Car-t constructs comprising novel CD19 binding agents in combination with il18 and methods of use thereof

Abstract

The present disclosure relates to immune cells comprising one or more vectors comprising a nucleic acid sequence encoding a chimeric antigen receptor having specificity for CD19 and a nucleic acid sequence encoding a T cell priming enhancer (e.g., IL-18); a composition comprising the T cell; and methods of producing and / or using the T cells for treating diseases associated with CD19 expression.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application No. 63 / 417,216, filed on October 18, 2022, and U.S. Provisional Application No. 63 / 426,944, filed on November 21, 2022, the contents of which are hereby incorporated by reference in their entirety for all purposes. Technical Field

[0002] The present disclosure generally relates to T cells engineered to express a chimeric antigen receptor (CAR) and interleukin-18 to treat diseases associated with expression of cluster of differentiation 19 protein (CD19). Background Art

[0003] The latest progress using autologous T cell (CART) therapy modified by chimeric antigen receptor (CAR) (which relies on redirecting T cells to suitable cell surface molecules on cancer cells (such as B cell malignancies)) has shown promising results in treating B cell malignancies and other cancers using the power of the immune system. Sadelain et al., Cancer 1907393 1Discovery 3:388-398 (2013). The clinical results of mouse-derived CART19 (i.e., "CTL019") show the prospect of establishing complete remission in patients with chronic lymphocytic leukemia (CLL) and childhood acute lymphoblastic leukemia (ALL). Although various CD19 CAR T cell therapies have been successful in the clinic, the therapeutic index of these therapies is still very high due to immunogenicity issues, toxicity associated with CAR T cell infusion, and tumor recurrence.

[0004] Therefore, there is an urgent need in the art for new methods that can address or alleviate the harmful side effects of CAR T cell therapy and allow for more effective, safe and efficient adoptive immunotherapy. The present disclosure addresses this need. Summary of the Invention

[0005] An aspect of the present disclosure provides a vector comprising: (a) a first polynucleotide comprising a constitutive promoter operably connected to a nucleic acid encoding a chimeric antigen receptor (CAR), wherein the CAR comprises a single-chain antibody or a single-chain antibody fragment containing an anti-CD19 binding domain, a transmembrane domain, a costimulatory and intracellular signaling domain; and (b) a second polynucleotide comprising a nucleic acid encoding a polypeptide or a functional derivative thereof that enhances immune cell function. In some embodiments, the first polynucleotide is operably connected to the second polypeptide via a linker peptide.

[0006] In some embodiments, the polypeptide or functional derivative thereof that enhances immune cell function is selected from cytokines, interferons, chemokines, antibodies or antibody fragments, checkpoint inhibitor antagonists, dominant negative receptors, switch receptors, and combinations thereof.

[0007] In some embodiments, the polypeptide or its functional derivative that enhances immune cell function is: (a) a chemokine, a chemokine receptor, a cytokine, a cytokine receptor, and a combination thereof; (b) a cytokine selected from the following: interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-11 (IL-11), interleukin-12 (IL-12), interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-18 (IL-18), interleukin-18 receptor (IL-18R), interleukin-21 (IL-21), granulocyte macrophage colony stimulating factor, alpha, beta or gamma interferon, erythropoietin, and a combination thereof; or (c) a chemokine selected from the following: CCL21, CCL19, or a combination thereof.

[0008] In some embodiments, the polypeptide or functional derivative thereof that enhances immune cell function further comprises a leader sequence selected from the group consisting of an IL-2 signal sequence, an IL-12 signal sequence, a kappa leader sequence, a CD8 leader sequence, or any equivalent thereof.

[0009] In some embodiments, the polypeptide or functional derivative thereof that enhances immune cell function comprises an IL-18 polypeptide, or a polypeptide having the amino acid sequence of SEQ ID NO: 105, SEQ ID NO: 215, SEQ ID NO: 106, SEQ ID NO: 107, or an amino acid sequence that is about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to SEQ ID NO: 105, SEQ ID NO: 215, SEQ ID NO: 106 or SEQ ID NO: 107.

[0010] In some embodiments, the IL-18 polypeptide further comprises a CD8 leader sequence or the amino acid sequence of SEQ ID NO: 25, or an amino acid sequence about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 25.

[0011] In some embodiments, the IL-18 polypeptide comprises a mutation at a position selected from positions 42, 74, 85, 87, 89, 104, 112, 10, 132, 143, 149, 163, and 189 of SEQ ID NO: 107.

[0012] In some embodiments, the IL-18 polypeptide comprises E42A; E42K; K89A; E42A and K89A; E42K and K89A; E42A and C74S; E42A, C74S and K89A; C74S and K89A; C74S, C112S and C112S; E42A, C74S, C112S and C112S; E42A, K89A, C74S, C112S and C112S of SEQ ID NO:7.

[0013] In some embodiments, the IL-18 polypeptide: (a) exhibits at least about a 2-fold increase in activity when compared to WT IL-18; (b) is resistant to inhibition by IL18BP when compared to WT IL-18; and / or (c) requires at least about a 4-fold higher concentration of IL-18BP for neutralization when compared to WT IL-18.

[0014] In some embodiments, the vector is selected from DNA, RNA, plasmid, lentiviral vector, adenoviral vector or retroviral vector. In some embodiments, the vector is an in vitro transcribed vector.

[0015] In some embodiments of the vectors disclosed herein, the constitutive promoter comprises a promoter selected from the group consisting of: EF-1α promoter, PGK-1 promoter, truncated PGK-1 promoter, UBC promoter, CMV promoter, CAGG promoter, and SV40 promoter. In some embodiments, the constitutive promoter: (a) is EF-1 promoter; or (b) comprises a sequence of SEQ ID NO: 101.

[0016] In some embodiments, the vector further comprises a rev response element (RRE), a poly(A) tail, a 3'UTR, a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) and / or a cPPT sequence. In this embodiment, the WPRE comprises the sequence of SEQ ID NO: 100.

[0017] In some embodiments, the anti-CD19 binding domain comprises: (a) a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1) of SEQ ID NO: 1, a light chain complementary determining region 2 (LC CDR2) of SEQ ID NO: 2, and a light chain complementary determining region 3 (LC CDR3) of SEQ ID NO: 3; and a heavy chain variable domain comprising a heavy chain complementary determining region 1 (HC CDR1) of SEQ ID NO: 4, a heavy chain complementary determining region 2 (HC CDR2) of SEQ ID NO: 5, and a heavy chain complementary determining region 3 (HC CDR3) of SEQ ID NO: 6; or (b) a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1) of SEQ ID NO: 193, a light chain complementary determining region 2 (LC CDR2) of SEQ ID NO: 194, and a light chain complementary determining region 3 (LC CDR3) of SEQ ID NO: 195. CDR3); and a heavy chain variable domain comprising a heavy chain complementary determining region 1 (HC CDR1) of SEQ ID NO: 196, a heavy chain complementary determining region 2 (HC CDR2) of SEQ ID NO: 197, and a heavy chain complementary determining region 3 (HC CDR3) of SEQ ID NO: 198; or (c) a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3) disclosed in Table 2; and a heavy chain variable domain comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3) disclosed in Table 2.

[0018] In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO: 7 or 199, or an amino acid sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 7 or 199. In some embodiments, the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 8 or 200, or an amino acid sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 8 or 200. In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO: 7 and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 8. In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO: 199 and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 200.

