SNP (Single Nucleotide Polymorphism) marker closely linked with tobacco black shank resistance Ph gene and application of SNP marker

Abstract

The invention provides an SNP marker closely linked with a tobacco black shank resistance Ph gene and application thereof, and belongs to the technical field of tobacco breeding, the SNP marker comprises SNP-2 and SNP-6, the nucleotide sequence of the SNP-2 is shown as SEQ ID NO.1, the polymorphic site of the SNP-2 is located at the 68th site of the sequence shown as SEQ ID NO.1, the nucleotide sequence of the SNP-6 is shown as SEQ ID NO.2, and the polymorphic site of the SNP-6 is located at the 431st site of the sequence shown as SEQ ID NO.2. The two double-side specific SNP markers closely linked with the Ph gene developed by the invention can effectively promote tobacco black shank-resistant molecular breeding work, and have positive significance for cultivating a new black shank-resistant tobacco strain carrying the Ph gene.

Description

Technical Field

[0001] The present invention relates to the technical field of tobacco breeding, and in particular to a method for tobacco to resist black shank disease. Ph Tightly linked SNP markers and their application in assisting tobacco black shank resistance breeding. Background Art

[0002] Tobacco black shank is caused by Phytophthora nicotianae ( Phytophthora parasitica var nicotianae Black shank, a soil-borne fungal disease caused by tobacco ( ), is one of the most devastating diseases in tobacco production. Since its discovery over a century ago, it has rapidly spread throughout major tobacco-producing countries worldwide, causing massive economic losses annually. Black shank can occur throughout the tobacco plant's growth cycle, but primarily affects field-grown plants, primarily at the base of the stem. It can also damage the pith and leaves, ultimately causing the entire plant to wilt and die.

[0003] The occurrence and prevalence of tobacco black shank are affected by many factors. High temperature and humidity, poor drainage, and continuous cropping can aggravate the degree of damage caused by the disease. Therefore, in production practice, the damage can be reduced by reasonable rotation with non-host crops such as Gramineae, promoting deep plowing and high ridge transplanting, strengthening drainage and timely cleaning of diseased plants, as well as selecting appropriate fungicides, antagonistic bacteria and inducers. From the perspective of sustainable development, breeding disease-resistant varieties is undoubtedly the most economical, effective and environmentally friendly measure to prevent and control black shank, and the key is to find a suitable source of resistance. After decades of collection, creation and experimentation, tobacco has accumulated a wealth of black shank resistance sources, which mainly come from: (1) related species of tobacco, such as wild tobacco N. plumbaginifolia and N. longiflora Vertical resistance genes Php and Phl , and derived from N. rustica of Wz Genes; (2) Cultivated tobacco germplasm resources, such as the horizontal resistance micro-effect polygenes from cigar tobacco Florida301 and Beinhart1000-1, namely quantitative trait loci (QTLs). In addition, a number of resistance sources have also been identified from local tobacco germplasm resources; (3) Cultivated tobacco artificially induced mutants, such as the Honghua Dajinyuan mutant with high resistance to black shank disease obtained by Liu Xiaoxia et al. using radiation mutagenesis.

[0004] In the breeding process, researchers prefer to use vertical resistance genes with obvious resistance and sensitivity separation. There are currently four physiological races of black shank, namely 0, 1, 2 and 3. Among them, races 0 and 1 are the prevalent races in most tobacco-producing countries including my country, with race 0 being the dominant race. In view of this, N. plumbaginifolia Black shank resistance No. 0 physiological subspecies Ph Genes have received more attention. Ph The flue-cured tobacco variety Coker371-Gold with the gene is the source of resistance. A series of Ph The molecular markers linked to the gene were successfully applied to the directional improvement of black shank resistance in the flue-cured tobacco varieties Honghua Dajinyuan and YNR3. Ph There are still many shortcomings in gene-linked molecular markers: (1) Among the markers developed by Bao et al. in 2019, most of them are repulsive markers (dominant markers with bands only in susceptible parents), which are difficult to use in backcross molecular breeding, or have a small polymorphic range and cannot be widely used in other varieties. Only BS-SCAR1 has a good actual use effect, but this marker is not consistent with Ph Gene co-segregation, there is a possibility of misjudgment if only this marker is used; (2) The series of co-dominant markers developed by the Yunnan Tobacco Agricultural Science Research Institute from 2017 to 2020 are all SSR (simple sequence repeat) markers. Currently, SSR markers are gradually being replaced by the new generation of SNP (single nucleotide polymorphism) markers, which can no longer meet the needs of molecular breeding for low-cost, high-throughput and automated genotype detection. Summary of the Invention

[0005] In view of this, the present invention has developed Ph SNP markers with more tightly linked genes are designed to solve the technical problem that existing molecular markers cannot meet the requirements of molecular breeding for black shank resistance.

