combination EVB-5-F / R shown in SEQ ID NO.18 and SEQ ID NO.19;

[0021] The Td-5 was amplified using the Td intron 5'arm gene fragment shown in SEQ ID NO.7 as a template and the primer combination Td-5-F / R shown in SEQ ID NO.20 and SEQ ID NO.21.

[0022] Preferably, the reaction system during the amplification is: 2×Phanta Max Buffer 20-30 μL, 8-12 mM dNTP 0.8-1.2 μL, upstream primer 1.6-2.4 μL, downstream primer 1.6-2.4 μL, DNA template 0.8-1.2 ng, DNA polymerase 0.8-1.2 μL, and ddH2O to make up the system to 45-55 μL;

[0023] The reaction procedure during the amplification is as follows: pre-denaturation at 95°C for 2.5-3.5 min; denaturation at 95°C for 13-17 s, annealing at 55°C for 13-17 s, extension at 72°C for 50-70 s, 28-32 cycles; final extension at 72°C for 4.5-5.5 min; cooling at 4°C;

[0024] The nucleotide sequences of the Td-3, the EVB-3, the GLP1, the GLP1-FcBO, the 6xPolyAC, the FcBO-6xPolyAC, the EVB-5 and the Td-5 are shown in SEQ ID NO.22 to SEQ ID NO.29, respectively.

[0025] In a second aspect, the present invention provides a method for constructing the recombinant plasmid, comprising the following steps:

[0026] (1) Double digesting the pcDNA3.1 plasmid with Hind III and Xho I endonucleases, recovering the DNA product, and obtaining the pcDNA3.1 vector backbone DNA;

[0027] (2) The pcDNA3.1 vector backbone DNA was recombined with the nucleotide sequences of Td-3, EVB-3, GLP1, 6xPolyAC, EVB-5, and Td-5 to obtain the circGLP1 recombinant product;

[0028] The pcDNA3.1 vector backbone DNA was recombined with the nucleotide sequences of Td-3, EVB-3, GLP1-FcBO, FcBO-6xPolyAC, EVB-5, and Td-5 to obtain the circGLP1-FcBO recombinant product;

[0029] (3) The recombinant product obtained in step (2) was transformed into Escherichia coli, and positive clones were screened to obtain circGLP1 recombinant plasmid and circGLP1-FcBO recombinant plasmid.

[0030] Preferably, the enzymatic digestion temperature in step (1) is 35-38°C and the time is 1.5-2.5h;

[0031] During the recombination in step (2), the amount of the pcDNA3.1 vector backbone DNA is 0.04-0.06 pmol, and the amounts of the Td-3, the EVB-3, the GLP1, the GLP1-FcBO, the FcBO-6xPolyAC, the 6xPolyAC, the EVB-5, and the Td-5 are 0.12-0.18 pmol, respectively; 8-12 μL of 2×HieffCloneUniversal Premix is also added during the recombination, and ddH2O is added to the system to 18-22 μL; the temperature during the recombination is 45-55°C, and the time is 10-20 min;

[0032] The E. coli described in step (3) is a DH5α competent bacterium, and the plate used for screening positive clones is an LB plate containing 80-120 μg / mL ampicillin.

[0033] In a third aspect, the present invention provides a method for synthesizing circGLP1 or circGLP1-FcBO circular RNA, comprising the following steps:

[0034] (1) digesting the recombinant plasmid or the recombinant plasmid constructed by the method to obtain a linearized plasmid;

[0035] (2) performing in vitro transcription on the linearized plasmid to obtain in vitro transcribed RNA;

[0036] (3) Circularize the in vitro transcribed RNA to obtain circGLP1 and circGLP1-FcBO circular RNA.

[0037] Preferably, the enzyme used in the enzymatic digestion in step (1) is Xho I restriction endonuclease, and the temperature of the enzymatic digestion is 35-38° C., and the time is 1.5-2.5 h;

[0038] The in vitro transcription reaction system in step (2) includes: 10× Reaction Buffer A 1.8-2.2 μL, 8-12 mM N 6 -methyladenosine(m 6 A) Solution 0.9-1.1 μL, 80-120 mM ATP Solution 1.8-2.2 μL, 80-120 mM GTP Solution 1.8-2.2 μL, 80-120 mM CTP Solution 1.8-2.2 μL, 80-120 mM UTP Solution 1.8-2.2 μL, linearized plasmid 500 ng-1 μg, Enzyme Mix 1.8-2.2 μL, and RNase-free ddH2O to 18-22 μL; the in vitro transcription temperature is 35-38°C, and the time is 14-18 h;

[0039] After the in vitro transcription is completed, step (2) 1.8-2.2 μL DNase is added to the in vitro transcription reaction system and incubated at 35-38° C. for 20-40 minutes to digest the transcribed linearized plasmid;

[0040] The cyclization method in step (3) is as follows: mixing the in vitro transcribed RNA with 80-120 mM GTP solution to a final concentration of 1.8-2.2 mM GTP solution, and treating at 50-60° C. for 10-20 min;

[0041] In step (3), after the in vitro transcribed RNA is cyclized, the cyclized in vitro transcribed RNA is purified. The purification method is as follows: the cyclized in vitro transcribed RNA is mixed with sodium acetate, extracted with a phenol / chloroform mixture, solid-liquid separation is performed, the liquid portion is mixed with chloroform and extracted, anhydrous ethanol is added for incubation, solid-liquid separation is performed, the solid portion is dissolved with RNase-free ddH2O, and the linear RNA is digested with RNase R to obtain circular RNA.

[0042] In a fourth aspect, the present invention provides a circGLP1 or circGLP1-FcBO circular RNA synthesized according to the method.