[0019] In some embodiments, the CD19 binding domain is a scFv. In some embodiments, the anti-CD19 binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 146, or a sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146.

[0020] In some embodiments, the anti-CD 19 binding domain comprises: (a) a nucleic acid sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, and SEQ ID NO: 216; or (b) a nucleic acid sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, or SEQ ID NO: 216. NO:216 has a sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical.

[0021] In some embodiments, the anti-CD 19 binding domain comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, and SEQ ID NO: 216, or (b) a nucleic acid sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, and SEQ ID NO: 216. NO:120, SEQ ID NO:225 or SEQ ID NO:216 having a sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical.

[0022] In some embodiments, the transmembrane domain comprises a transmembrane domain of a protein selected from the group consisting of the alpha, beta, or zeta chain of a T cell receptor, CD2, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9.

[0023] In some embodiments, the transmembrane domain comprises an amino acid sequence selected from SEQ ID NO: 29, 31, or 33, or an amino acid sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 29, 31, or 33. In some embodiments, the transmembrane domain comprises a nucleic acid sequence selected from SEQ ID NO: 30, SEQ ID NO: 32, or SEQ ID NO: 34, or a nucleic acid sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 30, 32, or 34. In some embodiments, the transmembrane domain comprises a CD8 transmembrane domain and / or an amino acid sequence of SEQ ID NO:29, or an amino acid sequence that is about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO:29.

[0024] In some embodiments, the transmembrane domain comprises the nucleic acid sequence of SEQ ID NO:30, or a nucleic acid sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO:30.

[0025] In some embodiments, the encoded anti-CD19 binding domain is connected to the transmembrane domain by a hinge region. In some embodiments, the hinge region: (a) is derived from a protein selected from the group consisting of an Fc fragment of an antibody, a hinge region of an antibody, a CH2 region of an antibody, a CH3 region of an antibody, an artificial spacer sequence, an IgG hinge, a CD8 hinge, and any combination thereof; or (b) comprises the amino acid sequence of SEQ ID NO: 27 or SEQ ID NO: 35, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 27 or 35.

[0026] In some embodiments, the hinge region comprises a CD8 hinge region and / or an amino acid sequence of SEQ ID NO: 27, or an amino acid sequence that is about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 27. In some embodiments, the hinge region comprises a nucleic acid sequence selected from SEQ ID NO: 28 or SEQ ID NO: 36, or a nucleic acid sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 28 or 36.

[0027] In some embodiments of the vectors disclosed herein, the costimulatory domain of the CAR is a functional signaling domain of a protein selected from the group consisting of: TNFR superfamily members, OX40 (CD134), CD2, CD5, CD7, CD27, CD28, CD30, CD40, PD-1, CD8, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD11a, CD18, ICOS (CD278), LIGHT, NKG2C, B7-H3, a ligand that specifically binds to CD83, DAP10, DAP12, Lck, Fas, and 4-1BB (CD137). In some embodiments, the costimulatory domain comprises an amino acid sequence selected from SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:46, SEQ ID NO:48, or SEQ ID NO:50, or an amino acid sequence that is about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO:37, 39, 41, 43, 46, 48, or 50. In some embodiments, the costimulatory domain comprises a nucleic acid sequence selected from SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:47, or SEQ ID NO:49, or a nucleic acid sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO:38, 40, 42, 44, 45, 47, or 49.

[0028] In some embodiments of the vectors disclosed herein, the intracellular signaling domain of the CAR comprises a signaling domain of a protein selected from the group consisting of CD3ζ, FcγRIII, FcεRI, the cytoplasmic tail of an Fc receptor, a cytoplasmic receptor with an immunoreceptor tyrosine-based activation motif (ITAM), TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d.

[0029] In some embodiments, the intracellular signaling domain comprises the intracellular signaling domain of CD3 zeta, the amino acid sequence of SEQ ID NO: 52 or 54, or an amino acid sequence that is about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 52 or 54. In some embodiments, the intracellular signaling domain comprises the nucleic acid sequence of SEQ ID NO: 53 or 55, or a nucleic acid sequence that is about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 53 or 55. In some embodiments, the CAR comprises a functional signaling 4-1BB costimulatory domain and a functional CD3 zeta intracellular signaling domain.

[0030] In some embodiments, the CAR comprises the amino acid sequence of SEQ ID NO: 37, SEQ ID NO: 52, or SEQ ID NO: 54, or an amino acid sequence that is about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 37, SEQ ID NO: 52, or SEQ ID NO: 54. In some embodiments, the intracellular signaling domain comprises the amino acid sequence of SEQ ID NO: 37 and the amino acid sequence of SEQ ID NO: 52 or SEQ ID NO: 54, or an amino acid sequence that is about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 37, SEQ ID NO: 52, or SEQ ID NO: 54. In this embodiment, the sequences are expressed in the same frame as a single polypeptide chain.

[0031] In some embodiments of the vectors disclosed herein, (a) the nucleic acid sequence comprises the sequence of SEQ ID NO:38, or a nucleic acid sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO:38, and / or (b) the nucleic acid sequence comprises the sequence of SEQ ID NO:53 or SEQ ID NO:55, or a nucleic acid sequence that is about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO:53 or 55.

[0032] In some embodiments, the CAR further comprises a leader sequence. In some embodiments, the leader sequence comprises SEQ ID NO: 25. In some embodiments, the linker peptide: (a) is selected from F2A, E2A, P2A, T2A or furin-(G4S) 2-T2A (F-GS2-T2A); and / or (b) comprises an amino acid sequence of SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96 or SEQ ID NO: 99; and / or (c) comprises a nucleic acid sequence of SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97 or SEQ ID NO: 98.

[0033] One aspect of the present disclosure provides a vector comprising: (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding an anti-CD19 chimeric antigen receptor (CAR), wherein the CAR comprises: (i) an anti-CD19 binding domain comprising: (1) LC CDR1 of SEQ ID NO: 1, LC CDR2 and LC CDR3 of SEQ ID NO: 2, HC CDR1 of SEQ ID NO: 4, HC CDR2 of SEQ ID NO: 5, and HC CDR3 of SEQ ID NO: 6; or (2) LC CDR1 of SEQ ID NO: 193, LC CDR2 of SEQ ID NO: 194, LC CDR3 of SEQ ID NO: 195; HC CDR1 of SEQ ID NO: 196, HC CDR2 of SEQ ID NO: 197, and HC CDR3 of SEQ ID NO: 198. NO: 198 HC CDR3; or (c) a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3) disclosed in Table 2; and a heavy chain variable domain comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3) disclosed in Table 2. (b) a second polynucleotide comprising a nucleic acid encoding interleukin-18 (IL-18) and / or interleukin-18 receptor (IL-18R). In some embodiments, the first polynucleotide is operably linked to the second polypeptide via a linker peptide selected from the group consisting of F2A, E2A, P2A, T2A, and furin-(G4S)2-T2A (F-GS2-T2A).

[0034] One aspect of the present disclosure provides a vector comprising: (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding an anti-CD 19 chimeric antigen receptor (CAR), wherein the CAR comprises: (i) an anti-CD 19 binding domain comprising an amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; (ii) a transmembrane domain selected from the group consisting of CD28 or the CD8 transmembrane domain; (iii) a costimulatory domain comprising an intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB; and (iv) an intracellular signaling domain comprising CD3-ζ; and (b) a second polynucleotide comprising a nucleic acid encoding interleukin-18 (IL-18) and / or interleukin-18 receptor (IL-18R). In this embodiment, the first polynucleotide is operably linked to the second polypeptide via a linker peptide selected from the group consisting of: F2A, E2A, P2A, T2A, or Furin-(G4S)2-T2A (F-GS2-T2A).