[0006] In the first aspect, the present invention provides a method for treating tobacco black shank disease Ph The SNP marker combination closely linked to the gene includes SNP-2 and SNP-6, specifically: The nucleotide sequence of SNP-2 is shown in SEQ ID No. 1, and the polymorphic site is located at position 68 of the sequence shown in SEQ ID No. 1, and the polymorphism is T / C; The nucleotide sequence of SNP-6 is shown in SEQ ID No. 2, and the polymorphic site is located at position 431 of the sequence shown in SEQ ID No. 2, and the polymorphism is T / A.

[0007] Based on tobacco SSR markers and SNP variation analysis of 33 cultivated tobacco germplasm resources, this paper systematically elucidates the relationship between tobacco black shank resistance and SNP variation. Ph genetic N. plumbaginifolia Molecular characterization of chromosome segments, integrating existing Ph Genetic map of gene molecular markers, and then developed 6 PhSNP markers closely linked to genes; among them, SNP-2 and SNP-6 are located in Ph gene, and SNP-2 and SNP-6 are associated with Ph The genetic distance of the genes was calculated to be 0.49 cM, which showed a close linkage.

[0008] In a second aspect, the present invention provides a primer set for detecting the above-mentioned SNP markers. In some embodiments of the present invention, the primer set includes a primer pair having sequences as shown in SEQ ID No. 3-4 and a primer pair having sequences as shown in SEQ ID No. 5-6.

[0009] Detection products containing the above primer set also fall within the scope of protection of the present invention. It is understood that the detection products include but are not limited to detection reagents, kits or gene chips.

[0010] In a third aspect, the present invention provides the use of the above-mentioned SNP marker, primer set or detection product in any of the following: 1) Application in tobacco black shank resistance breeding; 2) Inspecting whether tobacco materials carry Ph In the application of genes, specifically, if the genotype of SNP-2 is detected to carry T and the genotype of SNP-6 is detected to carry A, it can be determined that the tobacco material to be tested carries Ph Gene.

[0011] In a fourth aspect, the present invention provides a method for cultivating a black shank-resistant tobacco line, comprising the following steps: S1. Will carry Ph Black shank resistance in tobacco and those without Ph The black shank-susceptible tobacco plants with the same gene were hybridized and then backcrossed; S2. Select an individual plant with a SNP-2 genotype of C / T, a SNP-6 genotype of T / A, and a phenotype similar to that of tobacco susceptible to black shank from the population obtained in step S1, hybridize the individual plant with tobacco susceptible to black shank, and continue to select an individual plant with a SNP-2 genotype of C / T, a SNP-6 genotype of T / A, and a phenotype similar to that of tobacco susceptible to black shank, and repeat the above steps until a target individual plant with a SNP-2 genotype of C / T, a SNP-6 genotype of T / A, and a phenotype no significantly different from that of tobacco susceptible to black shank is obtained; S3. Self-pollinate the target individual plants, and identify and obtain individual plants with a SNP-2 genotype of T / T and a SNP-6 genotype of A / A, which are new tobacco lines resistant to black shank.

[0012] Preferably, in the above method, carrying Ph The tobacco strain with the black shank resistance gene is Coker371-Gold.

[0013] Preferably, in the above method, no Ph The tobacco varieties susceptible to the black shank disease gene are any one of Zhongyan Texiang 301, Beinhart 1000-1, Florida 301, Coker 86, Dixie Bright 101, Hicks, K346, NC82, NC89, Speight G-28, Speight G-80, Jingyehuang, Yanyan 97, K326, Cuibi No. 1, Honghua Dajinyuan, Longjiang 911, Zhongyan 101, Zhongyan 100, Te 2, Te 3, Te 4, Te 5, Te 8, Te 10, Te 13, Te 18, Texiang Zhushayan, Samsun, TN 90, Dabaijin 599, and Gexin No. 3.

[0014] In the scheme of the present invention, SNP-2 and SNP-6 genotype detection can be carried out with reference to existing technologies, specifically by extracting DNA from the tobacco material to be tested as a template, amplifying using a primer pair with a sequence such as SEQ ID No. 3-4 and a primer pair with a sequence such as SEQ ID No. 5-6, and analyzing the amplified product (such as sequencing) to obtain the genotype result.