[0043] Preferably, the sequence of the circGLP1 circular RNA is shown as SEQ ID NO.30, and the sequence of the circGLP1-FcBO circular RNA is shown as SEQ ID NO.31.

[0044] In a fifth aspect, the present invention provides a nanoliposome comprising the circGLP1 or circGLP1-FcBO circular RNA.

[0045] In a sixth aspect, the present invention provides a method for preparing the nanoliposome, comprising the following steps:

[0046] (1) mixing ionizable lipids, phospholipids, cholesterol, and PEGylated lipids with an ethanol solution to obtain a nanoliposome-ethanol solution;

[0047] (2) mixing a citric acid buffer with the circular RNA to obtain a circRNA-citric acid buffer;

[0048] (3) The nanoliposome-ethanol solution was mixed with the circRNA-citrate buffer solution and then the nanoliposomes were prepared using a nanodrug preparation system to obtain nanoliposomes of circGLP1 or circGLP1-FcBO circular RNA.

[0049] Preferably, in step (1), the ionizable lipid is ALC-0315, the phospholipid is DSPC, the cholesterol is Cholesterol, and the PEGylated lipid is DMG-PEG2000; the concentrations of the ionizable lipid, phospholipid, cholesterol, and PEGylated lipid in the nanoliposome-ethanol solution are 8-12 mg / mL, respectively;

[0050] The preparation method of the citric acid buffer in step (2) is as follows: mixing a citric acid solution with a sodium citrate solution, adding dimethylnitrosoacetamide and standing for 20 to 40 minutes, removing the dimethylnitrosoacetamide, and obtaining a citric acid buffer; after the citric acid buffer is mixed with the circular RNA, the concentration of the circular RNA is 0.13 to 0.15 μg / μL;

[0051] The volume ratio of the nanoliposome-ethanol solution and the circRNA-citrate buffer when mixed in step (3) is 80-120:250-350; the obtained circGLP1 or circGLP1-FcBO circular RNA nanoliposomes are also ultrafiltered and concentrated using an ultrafiltration tube with a molecular weight cutoff of 28-35KD, and the rate of the ultrafiltration concentration is 2500×g~3500×g, and the time is 10-30 min.

[0052] In a seventh aspect, the present invention provides a use of the recombinant plasmid or the recombinant plasmid constructed by the method or the circular RNA or the nanoliposome or the nanoliposome prepared by the method in preparing a drug for treating diabetes.

[0053] Preferably, the diabetes is type II diabetes.

[0054] Compared with the prior art, the present invention has the following beneficial effects:

[0055] The present invention synthesizes two circular RNAs of GLP-1-like polypeptides based on the segmented IRES-PIE system, which are packaged and delivered via nanoliposomes (LNPs). In vivo, the EVB-IRES can drive the expression of GLP-1-like polypeptides, effectively reducing blood sugar and body weight in type 2 diabetic mice in about a week, demonstrating a good long-term hypoglycemic effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0057] Figure 1 This is a structural diagram of the expression plasmid pcDNA3-EVB-IRES-circGLP1 in Example 2;

[0058] Figure 2 This is a structural diagram of the expression plasmid pcDNA3-EVB-IRES-circGLP1-FcBO in Example 3;

[0059] Figure 3 The results of non-denaturing agarose gel electrophoresis analysis of circGLP1 / circGLP1-FcBO circRNA in Example 4 are shown;

[0060] Figure 4 The results of the dual-luciferase reporter gene assay in Example 5, where Mock represents the control group and Semaglutide represents the positive reference group;

[0061] Figure 5 The LNP particle size (A) and zeta potential (B) of circGLP1 and circGLP1-FcBO circular RNA in Example 6;

[0062] Figure 6 The blood glucose changes in type II diabetic mice in different treatment groups in Example 7, wherein Vehicle represents the control group and Semaglutide represents the positive reference group;

[0063] Figure 7 The figure shows the body weight changes of type II diabetic mice in different treatment groups in Example 7, wherein Vehicle represents the control group and Semaglutide represents the positive reference group. DETAILED DESCRIPTION

[0064] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0065] Example 1 Synthesis and amplification of DNA fragments

[0066] 1. Synthesis of related DNA fragments

[0067] The following DNA fragments were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0068] (1) Td intron 3'arm (SEQ ID NO.1): GGGAGACCCTCGAATGGAATTGGTTCTACATAAATGCCTAACGACTATCCCTTTGGGGAGTAGGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATTCCGGGGTAAGATTAACGACCTTATCTGAACATAATG

[0069] (2) EVB-IRES 3'arm (SEQ ID NO.2): TTAAAACAGCCTGTGGGTTGTTCCCACCCGCAGG GCCCACTGGGCGCTAGCACACTGGTATCCCGGTACCCTTGTGCGCCTGTTTTATATACCCTCCCCCTTATGTAACTTAGAAGTATGATTCAAACGGTCGACAGGCGGCTCAGTGCACCAACTGAGTCATGACCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAAGCTGTTCACACGGCTGAAGGAGAAAACGTTCGTTACCCGGCCAATTACTTCGAGAAACCTAGTACCACCATGAAGGTTGCGCAGTGTTTCGCTCCACACAACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGGCAACCCATGGGACGCTTCAATACTGACATGGTGTGAAGAGTCTATTGAGCTAATTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCCAACTGTGGAGCAGATACTCACAAACCAGTGAGCGGTCTGTCGTAACGGGCAACTCCGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCTTTTTATTCTTACATTGGCTGCTTATGGTGACAATTGACAAATTGTTACCATATAGCTATTGGATTGGCCATCCGGTGACAAACAGAGCTATTGTTTACTTGTTTGTTGGGT (The underlined part is the E1-like sequence)