[0035] In one aspect of the present disclosure, a vector is provided, comprising: (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding an anti-CD 19 chimeric antigen receptor (CAR), wherein the CAR comprises: (i) an anti-CD 19 binding domain comprising an amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; (ii) a transmembrane domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 29, 31, and 33; (iii) a costimulatory domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 46, SEQ ID NO: 48, and SEQ ID NO: 50; and (iv) a transmembrane domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 52 or SEQ ID NO: 53. NO:54; and (b) a second polynucleotide comprising: (i) a nucleic acid encoding the amino acids of SEQ ID NO:105, 215, 106 or 107, and / or (ii) an IL-18 polypeptide comprising E42A; E42K; K89A; E42A and K89A; E42K and K89A; E42A and C74S; E42A, C74S and K89A; C74S and K89A; C74S, C112S and C112S; E42A, C74S, C112S and C112S; E42A, K89A, C74S, C112S and C112S of SEQ ID NO:107. In this embodiment, the first polynucleotide is operably linked to the second polypeptide via a linker peptide selected from the group consisting of: F2A, E2A, P2A, T2A, and furin-(G4S)2-T2A (F-GS2-T2A).

[0036] In one aspect of the present disclosure, a vector is provided, comprising: a vector comprising: (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding an anti-CD 19 chimeric antigen receptor (CAR), wherein the CAR comprises: (i) an anti-CD 19 binding domain comprising the amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; (ii) a transmembrane domain comprising the amino acid sequence of SEQ ID NO: 29; (iii) a costimulatory domain comprising the amino acid sequence of SEQ ID NO: 37; and (iv) an intracellular signaling domain of SEQ ID NO: 52 or SEQ ID NO: 54; and (b) a second polynucleotide comprising: (i) a nucleic acid encoding the amino acid sequence of SEQ ID NO: 105, 215, 106, or 107, and / or (ii) a nucleic acid encoding the amino acid sequence of SEQ ID NO: 106 or 107. In some embodiments, the first polynucleotide is operably linked to the second polypeptide via a linker peptide selected from the group consisting of F2A, E2A, P2A, T2A, and furin-(G4S)2-T2A (F-GS2-T2A).

[0037] In some embodiments, the first polynucleotide comprises: (a) an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO: 66, 77, 88, 148, 170, 181, 203, 214, 159, 192, 23 and 20; and / or (b) an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO: 65, 76, 87, 147, 169, 180, 202, 213, 158, 191, 22 and 19.

[0038] Another aspect of the present disclosure provides a modified cell comprising a vector described herein. In some embodiments, the modified cell is an immune cell or a precursor cell thereof.

[0039] In some embodiments, the modified cells are selected from T cells, natural killer (NK) cells, cytotoxic T lymphocytes (CTL), regulatory T cells, natural killer T (NKT) cells, dendritic cells, macrophages, human embryonic stem cells, and pluripotent stem cells from which lymphoid cells can be differentiated. In some embodiments, the modified cells are autologous cells, heterologous cells, or allogeneic cells. In some embodiments, the cells are modified T cells or modified human T cells. In some embodiments, the modified T cells are CD8 + T cells.

[0040] In some embodiments, the modified cells are cells with a central memory phenotype (CD44 - ;Ly6C + ) of CD8 + T cells, with M1 phenotype (MHC-II + ) macrophages, or macrophages with a mature and activated phenotype (CD86 + ;MHC-II + ) of dendritic cells.

[0041] In some embodiments, the modified cell further comprises: (a) a switch receptor comprising a first polypeptide conjugated to a second polypeptide, the first polypeptide comprising at least a portion of an inhibitory molecule selected from PD1, TGFβR, TIM-2, and BTLA, the second polypeptide comprising an intracellular signaling domain of a molecule selected from OX40, CD27, CD28, IL-12R, ICOS, and 4-1BB; (b) a dominant negative receptor comprising a truncated variant of a receptor selected from PD1, TGFβR, TIM-2, and BTLA; and / or (c) a polypeptide or functional derivative thereof that enhances immune cell function, the polypeptide or functional derivative thereof being selected from a chemokine, a chemokine receptor, a cytokine, a cytokine receptor, interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-21 (IL-21), CCL21, CCL19, and combinations thereof.

[0042] Another aspect of the present disclosure provides a composition comprising a modified cell or a modified cell population described herein.

[0043] Another aspect of the present disclosure provides a method of preparing a modified cell, the method comprising transfecting the cell with a vector described herein.

[0044] Another aspect of the present disclosure provides a method of providing anti-tumor immunity to a mammal, comprising administering to the mammal an effective amount of: (a) a composition comprising a modified cell described herein or a modified cell prepared by a method described herein; (b) a modified cell described herein; or a modified cell prepared by a method described herein; or (c) a composition described herein.

[0045] Another aspect of the present disclosure provides a method of treating a mammal having a disease associated with CD19 expression, comprising administering to the mammal an effective amount of: (a) a composition comprising a modified cell described herein or a modified cell prepared by a method described herein; (b) a modified cell described herein; or a modified cell prepared by a method described herein; or (c) a composition described herein.

[0046] In some embodiments, the modified cells are autologous modified T cells. In some embodiments, the modified cells are allogeneic modified T cells. In some embodiments, the mammal is a human.

[0047] In some embodiments, the disease associated with CD19 expression is selected from: (a) a proliferative disease, malignancy, precancerous condition or non-cancer related indication associated with CD19 expression; or (b) cancer, atypical and / or non-classical cancer, myelodysplasia, myelodysplastic syndrome or preleukemia.

[0048] In some embodiments, the disease is a hematological cancer selected from the group consisting of: (a) acute leukemia, chronic leukemia, hematological disorders, and combinations thereof; or (b) B-cell acute lymphoblastic leukemia ("BALL"), T-cell acute lymphoblastic leukemia ("TALL"), acute lymphoblastic leukemia (ALL), chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell leukemia, tumors, Burkitt lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative disorders, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndrome, non-Hodgkin lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom's macroglobulinemia, ineffective production (or dysplasia) of myeloid blood cells, and combinations thereof.

[0049] In some embodiments, the modified cell or the composition is administered in combination with: (a) an agent that increases the efficacy of: a modified cell comprising a vector described herein, a modified cell described herein, or a modified cell prepared by the methods described herein; (b) an agent that ameliorates one or more side effects associated with the administration of: a modified cell comprising a vector described herein, a modified cell described herein, or a modified cell prepared by the methods described herein; or (c) an agent that treats a disease associated with overexpression of CD19. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 Shown is a schematic outlining the identification of unique CD19-specific antibody clones from a phage display library followed by biotinylated baculovirus binding, SIGLEC binding, and / or NALM6 tumor cell binding selection.

[0051] Figure 2A-2E An alignment of the nucleic acid sequences of the novel CD19 binding agents of the present disclosure is shown.

[0052] Figure 2F A percent identity matrix illustrating the similarity of novel binders at the nucleic acid level is shown.