[0015] Compared with the prior art, the present invention has the following beneficial effects: The present invention develops Ph Two bilateral specific SNP markers closely linked to genes, compared with the prior art Ph Gene-linked molecular markers can better meet the needs of molecular breeding for low-cost, high-throughput and automated genotype detection.

[0016] The present invention utilizes tobacco SSR markers and SNP variation data based on whole genome resequencing to identify the carriers of Ph genetic N. plumbaginifolia The molecular characteristics of chromosome segments were systematically and comprehensively described, and the Ph The flue-cured tobacco varieties Coker371-Gold and Coker371-Gold that carry the black shank resistance gene Ph The black shank disease-susceptible flue-cured tobacco variety Zhongyan Texiang 301 was hybridized with the gene of Ph Integration of molecular markers linked to genes provides a basis for the development of other Ph The molecular markers with tightly linked genes provide new ideas and also offer technical support for better utilization of this source of black shank disease resistance in the future. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] To more clearly illustrate the technical solution of the present invention, the following briefly introduces the drawings used in the present invention. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be derived from these drawings without inventive effort.

[0018] Figure 1 The results of SSR analysis of the end of the 20th linkage group of Coker371-Gold in Example 1 of the present invention are shown in Figure 1, where A is the SSR polymorphism analysis between Zhongyan Texiang 301 and Coker371-Gold, B is the SSR markers and their positions at the end of the 20th linkage group, and C is the SSR markers at the end of the 20th linkage group. NtaSR1 and the physical location in the Yunyan87 genome; Figure 2 This is a chromosomal distribution diagram of the number and average spacing of Coker371-Gold-specific SNPs in Example 1 of the present invention, where A is the chromosomal distribution of the number of Coker371-Gold-specific SNPs, and B is the average spacing of the specific SNPs on each chromosome of Coker371-Gold; Figure 3 This is a comparison chart of the allelic SNP deletion rates of Coker371-Gold and other 32 cultivated tobacco germplasm resources in the 0-30 Mb interval of chromosome Yunyan 87HIC_ASM_14 in Example 1 of the present invention; Figure 4 In Example 1 of the present invention, Ph Gene-linked molecular markers and their genetic maps, where A is 8 known Ph Gene-linked molecular markers and their genetic maps, B is a newly developed Ph Gene-linked SNP molecular markers and their physical maps; recombinant plants indicate the number of plants in which the phenotype and genotype are recombined; Figure 5 The embodiment 2 of the present invention carries Ph Comparison of the resistance performance of the new Zhongyan Texiang 301 strain (left) and the original Zhongyan Texiang 301 (right) after inoculation with black shank race 0; Figure 6 The embodiment 2 of the present invention carries Ph Comparison of the field performance of the new Zhongyan Texiang 301 strain (left) and the original Zhongyan Texiang 301 (right) with the same gene in Feixian County, Shandong Province. DETAILED DESCRIPTION

[0019] The following embodiments of the technical solution of the present invention will be described in detail with reference to the accompanying drawings. The following embodiments are only used to more clearly illustrate the technical solution of the present invention and are therefore only examples and are not intended to limit the scope of protection of the present invention.

[0020] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention pertains; the terms used herein are for the purpose of describing specific implementations only and are not intended to limit the present invention; the term "include" and any variations thereof herein are intended to cover non-exclusive inclusions.

[0021] In order to solve the problem that the existing technology lacks black leg resistance genes Ph The present invention is based on tobacco SSR markers and SNP variation analysis of 33 cultivated tobacco germplasm resources, and systematically clarifies the presence of SNPs that carry resistance to tobacco black shank disease. Ph genetic N. plumbaginifolia Molecular characterization of chromosome segments, integrating existing Ph Genetic map of gene molecular markers, and further developed Ph The two bilateral specific SNP markers with tightly linked genes meet the current work needs of tobacco disease resistance molecular breeding.

[0022] The embodiment of the present invention provides a method for preventing tobacco from black shank disease Ph The SNP markers that are closely linked to genes are: The nucleotide sequence of SNP-2 is shown in SEQ ID No. 1, and the polymorphic site is located at position 68 of the sequence shown in SEQ ID No. 1, and the polymorphism is T / C; The nucleotide sequence of SNP-6 is shown in SEQ ID No. 2, and the polymorphic site is located at position 431 of the sequence shown in SEQ ID No. 2, and the polymorphism is T / A.