[0070] (3) EVB-IRES 5'arm (SEQ ID NO.3): CTAC ACCATTAAATTACAAGGTCTTAGAAACTCTC AACTTTATTTTGACACTCAATACAGCAAAGGATCC (The underlined part is the E2-like sequence)

[0071] (4) GLP1 cDNA (SEQ ID NO.4): GGATCCGCCACC ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCGGATCCCGGATCAGGCGCCATTCTGAAGGGACCTTTACCAGTGATGTAAGTTCTTATTTGGAAGGCCAAGCTGCCAAGGAATTCATTGCTTGGCTGGTGAAAGGCGGCGGTGGCGGCGGTGGTTCTGGCGGCGGTGGTTCTTCTGGCGGCGGTGGTAGTGCTGAATCGAAATATGGTCCCCCATGTCCACCCTGTCCAGCTCCAGAA (the underlined part is the insulin signal peptide expression sequence, and the bold part is the GLP1 polypeptide expression sequence)

[0072] (5)GLP1-FcBO cDNA (SEQ ID NO.5): GCCACC ATGGCCCTGTGGATGCGCCTCCTGCCC CTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCGGATCCCGGATCAGGCGCCATTCTGAAGGGACCTTTACCAGTGATGTAAGTTCTTATTTGGAAGGCCAAGCTGCCAAGGAATTCATTGCTTGGCTGGTGAAAGGCGGCGGTGGCGGCGGTGGTTCTGGCGGCGGTGGTTCTTCTGGCGGCGGTGGTAGTGCTGAATCGAAATATGGTCCCCCATGTCCACCCTGTCCAGCTCCAGAATTTTATTGGCATTGCCTGGATGAAGGCGGCGGTGGTTCTTTTTATTGGCATTGCCTGGATGAAGGTGGTGGTGGTTCATTTTATTGCCATACCATTGATGAATGAGGACATGGAGTGA (the underlined part is the insulin signal peptide expression sequence, the bold part is the GLP1 polypeptide expression sequence, and the italic part is the FcBO polypeptide expression sequence)

[0073] (6) 6xPolyAC (SEQ ID NO. 6): GGACATGGAGTGAAAAAAACAAAAAACAAAACAAAAA ACAAAAAACAAAACAAAAAACAAAAAACAAAACAAAAAACAAAAAACAAAACAAAAAACAAAAAACAAAACAAAAAACAAAAAACAAAAC

[0074] (7) Td intron 5'arm (SEQ ID NO.7): TAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTAGACAATCCCGTGCTAAATTGTAGGACTAATTCCATTTATCAGATTTCTAG

[0075] 2. Amplification of target gene fragments

[0076] The above-synthesized gene fragment was used as a template and amplified using the primer combination shown in Table 1. The kit used for amplification was a high-fidelity PCR kit (Nanjing Novozymes Biotech Co., Ltd., Catalog No. P505-d1). After amplification, the PCR product was purified using a kit (Nanjing Novozymes Biotech Co., Ltd., Catalog No. DC301-01). The reaction system and reaction procedure for high-fidelity PCR amplification are shown in Tables 2 and 3. The gene fragments and primer combinations used for amplification are as follows:

[0077] (1) Using the Tdintron 3'arm gene fragment as a template and the primer combination Td-3-F / R, the target product Td-3 (SEQ ID NO. 22) was obtained;

[0078] SEQ ID NO.22: GCTAGCGTTTAAACTTAAGCTTGGGAGACCCTCGAATGGAATTGGTTCTAC ATAAATGCCTAACGACTATCCCTTTGGGGAGTAGGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATTCCGGGGTAAGATTAACGACCTTATCTGAACATAATGctAcACCATTAAATTACAAGGTCTT

[0079] (2) Using the EVB-IRES 3'arm gene fragment as a template and the primer combination EVB-3-F / R, the target product EVB-3 (SEQ ID NO. 23) was obtained;

[0080] SEQ ID NO.23: CCTTATCTGAACATAATGCTACACCATTAAATTACAAGGTCTTAGAAACTCT CAACTTTATTTTGACACTCAATACAGCAAAGGATCCGCCACCATGGCCCTGTGGATGCG

[0081] (3) Using GLP1 cDNA as a template and the primer combination GLP1-F / R, the target product GLP1 (SEQ ID NO. 24) was obtained;

[0082] SEQ ID NO.24: ACTCAATACAGCAAAGGATCCGCCACCATGGCCCTGTGGATGCGCCTCCTG CCCCTGCTGGCCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCGGATCCCGGATCAGGCGCCATTCTGAAGGGACCTTTACCAGTGATGTAAGTTCTTATTTGGAAGGCCAAGCTGCCAAGGAATTCATTGCTT GGCTGGTGAAAGGCGGCGGTGGCGGCGGTGGTTCTGGCGGCGGTGGTTCTTCTGGCGGCGGTGGTAGTGCTGAATCGAAATATGGTCCCCCATGTCCACCCTGTCCAGCTCCAGAATGAGGACATGGAGTGAAAAAAAC

[0083] (4) Using GLP1-FcBO cDNA as a template and the primer combination GLP1-F / GLP1-FcBO-R, the target product GLP1-FcBO (SEQ ID NO. 25) was obtained;