[0053] Figure 3A-3B A graph showing the cell growth rate based on cell doublings ( Figure 3A ) and size ( Figure 3B ), armed with interleukin-18 (IL-18) CD19CAR T cells expressing CD19 CAR, the CD19 CAR comprising original and optimized CD19 binders 42 and 52 (42og, 42op, 52og and 52op) on the expansion of CAR T cells. CD19 CART cells expressing CD19-52op, CD19-52op-IL18, CD19-52og-IL-18 and CD19-42op-IL-18 continued to expand after 12 days of culture without stimulation, while the expansion of CD19 CAR T cells expressing CD19-52og, CD19-42og and CD19-42og-IL-18 decreased steadily over time. Among the armed constructs tested, CD19-42og-IL-18CAR T cells showed the least continuous expansion after activation. The expansion size between all test groups appeared relatively similar ( Figure 3B ).

[0054] Figure 4A-4BA histogram is shown demonstrating that arming CD19CAR T cells with IL-18 did not alter the expression of CD19 CAR on the surface of ND609CAR T cells. In particular, the mean fluorescence intensity (mfi) of CD19 CAR on ND609CAR T cells was not lost with co-expression of 2A-IL-18. However, in the presence of CD19-52og CAR and CD19-52opCAR ( Figure 4B ) compared with CD19 42og-CAR and CD19-42op CAR ( Figure 4A ) showed a more unique expression profile. IL-18 co-expression may enhance the surface expression of CD19-42og CAR.

[0055] Figure 5 Such a schematic diagram is shown, which shows the timeline for evaluating the in vivo cytotoxicity effectiveness (e.g., killing) of the CD19 CAR T cells armed with IL-18. ND609 CAR T cells are transduced with original and optimized CD19 CAR (binding agents 42 and 52) -2A-IL18 constructs, and CD19 CAR T cells are evaluated in vivo using the Jeko NSG mouse model. At the 2nd week, the 4th week, and during the subsequent weeks, animals are bled to assess the peripheral blood levels of huCD45 and the serum levels of IL-18. Health, body weight, and BLI are also evaluated at the specified time (downward arrow). In addition, at the 2nd week, the 4th week, and during the subsequent weeks, cells are harvested from the femur and spleen of the mixed group to evaluate their competitiveness according to tumor clearance rate. Table 4 shows the experimental setup.

[0056] Figures 6A-6K Figure 1 shows the anti-tumor activity (tumor control) of IL-18-armed CD19CAR T cells in Jeko1 NSG mice. Figure 6A-6G ) or without IL-18 armament ( Figure 6H-6K ) of CD19 CAR T cells, and as Figure 5 When 1x10 5When used at concentrations of CAR+ / mice, all tested IL-18-armed CD19 CAR T cells cleared tumors without recurrence for the duration of the experiment (approximately 80 days) based on tumor bioluminescence imaging (BLI). These figures show that CAR T cells containing the original CD19 binder 42CAR (CD19-42og-IL-18) armed with IL-18 cleared tumors faster than CAR T cells containing CD19-42op-IL-18, control CD19-IL-18, CD19-52op-IL-18, and CD19-52og-IL-18. Using IL-18 from donor ND609 ( Figures 6A-6C )、ND585( Figure 6D-6G ) and ND608( Figure 6H-6K ) primary T cells to test the anti-tumor activity of CD19 binders in the Jeko1 NSG mouse model.

[0057] Figures 7A-7D Figure 2 shows the time course of human CD45 positivity (huCD45) in the peripheral blood of animals administered IL-18-armed ND609 CAR T cells expressing CD19-42 native or optimized or CD19-52 native. + ) cells and demonstrated that the majority of the IL-18-armed CD19 CAR T cells tested had a population contraction after tumor clearance. A good overall contraction of peripheral huCD45 blood levels after tumor clearance was observed in all animals tested. Figure 7A Mice in the WT model showed persistent elevation of peripheral huCD45 blood levels after tumor clearance, which may be due to the GVHD responses periodically observed in the model.

[0058] Figures 8A-8F Figure 2 shows the expression of CAR-positive and human CD45-positive cells in the peripheral blood of animals administered with armed CAR T cells containing original or optimized CD19-42 CAR; and original CD19-52 CAR. + CART cells; Figures 8A-8C ) cells and the percentage of human CD45-positive and CD4-positive (huCD45 + CD4 + ; Figure 8D-8F ) cells. IL-18 co-expression in treated animals enhanced or maintained CD4 + A high percentage of CAR T cells. In addition, the attached figure shows that Figure 7A Mouse #534, whose peripheral huCD45 blood levels remained elevated after tumor clearance, was most likely to have undergone a GvHD T cell response, as the percentage of positive T cells decreased ( Figure 8A ), null response drives CAR-independent T cell expansion ( Figure 8D ). Each line represents an individual animal.

[0059] Figures 9A-9F Figure 2 shows a graph characterizing the time-dependent changes in human CD45 positivity (huCD45) in the peripheral blood of animals administered IL-18-armed ND585 CAR T cells expressing either the CD19-42 native or optimized CAR. + ) cells. The levels of IL-18-armed CD19 CAR T cells in peripheral blood ( Figure 9A-9B ); huCD45 expressing CD19 CAR + Percentage ( Figure 9C-9D ) and CD45 + CD4 in the group + The percentage of cells ( Figure 9E-9F Most IL-18-armed CD19 CAR T cells tested shrank in number after tumor clearance. Human CD45 was not detected in the blood at D14 in any of the groups tested. Each line represents a single animal.

[0060] Figures 10A-10F Figure 2 shows a graph characterizing the time-dependent changes in human CD45 positivity (huCD45) in the peripheral blood of animals administered IL-18-armed ND585 CAR T cells expressing either the CD19-52 native or optimized CAR. + ) cells. The levels of IL-18-armed CD19 CAR T cells in peripheral blood ( Figures 10A-10B ); huCD45 expressing CD19 CAR + Percentage ( Figure 10C-10D ) and CD45 + CD4 in the group + The percentage of cells ( Figure 10E-Figure 10F Most IL-18-armed CD19 CAR T cells tested shrank in number after tumor clearance. Human CD45 was not detected in the blood at D14 in any of the groups tested. Each line represents a single animal.

[0061] Figures 11A-11F Shown in Figures 6A-6K In animals injected with IL-18-armed CD19 CAR T cells, weight loss was associated with tumor clearance. Figures 11A-11D The animals shown are Figure 6D-6G Related to the animals shown in.

[0062] Figure 12 Shown is the administration of 1 x 10 5Figure 2 shows Kaplan-Meier survival curves of animals that were administered IL-18 armed ND585 CD19 CAR T cells expressing original or optimized CD19 binders 42 and 52. 100% of mice administered CD19-42OP-IL18 and CD19-52OP-IL18 CAR T cells remained alive for the duration of the study (70 days). 80% of mice administered CD19-42og-IL18 CAR T cells remained alive at the end of the study, and one mouse died on day 22 due to endpoint weight loss during tumor clearance. 60% of mice administered CD19-52og-IL18 CAR T cells remained alive at the end of the study; one mouse died on day 22 due to endpoint weight loss during tumor clearance; and the second mouse died of spontaneous death on day 66. Mice expressing positive control CD19 CAR T cells died on day 28, and mice administered untransduced CAR T cells died on day 29 due to excessive weight loss.