[0023] The present invention provides a primer set for detecting the above-mentioned SNP markers, specifically: The primer pair whose sequences are shown in SEQ ID No. 3-4 is used to detect SNP-2; The primer pair with the sequence shown as SEQ ID No. 5-6 is used to detect SNP-6.

[0024] The present invention also provides a method for cultivating a black shank-resistant tobacco line, comprising the following steps: S1. Will carry Ph Black shank resistance in tobacco and those without Ph The black shank-susceptible tobacco plants with the same gene were hybridized and then backcrossed; S2. Select an individual plant with a SNP-2 genotype of C / T, a SNP-6 genotype of T / A, and a phenotype similar to that of tobacco susceptible to black shank from the population obtained in step S1, hybridize the individual plant with tobacco susceptible to black shank, and continue to select an individual plant with a SNP-2 genotype of C / T, a SNP-6 genotype of T / A, and a phenotype similar to that of tobacco susceptible to black shank, and repeat the above steps until a target individual plant with a SNP-2 genotype of C / T, a SNP-6 genotype of T / A, and a phenotype no significantly different from that of tobacco susceptible to black shank is obtained; S3. Self-pollinate the target individual plants, and identify and obtain individual plants with SNP-2 genotype of T / T and SNP-6 genotype of A / A, which are new tobacco varieties resistant to black shank.

[0025] In one embodiment of the present invention, Ph The tobacco with the gene for black shank resistance is Coker371-Gold, which does not carry Ph The tobacco variety susceptible to black shank disease is Zhongyan Texiang 301; the resulting new tobacco line has excellent black shank disease resistance, and its phenotype after field planting has no significant difference from Zhongyan Texiang 301.

[0026] Some specific examples are listed below. It should be noted that the examples described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention. Where specific techniques or conditions are not specified in the examples, the techniques or conditions described in the literature in this field or the product specifications were used. Where the manufacturers of the reagents or instruments used are not specified, they are all conventional products that can be purchased commercially.

[0027] Example 1 The present invention utilizes tobacco SSR markers and SNP variation data based on whole genome resequencing to identify the carriers of Ph genetic N. plumbaginifolia A systematic and comprehensive analysis of the molecular characteristics of chromosome segments was conducted, and the Ph The flue-cured tobacco varieties Coker371-Gold and those without the gene for black shank resistance Ph The black shank disease-susceptible flue-cured tobacco variety Zhongyan Texiang 301 was hybridized with the gene of Ph The molecular markers linked to genes were integrated to develop Ph SNP markers that are tightly linked to genes. Specific experiments include the following: (1) Carry Ph genetic N. plumbaginifolia SSR molecular marker analysis of chromosome segments.

[0028] Refer to Bao et al. (BAO YG, DING N, QIN QL, et al. Genetic mapping of the Ph gene conferring disease resistance to black shank in tobacco. MolecularBreeding, 2019, 39(9): 122) Right Ph The results of gene location were based on the tobacco SSR high-density linkage map published by Bindler et al. (BINDLER G, PLIESKE J, BAKAHER N, et al. A high density genetic mapof tobacco ( Nicotiana tabacum L.) obtained from large-scale microsatellitemarker development. Theoretical and Applied Genetics, 2011, 123: 219-230). Twenty-two SSR markers evenly distributed from the end to 70 cM of linkage group 20 (LG20) were selected. PCR and polyacrylamide gel electrophoresis were performed on Zhongyantexiang 301 and Coker371-Gold, and a total of 19 stably amplified SSR markers with clear bands were obtained. Polymorphism analysis showed that 9 SSR markers from the end to 27.816 cM were polymorphic between Zhongyan Texiang 301 and Coker371-Gold, but only 3 of them were co-dominant markers (i.e., amplification products were generated in both Zhongyan Texiang 301 and Coker371-Gold, and the bands showed length polymorphism), while the remaining 6 were dominant markers of Zhongyan Texiang 301 (i.e., amplification products were generated only in Zhongyan Texiang 301, but not in Coker371-Gold). However, 10 SSR markers from 39.192 cM to 63.237 cM amplified products in both Zhongyan Texiang 301 and Coker371-Gold, but none of them showed length polymorphism ( Figure 1 A and B).