[0084] SEQ ID NO.25: ACTCAATACAGCAAAGGATCCGCCACCATGGCCCTGTGGATGCGCCTCCTG CCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCGGATCCCGGATCAGGCGCCATTCTGAAGGGACCTTTACCAGTGATGTAAGTTCTTATTTGGAAGGCCAAGCTGCCAAGGAATTCATTGCTTGGCTGGTGAAAGGCGGCGGTGGCGGCGGTGGTTCTGGCGGCGGTGGTTCTTCTGGCGGCGGTGGTAGTGCTGAATCGAAATATGGTCCCCCATGTCCACCCTGTCCAGCTCCAGAATTTTATTGGCATTGCCTGGATGAAGGCGGCGGTGGTTCTTTTTATTGGCATTGCCTGGATGAAGGTGGTGGTGGTTCATTTTATTGCCATACCATTGATGAATGAGGACATGGAGTGAAAAAAACAAAA

[0085] (5) Using 6xPolyAC as a template and the primer pair 6xPolyAC-F / R, the target product 6xPolyAC (SEQ ID NO.26) was obtained;

[0086] SEQ ID NO.26: ACCCTGTCCAGCTCCAGAATGAGGACATGGAGTGAAAAAAACAAAAAAC AAAACAAAAAACAAAAAACAAAACAAAAAACAAAAAACAAAACAAAAAACAAAAAACAAAA CAAAAAACAAAAAACAAAACAAAAAACAAAAAACAAAACTTAAAACAGCCTGTGGGTTG

[0087] (6) Using 6xPolyAC as a template and the primer pair FcBO-6xPolyAC-F / 6xPolyAC-R, the target product FcBO-6XPolyAC (SEQ ID NO.27) was obtained;

[0088] SEQ ID NO.27: TGAATGAGGACATGGAGTGAAAAAAACAAAAAACAAAACAAAAAACAAA AAACAAAACAAAAAACAAAAAACAAAACAAAAAACAAAAAACAAAACAAAAAACAAAAAAC AAAACAAAAAACAAAAAACAAAACTTAAAACAGCCTGTGGGTTG

[0089] (7) Using the EVB-IRES 5'arm gene fragment as a template and the primer combination EVB-5-F / R, the target product EVB-5 (SEQ ID NO. 28) was obtained;

[0090] SEQ ID NO.28: CAAAACAAAAAACAAAAAACAAAACAAAAAACAAAAAACAAAACAAAA AACAAAAAACAAAACAAAAAACAAAAAACAAAACAAAAAACAAAAAACAAAACTTAAAACAGCCTGTGGGTTGTTCCCACCCGCAGGGCCCACTGGGCGCTAGCACACTGGTATCCCGGTACCCTTGTGCGCCTGTTTTATATACCCTCCCCCTTATGTAACTTAGAAGTATGATTCAAACGGTCGACAGGCGGCTCAGTGCACCAACTGAGTCATGACCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAAGCTGTTCACACGGCTGAAGGAGAAAACGTTCGTTACCCGGCCAATTACTTCGAGAAACCTAGTACCACCATGAAGGTTGCGCAGTGTTTCGCTCCACACAACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGGCAACCCATGGGACGCTTCAATACTGACATGGTGTGAAGAGTCTATTGAGCTAATTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCCAACTGTGGAGCAGATACTCACAAACCAGTGAGCGGTCTGTCGTAACGGGCAACTCCGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCTTTTTATTCTTACATTGGCTGCTTATGGTGACAATTGACAAATTGTTACCATATAGCTATTGGATTGGCCATCCGGTGACAAACAGAGCTATTGTTTACTTGTTTGTTGGgTTAATTGAGGCCTGAGTATAAGGTGA

[0091] (8) Using the Td intron 5'arm gene fragment as a template and the primer pair Td-5-F / R, the target product Td-5 (SEQ ID NO.29) was obtained.

[0092] SEQ ID NO.29: TGTTTACTTGTTTGTTGGgTTAATTGAGGCCTGAGTATAAGGTGACTTATACT TGTAATCTATCTAAACGGGGAACCTCTCTAGTAGACAATCCCGTGCTAAATTGTAGGACTAATTCC ATTTATCAGATTTCTAGCTCGAGTCTAGAGGGCCC

[0093] Table 1 Sequences of primer combinations used in amplification

[0094]

[0095]

[0096] Table 2 Reaction system for high-fidelity PCR amplification

[0097] Ingredients Dosage 2×PhantaMaxBuffer 25 μL dNTP (10 mM each) 1 μL PrimerF (upstream primer) 2μL PrimerR (downstream primer) 2μL DNA template 1ng PhantaMaxSuper-FidelityDNAPolymerase 1 μL <![CDATA[ddH2O]]> Make up the system to 50 μL

[0098] Table 3 Reaction procedures for high-fidelity PCR amplification

[0099]

[0100]

[0101] Example 2 Construction of pcDNA3-EVB-IRES-circGLP1 expression plasmid

[0102] 1. Take 1 μg of pcDNA3.1 plasmid and digest it with Hind III and Xho I endonucleases (NEB) at 37°C for 2 h. Recover the DNA product using a kit (Nanjing Novozymes Biotech Co., Ltd., Cat. No. DC301-01) to obtain the pcDNA3.1 vector backbone DNA.

[0103] 2. Use the One-step cloning kit (Yisheng, Cat. No. 10922ES20) according to the system shown in Table 4 and react at 50°C for 15 minutes to complete the recombination reaction.

[0104] Table 4 Construction of the recombination reaction system of pcDNA3-EVB-IRES-circGLP1

[0105] Ingredients Dosage Td-3 0.15 pmol EVB-3 0.15 pmol GLP1 0.15 pmol 6xPolyAC 0.15 pmol EVB-5 0.15 pmol Td-5 0.15 pmol pcDNA3.1 vector backbone DNA 0.05 pmol 2×HieffCloneUniversalPremix 10 μL <![CDATA[ddH2O]]> Make up the system to 20 μL

[0106] 3. After the recombination reaction is completed, the recombinant product is used to transform DH5α competent bacteria (Beijing Qingke Biotechnology Co., Ltd., catalog number: TSC-C14), and clones are picked on LB plates containing 100 μg / mL ampicillin. The expression plasmid pcDNA3-EVB-IRES-circGLP1 ( Figure 1 ).