[0063] Figures 13A-13B Figure 2 shows a graph demonstrating the effect of IL-18 arming (CD19 binder-IL18) on expansion or growth curves ( Figure 13A ) and mean cell size or shrinkage ( Figure 13B All tested CAR T cells showed similar robust expansion and contraction. However, compared with IL-18-armed CAR T cells containing 42 optimized (CD19-42op-IL18), 52 original (CD19-52og-IL18), and 52 optimized (CD19-52op-IL18), IL-18-armed CD19 CAR T cells containing original 42CD19 binder (CD19-42og-IL18) expanded and contracted faster.

[0064] Figures 14A-14B Shown is a bar graph quantifying raw mean fluorescence intensity from flow cytometry analysis demonstrating the expression of CD19 CAR in 1447 cells from ND585 donor ( Figure 14A ) and ND307 donor ( Figure 14B ) on primary human T cells. Specifically, the CD19 CAR+IL-18 construct was transduced in ND585 T cells and evaluated by flow cytometry. The expression of CD19 CAR was stable in all test groups over the time period tested. +T cell gating. CD19CAR expression based on MFI showed that control CD19-IL18 expression > CD19-42-IL18 expression > CD19-52-IL18 expression.

[0065] Figures 15A-15F A bar graph is shown for Nalm6 ( Figure 15B and Figure 15E ) and Jeko-1( Figure 15A and Figure 15D ) after stimulation or in the absence of any stimulation ( Figure 15C and Figure 15F ), from ND585 donor ( Figures 15A-15C ) or ND307 donor ( Figure 15D-15F )CD4 + CAR T cells expressing CD19-42og-IL-18, CD19-42op-IL-18, CD19-52og-IL-18, and CD19-52op-IL-18 were quantified for IL-2 and TNF-α production (IL-2 alone, TNFα alone, and a combination of IL-2 and TNF-α). The figures show that IL-2 and TNF-α production was essentially similar in all tested groups (CD19 CARs containing original and optimized CD19 binders 42 and 52). + T cell gating. The mean fluorescence intensity (mfi) of CD19 surface expression in Nalm6 cells was about 13606 mfi, and in Jeko cells it was 6851 mfi. Table 8 shows the CD8 + T cells were gated for the production of INF-γ and TNF-α.

[0066] Figures 16A-16F Shown is a bar graph showing the expression of ND307 CD4 T cells expressing CD19-42og-IL-18, CD19-42op-IL-18, CD19-52og-IL-18 and CD19-52op-IL-18 after stimulation with recombinant K562 cells. + and CD8 + Cytokine production (IL-2, TNF-α, and IFN-γ) of CAR T cells was quantified, and the recombinant K562 cells were transfected with different amounts of RNA encoding truncated CD19 antigen (CD19Ag RNA). K562 cells were transfected with: no CD19 antigen, low CD19 antigen (approximately 3% CD19 antigen expression), medium CD19 antigen (approximately 49% CD19 antigen expression), or high CD19 antigen (approximately 71% CD19 antigen expression). CD19 antigen expression was determined by flow cytometry. ND307 CD4 +TNF-α production in CAR T cells was higher in CAR T cells expressing CD19-42og-IL-18. DETAILED DESCRIPTION I. Overview

[0067] The present disclosure provides novel CD19 CAR constructs (CD19 CAR-IL-18) operably linked to recombinant interleukin-18 constructs, CAR T cells comprising the CD19 CAR-IL-18 constructs, and methods of using the IL-18-armed CD19 CAR T cells. Arming novel CD19 CAR T cells with IL-18: (1) enhances the expression of CD19 CAR; (2) reduces their expansion in the absence of stimulation; (3) enhances their tumor clearance efficacy; (4) stimulates CD19 CAR T cell contraction after tumor clearance; (5) enhances or maintains CD4 T cell proliferation in treated animals. + High percentage of CD19 CAR T cells; and (6) reducing side effects (e.g., weight loss). In general, co-expression of novel CD19 CAR with IL-18 reduces systemic CAR-induced toxicity (e.g., weight loss) and tumor recurrence or remission. As shown herein, 80%-100% of animals administered with IL-18-armed CD19 CAR T cells described herein survived the test duration, while animals administered with "positive control" CD19 CAR T cells (e.g., clinically approved CD19 binders) died on day 28, and animals administered with untransduced CAR T cells died on day 29. A. Identification of Novel CD19 Binders

[0068] The present disclosure provides novel CD19 chimeric antigen receptors, which have low affinity and fast dissociation rate compared to CD19 CAR known in the prior art or clinically approved CARs based on CD19 binding agents (e.g., FMC63). FMC63 is a IgG2a mouse monoclonal antibody specific for CD19, which is a target for immunotherapy of B lineage leukemia and lymphoma. The complete characterization of these novel CD19 binding agents is described in co-pending PCT applications and U.S. applications, which claim priority to U.S. Provisional Application No. 63 / 417,220 filed on October 18, 2022 and U.S. Provisional Application No. 63 / 426,967 filed on November 21, 2022, the contents of which are hereby incorporated by reference in their entirety for all purposes.

[0069] Chimeric antigen receptor-modified T cells (CAR T cells) for CD19 have shown promise as a new type of therapy for hematological malignancies. Significant anti-tumor responses have been achieved from anti-CD19 CAR-T therapies for B-cell acute lymphoblastic leukemia (B-ALL) and other refractory B-cell malignancies. Complete remission (CR) has been achieved in up to 70%-90% of cases of relapsed / refractory acute lymphoblastic leukemia (R / R B-ALL). In view of these excellent experimental results, the US Food and Drug Administration (FDA) and the European Medicines Agency (EMA) have approved several CAR T cell products targeting CD19 for the treatment of large B-cell lymphoma, including tisagenlecleucel ( Novartis), axicabtagene ciloleucel ( Kite Pharma-Gilead) and lisocabtagene maraleucel ( JunoTherapeutics-Celgene-BMS. In addition, brexucabtagene autoleucel ( Kite Pharma-Gilead) is approved for the treatment of relapsed / refractory mantle cell lymphoma. Despite a series of validated CAR T cell products, the success of these approved CAR T cell products has been limited. This is because approximately 40%-50% of patients who respond to CD19 CAR T cell therapy relapse within 1 year, and nearly half of these relapses include CD19-positive leukemic cells. Recent evidence suggests that resistance to CD19 chimeric antigen receptor (CAR)-modified T cell therapies may be due to the presence of CD19 isoforms that lose binding to the single-chain variable fragment (scFv) in current use. Other resistance mechanisms that limit current CAR T cell therapies include T cell exhaustion, immunosuppression, antigen loss, cytokine release syndrome (CRS), immune effector cell-associated neurotoxicity syndrome and / or neurotoxicity.

[0070] To address these issues, the present disclosure provides improved CD19 CAR constructs operably linked to interleukin-18 (IL-18) and IL-18-armed CD19 CAR T cells comprising novel CD19 binders targeting distinct and non-overlapping epitopes on the CD19 protein.

[0071] Specific screening is performed for novel CD19 binding agents (e.g., antibodies, antibody fragments, or scFv) with desired characteristics. In particular, novel CD19 binding agents with low affinity and fast off-rate are screened. Low affinity binding can be determined by the on-rate (K on ) or dissociation rate (K off ) is determined, but the anti-CD19 binding agents disclosed herein (e.g., scFv) are selected for a fast off-rate. This fast off-rate allows the CD19 CAR to quickly dissociate from CD19, resulting in a shorter CAR T cell-tumor interaction. This shorter interaction time can then reduce cytokine release, thereby reducing toxicity. In one aspect, the CD19 binding agents disclosed herein have a K of about 1 nM to about 50 nM. D In another aspect, the CD19 binding agents disclosed herein have a value of about 1.0 x 10 -3 s -1 to approximately 5.0 x 10 -3 s -1 K off value.