[0029] In the evolutionary history of Nicotiana, due to N. plumbaginifolia and cultivated tobacco and its two ancestral species N. sylvestris and N. tomentosiformis The differentiation has lasted for millions of years, and the genomes have undergone drastic changes and accumulated a huge amount of differential sequences. Ph genetic N. plumbaginifolia The chromosome fragment may have been transferred into the cultivated tobacco genome through terminal translocation, and the translocation site is located between 27.816 cM and 39.192 cM on the 20th linkage group of tobacco SSR ( Figure 1 B), corresponding to the range of 13.029Mb to 19.547Mb of chromosome HIC_ASM_14 in the Yunyan 87 genome, and the latest published NtaSR1 Genomes (WANG JB, ZHANG QL, TUNG J, et al. High-quality assembled and annotated genomes of Nicotiana tabacum and Nicotiana benthamiana reveal chromosome evolution and changes indefense arsenals. Molecular Plant, 2024, 17(3): 423-437) Chromosome 19 (Chr19) between 150.695 Mb and 141.160 Mb ( Figure 1 C). In addition, based on the three co-dominant SSR markers on this fragment, it was inferred that this fragment may have certain homology with the replaced cultivated tobacco chromosome fragment.

[0030] (2) Carry Ph genetic N. plumbaginifolia SNP molecular marker analysis of chromosome segments.

[0031] Whole genome resequencing was performed on 33 different types of cultivated tobacco germplasm resources, including Zhongyan Texiang 301 and Coker371-Gold. Among them, the 33 cultivated tobacco germplasm resources are Coker371-Gold, Zhongyan Texiang 301, Beinhart 1000-1, Florida 301, Coker 86, Dixie Bright 101, Hicks, K346, NC82, NC89, Speight G-28, Speight G-80, Jingyehuang, Yanyan 97, K326, Cuibi No. 1, Honghua Dajinyuan, Longjiang 911, Zhongyan 101, Zhongyan 100, Te 2, Te 3, Te 4, Te 5, Te 8, Te 10, Te 13, Te 18, Texiang Zhushayan, Samsun, TN 90, Dabaijin 599 and Gexin 3; for detailed information on these germplasm resources and SNP variation analysis methods, please refer to the document "Construction and Application of Specific SNP Fingerprint Map of Zhongyan Texiang 301" (Chinese Tobacco Science, 2024, 45(5): 8-16).

[0032] Based on the SNP variation analysis data, we first conducted a statistical analysis of the 2894 specific SNPs in Coker371-Gold that were different from the other 32 germplasm resources. The results showed that nearly half of the specific SNPs were concentrated on chromosome HIC_ASM_14 (1282, accounting for 44.30%), and the number of SNPs on the remaining chromosomes ranged from 26 to 200, which was significantly different from HIC_ASM_14 ( Figure 2 A). The average spacing of specific SNPs also shows that the density of specific SNPs on HIC_ASM_14 is significantly higher than that on other chromosomes ( Figure 2 B). We further conducted a statistical analysis of the distribution of specific SNPs on chromosome HIC_ASM_14. The results are as follows: Figure 2 As shown in A, the vast majority of specific SNPs are concentrated in the chromosome segment of 0-18.54 Mb (i.e., HIC_ASM_14U, accounting for 96.57%); the average spacing of specific SNPs in this segment is also highly similar to that of the aforementioned HIC_ASM_14 ( Figure 2 B). The remaining segment (HIC_ASM_14D) has no significant difference from other chromosomes ( Figure 2 A, 2B). In summary, it is speculated that HIC_ASM_14U may be a carrier of Ph genetic N. plumbaginifolia The ends of the chromosome fragment also coincided with the translocation interval inferred by the aforementioned SSR analysis.

[0033] The missing allele SNP rate of 35,379 SNP variants in the 0-30 Mb interval on chromosome HIC_ASM_14 of all 33 germplasm resources, including Coker371-Gold, was statistically analyzed in sections. The results showed that, except for the 0-1 Mb interval, the missing allele SNP rate of Coker371-Gold in the 1-18.54 Mb interval was between 0.32 and 0.59, which was significantly higher than that of the other 32 germplasm resources (0.00-0.02). However, the missing allele SNP rate of Coker371-Gold in the 18.54-30 Mb interval was not significantly different from that of the other germplasm resources ( Figure 3 The above results show that Ph genetic N. plumbaginifolia The chromosome segment had a good homology with the replaced chromosome segment of cultivated tobacco, and the translocation site was located near 18.54 Mb of chromosome Yunyan 87HIC_ASM_14.

[0034] (3) Existing Ph Integrative mapping of gene-linked molecular markers.