[0107] A small amount of bacterial culture was taken from the successfully constructed plasmid pcDNA3-EVB-IRES-circGLP1 to expand the culture and extract the endotoxin-free plasmid for use in cell experiments.

[0108] Example 3 Construction of pcDNA3-EVB-IRES-circGLP1-FcBO plasmid

[0109] 1. Take 1 μg of pcDNA3.1 plasmid and digest it with Hind III and Xho I endonucleases (NEB) at 37°C for 2 h. Recover the DNA product using a kit (Nanjing Novozymes Biotech Co., Ltd., Cat. No. DC301-01) to obtain the pcDNA3.1 vector backbone DNA.

[0110] 2. Use the One-step cloning kit (Yisheng, Cat. No. 10922ES20) according to the system shown in Table 5 and react at 50°C for 15 minutes to complete the recombination reaction.

[0111] Table 5 Construction of pcDNA3-EVB-IRES-circGLP1-FcBO recombination reaction system

[0112] Ingredients Dosage Td-3 0.15 pmol EVB-3 0.15 pmol GLP1-FcBO 0.15 pmol FcBO-6xPolyAC 0.15 pmol EVB-5 0.15 pmol Td-5 0.15 pmol pcDNA3.1 vector backbone DNA 0.05 pmol 2×HieffCloneUniversalPremix 10 μL <![CDATA[ddH2O]]> Make up the system to 20 μL

[0113] 3. After the recombination reaction is completed, the recombinant product is used to transform DH5α competent bacteria (Beijing Qingke Biotechnology Co., Ltd., catalog number: TSC-C14), and clones are picked on LB plates containing 100 μg / mL ampicillin. The expression plasmid pcDNA3-EVB-IRES-circGLP1-FcBO ( Figure 2 ).

[0114] A small amount of bacterial culture was taken from the successfully constructed plasmid pcDNA3-EVB-IRES-circGLP1-FcBO to expand the culture and extract the endotoxin-free plasmid for use in cell experiments.

[0115] Example 4 In vitro synthesis of circGLP1 and circGLP1-FcBO circular RNA

[0116] 1. Preparation of linearized plasmid template

[0117] 1.5 μg of each plasmid, pcDNA3-EVB-IRES-circGLP1 and pcDNA3-EVB-IRES-circGLP1-FcBO, was reacted with the restriction enzyme Xho I (NEB, Catalog No. R0146V) at 37°C for 2 h. After electrophoresis on 1% agarose gel at 150 V for 30 min, the linearized plasmid was confirmed to be completely linearized. The linearized plasmid was then recovered using a kit (Nanjing Novozymes Biotech Co., Ltd., Catalog No. DC301-01).

[0118] 2. In vitro transcription

[0119] Use an in vitro transcription kit (Hanhai New Enzyme, Cat. No. HBP001506) to prepare the reaction system according to Table 6. Gently mix all components with a pipette and incubate at 37°C for 16 hours. Then, add 2μL of DNase I to the reaction system and incubate at 37°C for 30 minutes to digest the linearized plasmid DNA template.

[0120] Table 6 In vitro transcription reaction system

[0121] Components Dosage 10×ReactionBufferA 2μL <![CDATA[N 6 -methyladenosine(m 6 A)Solution(10mM)]]> 1 μL ATPSolution (100mM) 1.9 μL GTPSolution (100mM) 2μL CTPSolution (100mM) 2μL UTPSolution (100mM) 2μL LinearizedPlasmidTemplate 800ng EnzymeMix 2μL <![CDATA[RNase-freeddH2O]]> Make up to 20 μL

[0122] 3. In vitro circularization and purification of RNA

[0123] (1) GTP solution (100 mM, Sangon, catalog number: A620332-0250) was added to the RNA obtained by in vitro transcription to a final concentration of 2 mM in GTP solution and treated at 55°C for 15 min;

[0124] (2) Add RNase-free ddH2O to dilute the product to 180 μL;

[0125] (3) Add 20 μL of 3 M sodium acetate (pH = 5.2) to the diluted product and mix thoroughly with a pipette;

[0126] (4) Add 200 μL of phenol / chloroform mixture (1:1) for extraction, centrifuge at 12000 rpm (13400 × g) for 5 min at room temperature, and transfer the upper aqueous phase to a new RNase-free EP tube;

[0127] (5) Add an equal volume of chloroform to the aqueous phase and extract once. Transfer the upper aqueous phase to a new RNase-free EP tube.

[0128] (6) Add 2 volumes of anhydrous ethanol, mix well, incubate at -20°C for 30 min, and then centrifuge at 4°C, 12000 rpm (13400 × g) for 15 min;

[0129] (7) After discarding the supernatant, add 500 μL of pre-chilled 70% ethanol to wash the RNA precipitate, centrifuge at 12000 rpm (13400 × g) at 4°C, and discard the supernatant;

[0130] (8) Open the lid and dry for 3 min, add 35 μL RNase-free ddH2O to dissolve the RNA precipitate, and store at -80°C;

[0131] (9) Take the purified RNA sample and use RNase R (Hanhai New Enzyme, Catalog No.: HBP004600-1) at 37°C for 30 min to digest the linear RNA. The reaction system is shown in Table 7;

[0132] Table 7 RNase R digestion reaction system

[0133]

[0134] (10) After RNase R treatment, the circGLP1 circular RNA (SEQ ID NO. 30) and circGLP1-FcBO circular RNA (SEQ ID NO. 31) were obtained and stored at -80°C.