[0072] In addition, short interaction time reduces T cell exhaustion, thereby enhancing CAR T cell persistence. D ) and a fast off-rate (e.g., about 1.0 x 10 -3 s -1 to about 5.0x10 -3 s -1 K off ) Specifically screen CD19-specific antibodies or antibody fragments in human antibody libraries to identify the novel binding agents. Figure 1 Shown is a schematic outlining the general steps used to identify 12 unique CD19 binders from a phage display library and their selection by yeast display screening using biotinylated baculovirus binding, SIGLEC binding, and / or NALM6 tumor cell binding.

[0073] This yeast display screen generated approximately 13 novel binders, shown in Tables 3 and Figure 2A-2E The nucleic acid sequences of the novel CD19 binding agents disclosed herein are about 58% to about 97% identical to each other, such as Figure 2F As shown in .

[0074] When compared to T cells expressing known CD19 CAR (e.g., CAR based on FMC63), T cells expressing CD19 CAR comprising the novel binding agent of the present disclosure exhibit higher efficacy, enhanced in vivo persistence, and low toxicity. However, T cells expressing the low-affinity CD19 CAR of the present disclosure kill tumor cells as effectively as T cells expressing high-affinity CD19 CAR. In addition, T cells expressing the low-affinity CD19 CAR of the present disclosure can show cytokine production (e.g., interferon gamma or IL-2 production) and proliferation similar to T cells expressing high-affinity CD19 CAR (e.g., CAR based on FMC63).

[0075] The best of the 12 novel CD19 binder candidates were ultimately selected based on the following functional characteristics obtained from known CD19 binders: (1) low basal signal; (2) strong activation rate; (3) healthy expansion profile; (4) robust and stable surface expression; and (5) cytokine production. Based on these criteria, CD19 binders 42 (P1) and 52 (P11 and P13) were shown as exemplary candidates. Preliminary analysis showed that the 12 novel CD19 binders produced similar transcriptional profiles. As described herein, these 12 novel CD19 binders exhibited unusual and unique functional characteristics, signaling, pharmacology, and tumor suppression properties. The new properties described herein will address current CD19 CAR issues such as, for example, T cell exhaustion, immunosuppression, antigen loss, cytokine release syndrome (CRS), immune effector cell-associated neurotoxicity syndrome, and / or neurotoxicity.

[0076] In addition, CAR T cells expressing CARs comprising original or optimized CD19 binders 42 and 52 effectively controlled tumor growth in the Jeko NSG mouse model. CD19 binder 42 original CAR T cells inhibited tumor growth to the highest extent. CD19 binder 42opt CAR T cells, CD19 binder 52 original CAR T cells, and CD19 binder 52op CAR T cells also inhibited tumor growth. The complete characterization of these novel CD19 binders is described in the co-pending PCT application and U.S. application, which claims priority to U.S. Provisional Application No. 63 / 417,220 filed on October 18, 2022 and U.S. Provisional Application No. 63 / 426,967 filed on November 21, 2022, the contents of which are hereby incorporated by reference in their entirety for all purposes. B. Epitope Mapping of Novel CD19 Binders

[0077] The present disclosure provides improved CD19 CAR T cells that comprise novel CD19 binders that target distinct and non-overlapping epitopes on the CD19 protein and are armed with (i.e., co-express) interleukin-18 (IL-18).

[0078] CD19 binding agents are used to carry out an initial evaluation of the epitope binding region using a binding assay to determine whether the novel CD19 binding agents are bound to anti-FMC63 antibodies, and whether they share the same binding site (e.g., epitope), or whether they are bound to the same region. These data show that anti-FMC63 antibodies are not idiotypic antibodies of novel CD19 binding agents. For example, anti-FMC63 antibodies do not bind to any cell expressing a CAR comprising a novel CD19 binding agent as described herein. In addition, anti-FMC63 antibodies do not block the interaction between any tested novel CD19 binding agent and recombinant CD19 protein.

[0079] In addition, high-throughput shotgun mutagenesis analysis was performed to map the epitopes of novel CD19 binders on the extracellular domain of the full-length CD19 protein (SEQ ID NO: 217). High-throughput shotgun mutagenesis analysis of CD1942 original (42og) showed that CD19 42og binds to different epitopes on the extracellular domain of CD19 (Table 10). The CD19 42og scFv binds to the complete region of the extracellular domain of CD19 that does not overlap with the region bound by well-characterized CD19 antibodies (such as FMC63, 4G7, or 3B10).

[0080] Klesmith et al. (Biochemistry 58: 4869-4881 (2019)) used a high-throughput screening strategy to characterize the conformational epitopes of FMC63, 4G7, and 3B10 (e.g., anti-CD19 clinical antibodies) to comprehensively map the binding sequences of these antibodies to the extracellular domain of the CD19 variant CD19.1. These extensive analyses of the conformational epitope maps of FMC63, 4G7, and 3B10 showed that all three antibodies had partially overlapping epitopes near the published epitope of the antibody B43 co-crystallized with CD19. Two major epitope regions were identified. The first region comprises the amino acid sequence WAKDRPEIWEGEP (SEQ ID NO: 219) at positions 159-171 of the full-length CD19 protein (SEQ ID NO: 217). The second region comprises the amino acid sequence of PKGPKSLLSLE (SEQ ID NO: 220) and is located at positions 219-229 of SEQ ID NO: 217.

[0081] In contrast, the CD19 42og scFv primarily binds to the amino acid sequence QPGPPSEKAWQP (SEQ ID NO: 221) located at positions 98-109 of SEQ ID NO: 217. The CD19 42og scFv also interacts with another region comprising the amino acid sequence VPPDSVSRGPL (SEQ ID NO: 222) located at positions 202-212 of SEQ ID NO: 217 (full-length CD19). Thus, CD19 42og does not bind to the same epitope as FMC63, 4G7, 3B10, or B43 (e.g., anti-CD19 clinical antibodies).

[0082] These results further demonstrate the unique functional characteristics of the novel CD19 binding agents described herein, in particular CD19 42og. The novel binding agents disclosed herein have discovered new clinically relevant CD19 epitopes that do not overlap with epitopes from at least three well-characterized clinically relevant antibodies (i.e., FMC63, 4G7, and 3B10) (Table 10).

[0083] Finally, the specificity and selectivity of the novel CD19 disclosed herein were assessed using a high-throughput membrane proteome array (Integral Molecular). These experiments demonstrated that CD19 42og selectively binds to CD19 when cross-reactivity is assessed against an array of 5,220 human membrane proteins, representing over 94% of the human membrane proteome. C. IL-18 armation enhances the effectiveness of CD19-42 and CD19-52 CAR T cells

[0084] Of the 12 novel CD19 CAR T cells tested, CAR T cells expressing CARs containing original (og) or optimized (op) CD19 binders 42 or 52 had the following best attributes: low basal signaling, strong activation rate (e.g., NFAT), similar doubling during the manufacturing expansion phase (e.g., expansion profile), robust and stable surface expression (e.g., good maintenance of mfi), enhanced killing and long-term persistence of therapeutic activity. To further enhance the effectiveness of the novel CD19 CAR T cells, the effects of various immunomodulators (e.g., enhancers, payloads, or arms) on original (og) or optimized (op) CD19-42 and CD19-52 CAR T cells were determined.