[0035] Black shank race 0 was activated and propagated according to the methods of GB / T 23224-2008 (Identification of Disease Resistance of Tobacco Varieties) and Guo Xuan et al. (Genetic Analysis of Resistance of Cigar Tobacco Beinhart 1000-1 to Black Shank Race 0, Chinese Tobacco Science, 2017, 38(2): 56-62). Black shank race 0 was inoculated into Coker 371-Gold, Zhongyan Texiang 301, and the BC1F1 populations generated by hybridization and backcrossing of the two varieties when the tobacco seedlings had 5-6 true leaves. Black shank resistance of each test material was identified according to GB / T 23222-2008 (Grading and Survey Methods for Tobacco Diseases and Insect Pests). Every 3 days after inoculation, the disease status of each individual plant was tracked and graded according to the severity of the disease until the disease stopped developing. After the disease survey was completed, grades 0-1 were classified as resistant, and grades 7-9 were classified as susceptible. The survey results showed that a total of 113 disease-resistant plants and 90 disease-susceptible plants were identified. χ 2 ) test showed that the resistance and sensitivity segregation were consistent with dominant single gene inheritance (Table 1).

[0036] Table 1 Segregation and statistics of black shank resistance in the BC1F1 population derived from the hybridization of Coker371-Gold and Zhongyantexiang 301

[0037] Note: “-” indicates missing data.

[0038] By consulting and collecting 5 known and Ph The gene-linked molecular markers, plus the three co-dominant SSR markers screened in step (1), resulted in a total of eight molecular markers that can be used for backcross breeding, as shown in Table 2.

[0039] Table 2 8 known and Ph Information on molecular markers linked to genes

[0040] Note: “-” indicates missing data.

[0041] The BC1F1 population was genotyped using the markers in Table 2, and the genotypes were analyzed using QTLIciMapping 4.2. Ph The results show that the genetic linkage map of the gene was drawn. Figure 4 As shown in A, except InDel0617 and Ph Except for the co-segregation of genes, the other markers are located on the same side, Ph The genetic distances of the genes were 0.49, 0.99 and 1.48 cM, respectively, which preliminarily completed the existing Ph Integrative mapping of gene-linked molecular markers.

[0042] Referring to the method of Zhang Lei et al. (Comparison of two methods for recovering small DNA fragments from non-denaturing polyacrylamide gel, Chinese Bulletin of Agricultural Science, 2011, 27 (7): 227-230.), the target DNA bands of the PCR products of the remaining seven linked SSR markers except BS-SCAR1 (the PCR product of this marker was analyzed by agarose gel electrophoresis) were separated from the polyacrylamide gel. After being crushed with a pipette tip, an appropriate amount of ddH2O was added and boiled for 15 min. The supernatant obtained after centrifugation at 12000 r / min for 5 min was used as a template for secondary PCR using the original SSR primers. The PCR products were then detected by polyacrylamide gel electrophoresis and conventionally sequenced. Then, they were compared with Yunyan 87 and NtaSR1 Genome alignment was used to obtain the precise physical location of the SSRs in the genome. Analysis of the chromosomal locations of these linked markers revealed that their relative positions on the physical map were consistent with those on the genetic map, further demonstrating the reliability of the genetic linkage map.

[0043] (4) with Ph Development of SNP markers closely linked to genes.

[0044] To further clarify Ph The specific SNPs of Coker371-Gold were collected in the positioning interval of marker Scf_30K and InDel0617, and in the interval 3 Mb downstream of InDel0617. With the help of TBtools software and PrimerPremier 5.0 software, new linkage molecular markers were developed. Six pairs of polymorphic SNP markers that can be stably amplified were successfully developed, as shown in Tables 3 and 4.

[0045] Table 3 Location and variation information of 6 pairs of Coker371-Gold specific SNPs

[0046] Table 4 Information of 6 pairs of Coker371-Gold specific SNP primers

[0047] These SNP markers are used to identify the genotype of the BC1F1 population (it can be understood that the BC1F1 population has only two genotypes, namely, the donor parent / recurrent parent heterozygous type and the recurrent parent / recurrent parent homozygous type; when the markers SNP1-6 are used to detect the individual plants of the above-mentioned BC1F1 population, if the genotype of an individual plant at the target SNP site is heterozygous, namely, C / T, T / C, A / C, T / A, A / T, A / T respectively, then the marker genotype of the individual plant is the donor parent / recurrent parent heterozygous type; if the genotype of an individual plant at the target SNP site is homozygous, namely, T / T, C / C, C / C, A / A, T / T, T / T respectively, then the marker genotype of the individual plant is the recurrent parent / recurrent parent homozygous type. The use of SNP markers and their primers to identify genotypes can refer to existing methods, which will not be described in detail in this example), and based on the differences in the recombinant individual plants and the trend of reduction, Ph The gene is located between SNP-2 and SNP-6. The corresponding interval size of this location interval on chromosome HIC_ASM_14 of Yunyan 87 is about 6.60Mb. NtaSR1 The corresponding interval size on chromosome Chr19 is approximately 12.89 Mb ( Figure 4 B). SNP-2 and SNP-6 are associated with Ph The genetic distance of the genes was calculated to be 0.49 cM, which means they are all tightly linked (≤0.5 cM). They are all Coker371-Gold specific SNPs, so they can be effectively used in many varieties. Ph Gene molecular markers assist in improving breeding.