[0135]

[0136]

[0137] 4. Electrophoresis detection of circGLP1 and circGLP1-FcBO circular RNA

[0138] 500 ng of each circGLP1 / circGLP1-FcBO sample was analyzed by native agarose gel electrophoresis. 0.5× TBE electrophoresis buffer was prepared using DEPC-ddH₂O. The electrophoresis tank was soaked with nuclease remover overnight and rinsed with DEPC-ddH₂O the next day. Both the electrophoresis tank and electrophoresis buffer were pre-chilled at 4°C. A 1.5% agarose gel was prepared and pre-chilled at 4°C.

[0139] The purified circGLP1 and circGLP1-FcBO circular RNA samples were denatured. 500 ng of each sample before and after RNaseR enzyme treatment was taken and diluted to 5 μL with DEPC-ddH2O. 5 μL of 2×RNA Denatureing Loading Buffer (Biyuntian, Cat. No.: R0216) was added and incubated at 70°C for 10 minutes, and then immediately cooled on ice. The cooled sample was loaded onto a 1.5% agarose gel and electrophoresed at a constant voltage of 180V for 30 minutes. After the electrophoresis was completed, the sample was developed and photographed using a Tanon 2500 developer. The results are shown in the figure. Figure 3 As shown in the figure, after RNase R treatment, the linear precursor of circular RNA has been basically digested.

[0140] Example 5 Detection of Dual-Luciferase Reporter Gene Activity of circGLP1 and circGLP1-FcBO Circular RNA

[0141] 1. Cell transfection experiment

[0142] HEK293T cells were passaged and plated evenly in 24-well plates. Transfection experiments were performed when the cells reached 70-80% confluency. Each well was first transfected with the dual-luciferase reporter plasmid system (Table 8). The dual-luciferase reporter plasmid system was mixed and gently pipetted to mix. The mixture was incubated at room temperature for 5 minutes before being evenly added dropwise to each well.

[0143] Table 8 Dual luciferase reporter plasmid system

[0144] Components Dosage pGL4-miniCMV-CRE plasmid 250ng pcDNA3.1-GLP-1R plasmid 250ng pRL-TK plasmid 20ng Lipo8000 reagent (Biyuntian, product number: C0533) 0.8μL DMEM medium 25 μL

[0145] Afterwards, the control group (Mock) was treated with 0.8 μL of Lipo8000 reagent; the positive control group (Semaglutide) was treated with semaglutide injection (1.5 mL / vial, Novo Nordisk) to a final concentration of 1 pM; and the experimental groups (circGLP1 and circGLP1-FcBO) were treated with 0.5 μg of circGLP1 or circGLP1-FcBO circular RNA sample, 0.8 μL of Lipo8000 reagent, and 25 μL of DMEM medium. The mixture was gently pipetted and incubated at room temperature for 5 minutes before being evenly added dropwise to the culture dish (Note: The two transfection systems must be incubated separately before being added dropwise to the culture dish). Cultures were continued for 48 hours.

[0146] 2. Dual luciferase reporter gene assay

[0147] The transfected cells were washed, lysed, centrifuged and the supernatant lysate was collected using a dual luciferase reporter gene assay kit (Nanjing Novozymes Biotech Co., Ltd., catalog number: DL101-01) according to the instructions. The bioluminescence intensity was then read using a Promega bioluminescence detector. The results were as follows: Figure 4 As shown in the figure, it can be observed that the prepared two circular RNAs, circGLP1 and circGLP1-FcBO, can significantly activate GLP-1R.

[0148] Example 6 Preparation of circGLP1 and circGLP1FcBO Nanoliposomes

[0149] 1. Preparation of nanoliposome-ethanol solution

[0150] The lipids used in the preparation of nanoliposome LNPs (all products of Avitol) were: ALC-0315 (ionizable lipid), DSPC (phospholipid), Cholesterol (cholesterol), and DMG-PEG2000 (PEGylated lipid). The four lipids were weighed and dissolved in ethanol to prepare a 10 mg / mL (16 mM) stock solution of each lipid for use.

[0151] According to the ratio shown in Table 9, a nanoliposome-ethanol solution was prepared at a molar ratio of ALC-0315:DSPC:Cholesterol:DMG-PEG2000=50:10:38.5:1.5 for use.

[0152] Table 9 The ratio of each component of nanoliposome

[0153]

[0154] 2. Preparation of circRNA-citrate buffer

[0155] Prepare 50 mL of each 100 mM citric acid (molecular weight 210.14, weigh 1.05 g) and sodium citrate (molecular weight 294.10, weigh 1.47 g) solution in ultrapure water. Mix 33.0 mL of the citric acid solution and 17.0 mL of the sodium citrate solution, then add 0.5 mL of DEPC (dimethylnitrosoacetamide). Let stand for 30 minutes, then autoclave to remove the DEPC. After sterilization, dilute to 100 mL with DEPC-ddH2O to obtain 50 mM citric acid buffer (pH 4).

[0156] According to the nitrogen-phosphorus ratio N / P=6, it was calculated that the total mass of circRNA that can be encapsulated in every 100 μL of 10 mg / mL nanoliposome-ethanol solution is 43 μg.

[0157] Based on the volume ratio (FRR) of nanoliposome-ethanol solution: citric acid-RNA solution = 3, the total volume of citric acid buffer was 300 μL, and the RNA concentration of the prepared circRNA-citric acid buffer was 0.143 μg / μL.