[0085] Several immunomodulators increase the efficacy of engineered CAR T cells. These immunomodulators can use different mechanisms to enhance the efficacy of CAR T cells. For example, immunomodulators can increase the recruitment of endogenous immune cells to the tumor site (e.g., NK cell infiltration), increase persistence, reduce T cell exhaustion; and / or enable resistance to checkpoint inhibitors. In addition, immunomodulators such as cytokines (e.g., IL-2, IL-7, IL-12, IL-15, IL-15 / IL-15sushi, IL-15 / IL-15sushi anchor, IL-15 / IL-15RA, IL-18, IL-21, IL-21) can enhance T cell initiation, antigen presentation, and T cell infiltration in solid tumors. However, not all known immunomodulators are able to enhance the effectiveness (enhanced tumor clearance and low toxicity) and persistence of CAR T cells in vivo. This disclosure shows that IL-18 enhances the expression of CAR T cells comprising the novel CD19 binding agents 42 or 52 in their original or optimized form.

[0086] CD19-42-IL18 and CD19-52-IL18 CAR T cells each showed the ability to clear tumors in mice. However, when compared with CD19-42 (optimized) -IL18 CAR T cells, CD19-42 (original) -IL18 CAR T cells showed almost the same overall compactness in terms of the time to initial tumor clearance. Similar tumor clearance efficacy was observed in mice injected with CD19-52 (original) -IL18CART cells and CD19-52 (optimized) -IL18 CAR T cells. In all tested CAR T cells, the tumor recurred in at least one treated animal. However, CD19-42og-IL-18CART cells have the ability to re-control recurring tumors ( Figure 6D-6G In contrast, CD19-42 CAR T cells not armed with IL-18 were unable to regain control of relapsed tumors ( Figure 6H-6K These data suggest that arming naive or optimized CAR T cells with CD19-42 and 52 enhances the efficacy of CD19 CAR T cells.

[0087] Mice injected with the familiar CD19 CAR relapsed. This was unexpected because these mice were positive controls. In addition, the positive control CD19 CAR has been described to consistently clear tumors. However, the positive control CD19 CAR T cells did not have the expected tumor control. Even though they showed signs of controlling tumors, these mice were euthanized due to excessive weight loss. When compared to the positive control CAR, the novel CD19 binders disclosed herein showed stronger tumor clearance efficacy and fewer side effects when armed with IL-18. Therefore, the attenuated response of the positive control in this assay indicates that the novel CD19 binders disclosed herein are better, more efficient / effective, and less toxic than known CD19 binders when armed with IL-18.

[0088] Figures 8A-8F 、 Figure 9C-9F and Figure 10C-10F showed that IL-18 co-expression enhanced or maintained CD4 + High percentage of CD19 CAR T cells.huCD45 + The concentration of T cells in the blood of the administered animals decreased over time. + T cells began to decrease linearly from day 20 ( Figures 7A-7D ). This decrease correlated with the timing of tumor clearance, as shown in Figures 6A-6C and Figure 6G These results further showed that the numbers of CD19-42(og)-IL18 CAR T cells, CD19-42(op)-IL18 CAR T cells, CD19-52(og)-IL18 CAR T cells, and CD19-52(op)-IL18 CAR T cells shrank after tumor clearance. See Figure 3 (comparing IL-18 with no IL-18).

[0089] exist Figure 12 The Kaplan-Meier survival curve shows that the administration of 1x10 5The survival of animals that were given ND585 CD19CAR T cells armed with IL-18, which expressed original or optimized CD19 binders 42 and 52. 100% of mice administered CD19-42OP-IL18 CAR T cells and CD19-52OP-IL18 CAR T cells remained alive during the duration of the study (70 days). 80% of mice administered CD19-42og-IL18 CAR T cells remained alive at the end of the study, and one mouse died on day 22 due to endpoint weight loss during tumor clearance. 60% of mice administered CD19-52og-IL18 CART cells remained alive at the end of the study. One mouse administered CD19-52og-IL18 CAR T cells died on day 22 due to endpoint weight loss during tumor clearance; and the second mouse died of spontaneous death on day 66. Mice expressing positive control CD19 CAR T cells died on day 28, and mice administered untransduced CAR T cells died on day 29 due to excessive weight loss. The results for the positive control CD19 CAR were unexpected, but consistent with the observations made above using the tumor clearance assay. These data demonstrate that the novel CD19 binders described herein have enhanced efficacy and tolerability relative to existing CD19 binders.

[0090] Thus, one aspect of the present disclosure provides an isolated nucleic acid molecule encoding a chimeric antigen receptor (CAR) comprising a CD19 binding agent disclosed herein. In some embodiments, the CAR comprises an anti-CD19 binding domain selected from the group consisting of P1, P2, P3, P4, P5, P6, P7, P8, P9, P10, P11, P12, or P13. In some embodiments, the anti-CD19 binding domain comprises a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3) disclosed in Table 2; and a heavy chain variable domain comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3) disclosed in Table 2.

[0091] Another aspect of the present disclosure provides an isolated polypeptide molecule encoded by a nucleic acid molecule disclosed in Table 3 or Table 1.

[0092] Another aspect of the present disclosure provides a vector and / or T cell, which comprises a nucleic acid molecule encoding any novel CD19 binding agent described herein (e.g., P1-P13) and a nucleic acid encoding a polypeptide or a functional derivative thereof that enhances immune cell function. The inventors of the present disclosure further discovered that the CAR T cells comprising the low-affinity CD19 CAR of the present disclosure are armed with one or more molecules that enhance T cell activation, significantly enhancing the anti-tumor activity of the low-affinity CD19 CAR T cells, while reducing the side effects associated with CD19 CAR as disclosed herein. In fact, the arming (e.g., T cell activation molecule) gives low-affinity CAR T cells with antigen presentation function ("APC"). This new feature allows low-affinity CD19 CAR T cells to kill CD19 + cells, and at the same time induce endogenous naive T cells to differentiate into effector cytotoxic T cells after being stimulated by antigens. II. Chimeric Antigen Receptor (CAR)

[0093] One aspect of the present disclosure provides compositions of matter and methods of use for treating diseases (such as cancer) using anti-CD19 chimeric antigen receptors (CARs). Specifically, the present disclosure provides a variety of chimeric antigen receptors (CARs) comprising antibodies or antibody fragments engineered to enhance binding to CD19 proteins. In some embodiments, the CAR comprises the amino acid sequence of any one of SEQ ID NO:63, SEQ ID NO:74, SEQ ID NO:85, SEQ ID NO:145, SEQ ID NO:167, SEQ ID NO:178, SEQ ID NO:200, SEQ ID NO:211, SEQ ID NO:156, SEQ ID NO:189, SEQ ID NO:17, SEQ ID NO:8, SEQ ID NO:62, SEQ ID NO:73, SEQ ID NO:84, SEQ ID NO:144, SEQ ID NO:166, SEQ ID NO:177, SEQ ID NO:199, SEQ ID NO:210, SEQ ID NO:155, SEQ ID NO:188, SEQ ID NO:16, and SEQ ID NO:7. In some embodiments, the CAR comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, and SEQ ID NO: 216; or a nucleic acid sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, and SEQ ID NO: 216. NO:216 A polypeptide encoded by a nucleic acid sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical.