[0048] The above and Ph The detailed sequence information of SNP markers SNP-2 and SNP-6, which are closely linked to the gene, are shown in Sequence 1 (SEQ ID No. 1) and Sequence 2 (SEQ ID No. 2), respectively. Ph In the genome of Zhongyan Texiang 301 and 31 other types of cultivated tobacco germplasm resources, the 68th position of sequence 1 is C and the 431st position of sequence 2 is T; Ph In the Coker371-Gold genome of the gene, the 68th position of sequence 1 is T and the 431st position of sequence 2 is A.

[0049] Sequence 1 is as follows: TCACTAAAGCTACAAGGCACACACATATATGCAACACTTGGTTTATGTTACATAACACCTCTACAAA(C / T)TGTAAATACCAAAAATCAAGTTATACATTTCACCGTTTGAATATATCTATATAAGCTGTGTGGGTTTCTGTTTTTATTTTTTGCTTCAAATGAGCAGCAGAATGAAGAAG AATTTGGACATGAGCGTAGACGTCGGAATCTCAGTGCAATACAAGGGTGGTGAATAATTTTATTCGTTTTTTATCGTGTGAAATCATAAGCCATATTTATTACTTTGGAAACCATTTTTGGAAAGCATAAATTAGCTGAAAGGAAAAACTTTTCATTAAATAT GAATGTAATCCTTGGTTTGAAC (SEQID No.1).

[0050] Sequence 2 is as follows: TAGAAACGTAGAAACAGGAAT TTCCTTGTAAGGTTGCTTATTGACTTGCATTAAATTTTGACATCTATCTAATTTGATAATTAACCAAGCATGGCTTGGCTTTTACACATCACAATTATCCAAAACAAGAATTATATCTTATGTAATGCCCTCAATTTTAATGATTCTTTTATAGTGTTGCTTACTTGTACAATGTGTTATGACTCGACACAATGGGATAATCATGTCATAATTAA TTACTCAAAATGACTTGTACATTGTTTTCATTAACAAGGATATTGAGGATACATATGTACAAGTCATTTTGAGTAATTATAGCCTATCATCAACTAGTTATAATATACTCGTAATATTGTATAAAGAGGAATAACAACAACAACAACAACCCAGTGTAATAAAATTTTGATATTACAAAATATTTTGA(T / A)ATCCTTGCAACAATTTT GCTATTTTAGTTACCTATTTCTA (SEQ ID No. 2).

[0051] Example 2 This example verifies that SNP markers SNP-2 and SNP-6 are Ph The effectiveness of gene molecular markers in assisted breeding is tested in the following experiments: From the BC1F1 population ((Zhongyan Texiang 301 × Coker371-Gold) × Zhongyan Texiang 301), generated by hybridization and backcrossing between Coker371-Gold and Zhongyan Texiang 301, individual plants with a C / T SNP-2 genotype and a T / A SNP-6 genotype, similar in appearance to Zhongyan Texiang 301, were selected and crossed with Zhongyan Texiang 301 to create a BC2F1 population. Individual plants with a C / T SNP-2 genotype and a T / A SNP-6 genotype, similar in appearance to Zhongyan Texiang 301, were further identified from the BC2F1 population and crossed with Zhongyan Texiang 301. This process was repeated until a BC5F1 population was obtained with a C / T SNP-2 genotype and a T / A SNP-6 genotype, similar in appearance to Zhongyan Texiang 301. These plants were then self-pollinated to create a BC5F2 population. From the BC5F2 population, a single plant with the SNP-2 genotype of T / T and the SNP-6 genotype of A / A, which had no significant difference in appearance from Zhongyan Texiang 301, was identified as a carrier of Ph The new strain of China Tobacco Special Fragrance 301 with genes.