[0158] 3. Preparation and Characterization of Nanoliposome LNP Particles Packaging circGLP1 and circGLP1-FcBO Circular RNA

[0159] (1) Microfluidic preparation of circular RNA nanoliposomes

[0160] Take 100 μL of nanoliposome-ethanol solution and 300 μL of circRNA-citrate buffer, and use the microfluidic rapid nanodrug preparation system (Nanomicro Technology, model: NWDPSⅡ40) to prepare nanoliposome LNP. The volume ratio of nanoliposome-ethanol solution: citric acid-RNA solution (FRR) is 3, 200 μL of the front waste liquid and 50 μL of the rear waste liquid. Collect the sample after running the machine.

[0161] After sample collection, the ethanol concentration was immediately diluted to below 1% with 30 volumes of PBS solution. The sample was then concentrated by ultrafiltration using a Milipore 30KD ultrafiltration tube and centrifuged at 3000 × g for 20 minutes. The ultrafiltered sample was stored in PBS containing 2% sucrose and frozen at -80°C.

[0162] (2) LNP particle size characterization and measurement

[0163] The particle size and Zeta potential of LNP were measured using a dynamic light scattering instrument. Figure 5 As shown, LNPs with a uniform particle size of about 110 nm and a slightly negative Zeta potential were obtained.

[0164] Example 7 Blood sugar reduction experiment in type II diabetes model mice

[0165] Thirty eight-week-old C57BL / 6 mice were fed a high-fat diet for two months. A streptozotocin (STZ) solution was prepared by dissolving STZ in 0.1 mol / L citric acid-sodium citrate buffer (pH 4.5, 4°C). STZ was injected once daily at a dose of 60 mg / kg per week. Blood glucose levels were monitored using blood glucose test strips three weeks after injection. Successful establishment of a type 2 diabetes model was confirmed when blood glucose levels continued to rise and stabilized at 10-20 mmol / L.

[0166] For STZ-induced type II diabetic mice, blood glucose was continuously monitored for 3 days using blood glucose test strips. After blood glucose stabilized, circGLP1 and circGLP1-FcBO circular RNA-LNP prepared in Example 6 were injected intraperitoneally. The volume of the injected LNP preparation was 200 μL, of which the amount of circRNA was 40 μg, as the experimental group (LNP-circGLP1 and LNP-circGLP1-FcBO). The control group (Vehicle) was intraperitoneally injected with empty LNP at an injection volume of 200 μL, and the positive reference group (Semaglutide) was intraperitoneally injected with semaglutide at an injection volume of 15 ng / g body weight. Thereafter, their blood glucose and body weight changes were monitored for one week.

[0167] The results are as follows Figure 6 and Figure 7 As shown, after injection of circGLP1 and circGLP1-FcBO circular RNA-LNP, the mice's blood glucose levels remained below the initial level for a week, and their body weight also showed a significant downward trend, demonstrating that their effects can be maintained in vivo for at least a week. The circGLP1-FcBO RNA drug can maintain its hypoglycemic effect for 108 to 132 hours.

[0168] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A circGLP1 recombinant plasmid based on EVB-IRES and / or a circGLP1-FcBO recombinant plasmid, characterized in that: The circGLP1 recombinant plasmid contains the nucleotide sequences of Td-3, EVB-3, GLP1, 6xPolyAC, EVB-5 and Td-5; the circGLP1-FcBO recombinant plasmid contains the nucleotide sequences of Td-3, EVB-3, GLP1-FcBO, FcBO-6xPolyAC, EVB-5 and Td-5; The Td-3 was obtained by amplifying the Td intron 3'arm gene fragment shown in SEQ ID NO.1 as a template using the primer combination Td-3-F / R shown in SEQ ID NO.8 and SEQ ID NO.9; The EVB-3 was obtained by amplifying the EVB-IRES 3'arm gene fragment as shown in SEQ ID NO.2 using the primer combination EVB-3-F / R as shown in SEQ ID NO.10 and SEQ ID NO.11; The GLP1 was amplified using the GLP1 cDNA shown in SEQ ID NO. 4 as a template and the primer combination GLP1-F / R shown in SEQ ID NO. 12 and SEQ ID NO. 13; The GLP1-FcBO was amplified using the GLP1-FcBO cDNA shown in SEQ ID NO. 5 as a template and the primer combination GLP1-F / GLP1-FcBO-R shown in SEQ ID NO. 12 and SEQ ID NO. 14; The 6xPolyAC was amplified using the 6xPolyAC shown in SEQ ID NO.6 as a template and the primer combination 6xPolyAC-F / R shown in SEQ ID NO.15 and SEQ ID NO.16; The FcBO-6xPolyAC was amplified using 6xPolyAC as shown in SEQ ID NO. 6 as a template and the primer combination FcBO-6xPolyAC-F / 6xPolyAC-R as shown in SEQ ID NO. 17 and SEQ ID NO. 16; The EVB-5 was amplified using the EVB-IRES 5'arm gene fragment shown in SEQ ID NO.3 as a template and the primer combination EVB-5-F / R shown in SEQ ID NO.18 and SEQ ID NO.19; The Td-5 was amplified using the Td intron 5'arm gene fragment shown in SEQ ID NO.7 as a template and the primer combination Td-5-F / R shown in SEQ ID NO.20 and SEQ ID NO.

21.

2. The recombinant plasmid according to claim 1, wherein The reaction system for the amplification is as follows: 2×PhantaMax Buffer 20-30 μL, 8-12 mM dNTP 0.8-1.2 μL, upstream primer 1.6-2.4 μL, downstream primer 1.6-2.4 μL, DNA template 0.8-1.2 ng, DNA polymerase 0.8-1.2 μL, and ddH2O to make up the system to 45-55 μL; The reaction procedure during the amplification is as follows: pre-denaturation at 95°C for 2.5-3.5 min; denaturation at 95°C for 13-17 s, annealing at 55°C for 13-17 s, extension at 72°C for 50-70 s, 28-32 cycles; final extension at 72°C for 4.5-5.5 min; cooling at 4°C; The nucleotide sequences of the Td-3, the EVB-3, the GLP1, the GLP1-FcBO, the 6xPolyAC, the FcBO-6xPolyAC, the EVB-5 and the Td-5 are shown in SEQ ID NO.22 to SEQ ID NO.29, respectively.