[0052] Referring to the method in step (3) of Example 1, the above-mentioned Ph The results showed that the new strain of Zhongyan Texiang 301 carrying the gene and the Zhongyan Texiang 301 inoculated with black leg disease No. 0 physiological species were investigated after the disease was fully developed. Ph The new strain of Zhongyan Texiang 301 with the gene showed no obvious symptoms of the disease, while Zhongyan Texiang 301 had extremely severe disease ( Figure 5 ). In addition, during the blooming period in the field, carry Ph There is no significant difference in appearance between the new strain of Zhongyan Special Fragrance 301 and Zhongyan Special Fragrance 301 ( Figure 6 The above results fully demonstrate that SNP-2 and SNP-6 can be effectively used Ph Molecular markers of genes assist in breeding improvement.

[0053] In summary, the present invention systematically elucidates the relationship between tobacco black shank resistance and SNP variation based on tobacco SSR markers and 33 cultivated tobacco germplasm resources. Ph genetic N. plumbaginifolia Molecular characterization of chromosome segments, integrating existing Ph Genetic map of gene molecular markers; moreover, the Ph The two bilaterally specific SNP markers with tightly linked genes can well meet the current needs of tobacco disease resistance molecular breeding.

[0054] It should be noted that the present invention is not limited to the above-mentioned embodiments. The above-mentioned embodiments are merely examples, and any embodiments having substantially the same structure and effect as the technical concept within the scope of the technical solution of the present invention are all included in the technical scope of the present invention. In addition, without departing from the scope of the present invention, other embodiments that can be conceived by those skilled in the art and that combine some of the constituent elements in the embodiments are also included in the scope of the present invention.

Claims

1. Fight against black shank disease in tobacco Ph SNP markers that are tightly linked to genes are characterized by: Including SNP-2 and SNP-6; the nucleotide sequence of SNP-2 is shown in SEQ ID No.1, and the polymorphic site is located at the 68th position of the sequence shown in SEQ ID No.1; the nucleotide sequence of SNP-6 is shown in SEQ ID No.2, and the polymorphic site is located at the 431st position of the sequence shown in SEQ ID No.

2.

2. A primer set for detecting the SNP marker according to claim 1.

3. The primer set according to claim 2, characterized in that The primers include a primer pair having a sequence as shown in SEQ ID No. 3-4 and a primer pair having a sequence as shown in SEQ ID No. 5-6.

4. A detection product comprising the primer set according to claim 2.

5. Use of the SNP marker according to claim 1, the primer set according to claim 2, or the detection product according to claim 4 in tobacco black shank resistance breeding.

6. The SNP marker according to claim 1, the primer set according to claim 2 or the detection product according to claim 4 is used to detect whether tobacco materials carry Ph Application in genes.

7. The use according to claim 6, characterized in that When the genotype of SNP-2 carries T and the genotype of SNP-6 carries A, the tobacco material to be tested carries Ph Gene.

8. A method for breeding black shank resistant tobacco lines, characterized in that: The following steps are involved: S1. Will carry Ph Black shank resistance in tobacco and those without Ph The black shank-susceptible tobacco plants with the same gene were hybridized and then backcrossed; S2. Selecting individual plants with a SNP-2 genotype of C / T, a SNP-6 genotype of T / A, and a phenotype similar to that of the black shank-susceptible tobacco from the population obtained in step S1, hybridizing the individual plants with the black shank-susceptible tobacco, and continuing to select individual plants with a SNP-2 genotype of C / T, a SNP-6 genotype of T / A, and a phenotype similar to that of the black shank-susceptible tobacco, and repeating the above steps until a target individual plant with a SNP-2 genotype of C / T, a SNP-6 genotype of T / A, and a phenotype no significantly different from that of the black shank-susceptible tobacco is obtained; S3. Self-pollinate the target individual plants, and identify and obtain individual plants with SNP-2 genotype of T / T and SNP-6 genotype of A / A, which are new tobacco varieties resistant to black shank.

9. The method according to claim 8, characterized in that The carrying Ph The tobacco strain with the black shank resistance gene is Coker371-Gold.

10. The method according to claim 8, characterized in that The said does not carry Ph The tobacco varieties susceptible to the black shank disease gene are any one of Zhongyan Texiang 301, Beinhart 1000-1, Florida 301, Coker 86, Dixie Bright 101, Hicks, K346, NC82, NC89, Speight G-28, Speight G-80, Jingyehuang, Yanyan 97, K326, Cuibi No. 1, Honghua Dajinyuan, Longjiang 911, Zhongyan 101, Zhongyan 100, Te 2, Te 3, Te 4, Te 5, Te 8, Te 10, Te 13, Te 18, Texiang Zhushayan, Samsun, TN90, Dabaijin 599, and Gexin No. 3.

Images