3. A method for constructing the recombinant plasmid according to claim 1 or 2, characterized in that: The steps include: (1) Double digesting the pcDNA3.1 plasmid with Hind III and Xho I endonucleases, recovering the DNA product, and obtaining the pcDNA3.1 vector backbone DNA; (2) The pcDNA3.1 vector backbone DNA was recombined with the nucleotide sequences of Td-3, EVB-3, GLP1, 6xPolyAC, EVB-5, and Td-5 to obtain the circGLP1 recombinant product; The pcDNA3.1 vector backbone DNA was recombined with the nucleotide sequences of Td-3, EVB-3, GLP1-FcBO, FcBO-6xPolyAC, EVB-5, and Td-5 to obtain the circGLP1-FcBO recombinant product; (3) The recombinant product obtained in step (2) was transformed into Escherichia coli, and positive clones were screened to obtain circGLP1 recombinant plasmid and circGLP1-FcBO recombinant plasmid.

4. The method according to claim 3, wherein The enzymatic digestion in step (1) is performed at a temperature of 35 to 38° C. for 1.5 to 2.5 h. During the recombination in step (2), the amount of the pcDNA3.1 vector backbone DNA is 0.04-0.06 pmol, and the amounts of the Td-3, the EVB-3, the GLP1, the GLP1-FcBO, the FcBO-6xPolyAC, the 6xPolyAC, the EVB-5, and the Td-5 are 0.12-0.18 pmol, respectively; 8-12 μL of 2×HieffClone Universal Premix is added during the recombination, and ddH2O is added to the system to 18-22 μL; the temperature during the recombination is 45-55°C, and the time is 10-20 min; The E. coli described in step (3) is a DH5α competent bacterium, and the plate used for screening positive clones is an LB plate containing 80-120 μg / mL ampicillin.

5. A method for synthesizing circGLP1 or circGLP1-FcBO circular RNA, characterized in that: The steps include: (1) Enzymatically digesting the recombinant plasmid described in claim 1 or 2 or the recombinant plasmid constructed by the method described in claim 3 or 4 to obtain a linearized plasmid; (2) performing in vitro transcription on the linearized plasmid to obtain in vitro transcribed RNA; (3) Circularize the in vitro transcribed RNA to obtain circGLP1 and circGLP1-FcBO circular RNA.

6. The method according to claim 5, wherein The enzyme used in the enzymatic digestion in step (1) is Xho I restriction endonuclease, the temperature of the enzymatic digestion is 35-38° C., and the time is 1.5-2.5 h; The in vitro transcription reaction system in step (2) includes: 10× Reaction Buffer A 1.8-2.2 μL, 8-12 mM N 6 -methyladenosine(m 6 A) Solution 0.9-1.1 μL, 80-120 mM ATP Solution 1.8-2.2 μL, 80-120 mM GTP Solution 1.8-2.2 μL, 80-120 mM CTP Solution 1.8-2.2 μL, 80-120 mM UTP Solution 1.8-2.2 μL, linearized plasmid 500 ng-1 μg, Enzyme Mix 1.8-2.2 μL, and RNase-free ddH2O to 18-22 μL; the in vitro transcription temperature is 35-38°C, and the time is 14-18 h; After the in vitro transcription is completed, step (2) 1.8-2.2 μL DNase is added to the in vitro transcription reaction system and incubated at 35-38° C. for 20-40 minutes to digest the transcribed linearized plasmid; The cyclization method in step (3) is as follows: mixing the in vitro transcribed RNA with 80-120 mM GTP Solution to a final concentration of 1.8-2.2 mM GTP Solution, and treating at 50-60°C for 10-20 min; In step (3), after the in vitro transcribed RNA is cyclized, the cyclized in vitro transcribed RNA is purified. The purification method is as follows: the cyclized in vitro transcribed RNA is mixed with sodium acetate, a phenol / chloroform mixture is added for extraction, solid-liquid separation is performed, the liquid portion is mixed with chloroform and extracted, anhydrous ethanol is added for incubation, solid-liquid separation is performed, the solid portion is dissolved with RNase-free ddH2O, and the linear RNA is digested with RNase R to obtain circular RNA.

7. A circGLP1 or circGLP1-FcBO circular RNA synthesized according to the method of claim 5 or 6.

8. A nanoliposome comprising the circGLP1 or circGLP1-FcBO circular RNA according to claim 7.

9. A method for preparing the nanoliposome according to claim 8, characterized in that: The steps include: (1) mixing ionizable lipids, phospholipids, cholesterol, and PEGylated lipids with an ethanol solution to obtain a nanoliposome-ethanol solution; (2) mixing a citric acid buffer with the circular RNA according to claim 7 to obtain a circRNA-citric acid buffer; (3) The nanoliposome-ethanol solution was mixed with the circRNA-citrate buffer solution and then the nanoliposomes were prepared using a nanodrug preparation system to obtain nanoliposomes of circGLP1 or circGLP1-FcBO circular RNA.

10. Use of the recombinant plasmid according to claim 1 or 2, or the recombinant plasmid constructed by the method according to claim 3 or 4, or the circular RNA according to claim 7, or the nanoliposome according to claim 8, or the nanoliposome prepared by the method according to claim 9 in preparing a drug for treating diabetes.