[0094] In some embodiments, a CAR of the present disclosure comprising an anti-CD19 antigen binding domain described herein has low affinity and a fast dissociation rate when compared to CARs comprising an anti-CD19 antigen binding domain known in the art.

[0095] Therefore, the present disclosure provides cells (e.g., T cells) engineered to express CAR, wherein CAR T cells ("CART") exhibit anti-tumor properties. The cells are transformed with the CAR and expressed on the cell surface. The cells (e.g., T cells) are transduced with a viral vector encoding CAR. The viral vector is a retroviral vector. In some embodiments, the viral vector is a lentiviral vector. The cells can stably express the CAR. The cells (e.g., T cells) can be transfected with nucleic acid (e.g., mRNA, cDNA, DNA encoding CAR). In some embodiments, the cells can transiently express the CAR.

[0096] In some embodiments, the anti-CD19 protein binding portion of CAR is a scFv antibody fragment. Such antibody fragments can be functional because they retain equivalent binding affinity. For example, they bind to the same antigen with efficacy comparable to that of the IgG antibodies from which they are derived. Such antibody fragments can be functional because they provide biological responses that may include but are not limited to activation of an immune response, inhibition of signal transduction from its target antigen, inhibition of kinase activity, etc., as will be understood by those skilled in the art. In some embodiments, the anti-CD19 antigen binding domain of CAR is a humanized scFv antibody fragment.

[0097] The novel CD19 antigen binding domains are engineered to have low affinity and fast dissociation rates. The CD19 antigen binding domains were identified based on binding to CD19 on HEK293 cells and then binding to NALM6 expressing CD19 or lacking CD19 expression. In some embodiments, the novel anti-CD19 antigen binding domains described herein can have binding affinity for human CD19 (hCD19) antigen. For example, the association rate constant or K of the anti-CD19 antigen binding domains described herein is on Rate (binding rate constant (M -1 min -1 ); antibody (Ab) + antigen (Ag) → Ab-Ag) can be at least about 2 x 10 5 M- 1 s 1 , at least about 5x 10 5 M -1 s -1 , at least about 10 6 M -1 s-1 , at least about 5x 10 6 M -1 s -1 , at least about 10 7 M -1 s -1 , at least about 5x10 7 M -1 s -1 or at least about 10 8 M -1 s -1 . A. Chimeric Antigen Receptor

[0098] The present disclosure provides engineered immune effector cells (for example, T cells or NK cells), which include one or more CARs for directing the immune effector cells to cancer. In some embodiments, CAR includes antigen binding domains, transmembrane domains, costimulatory domains and intracellular domains. CAR can include any antigen binding domains as described herein, any hinge, any transmembrane domain, any costimulatory domains and any intracellular signaling domains.

[0099] The antigen binding domain can be operably connected to another domain of CAR (such as a transmembrane domain or an intracellular domain, both of which are described herein) for expression in any immune cell described herein. In one embodiment, the first nucleic acid sequence encoding the antigen binding domain is operably connected to the second nucleic acid encoding the transmembrane domain, and is further operably connected to the third nucleic acid sequence encoding the intracellular domain.

[0100] In some embodiments, the antigen binding domains described herein can be combined with any transmembrane domains described herein, any intracellular domains or cytoplasmic domains described herein, or any other domains described herein that can be included in the CAR of the present disclosure. The subject CAR of the present disclosure can also include a spacer domain as described herein. In some embodiments, each of the antigen binding domains, transmembrane domains, and intracellular domains is separated by a linker.

[0101] One aspect of the present disclosure provides a chimeric antigen receptor (CAR) comprising a single-chain antibody or single-chain antibody fragment containing an anti-CD19 binding domain, a transmembrane domain, a co-stimulatory and intracellular signaling domain. The anti-CD19 binding domain comprises a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1) of SEQ ID NO: 1, a light chain complementary determining region 2 (LC CDR2) of SEQ ID NO: 2, and a light chain complementary determining region 3 (LC CDR3) of SEQ ID NO: 3; and a heavy chain variable domain comprising a heavy chain complementary determining region 1 (HC CDR1) of SEQ ID NO: 4, a heavy chain complementary determining region 2 (HC CDR2) of SEQ ID NO: 5, and a heavy chain complementary determining region 3 (HC CDR3) of SEQ ID NO: 6.

[0102] Alternatively, the anti-CD19 binding domain can comprise a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1) of SEQ ID NO: 193, a light chain complementary determining region 2 (LC CDR2) of SEQ ID NO: 194, and a light chain complementary determining region 3 (LC CDR3) of SEQ ID NO: 195; and a heavy chain variable domain comprising a heavy chain complementary determining region 1 (HC CDR1) of SEQ ID NO: 196, a heavy chain complementary determining region 2 (HC CDR2) of SEQ ID NO: 197, and a heavy chain complementary determining region 3 (HC CDR3) of SEQ ID NO: 198.

[0103] In another embodiment, the anti-CD19 binding domain comprises a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3) disclosed in Table 2; and a heavy chain variable domain comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3) disclosed in Table 2.

[0104] In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO: 7 or 199, or an amino acid sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 7 or 199. In some embodiments, the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 8 or 200, or an amino acid sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 8 or 200.

[0105] In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO: 7 and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 8. In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO: 199 and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 200. In some embodiments, the CD19 binding domain is a scFv.

[0106] In some embodiments, the anti-CD 19 binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 146, or a sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146.

[0107] In some embodiments, the anti-CD 19 binding domain comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, and SEQ ID NO: 216; or a nucleic acid sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, and SEQ ID NO: 216. NO:216 has a sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical.

[0108] In some embodiments, the anti-CD 19 binding domain comprises a light chain variable region or a heavy chain variable region encoded by: (a) a nucleic acid sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, and SEQ ID NO: 216; or (b) a nucleic acid sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, and SEQ ID NO: 216. NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225 or SEQ ID NO:216 having a sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical. 1. Antigen binding domain

[0109] The antigen binding domain of CAR is the extracellular region of CAR for binding to specific target antigens, including proteins, carbohydrates and glycolipids. In some embodiments, CAR includes affinity for target antigens (such as tumor-associated antigens) on target cells (such as cancer cells). Target antigens can include any type of protein or its epitope associated with target cells. For example, CAR can include affinity for target antigens on target cells, and the target antigen indicates the specific state of the target cell.

[0110] As described herein, the CAR of the present disclosure having affinity for a specific target antigen on a target cell can include a target-specific binding domain. In some embodiments, the target-specific binding domain is a mouse target-specific binding domain, for example, the target-specific binding domain is of mouse origin. In some embodiments, the target-specific binding domain is a human target-specific binding domain, for example, the target-specific binding domain is of human origin.

[0111] In some embodiments, the antigen-binding domains include any domain that is combined with an antigen, and may include but is not limited to monoclonal antibodies, polyclonal antibodies, synthetic antibodies, human antibodies, humanized antibodies, non-human antibodies, and any fragment thereof. Therefore, in one embodiment, the antigen-binding domains partly include mammalian antibodies or their fragments. In some embodiments, the antigen-binding domains include full-length antibodies. In some embodiments, the antigen-binding domains include antigen-binding fragments (Fab), such as Fab, Fab', F(ab')2, monospecific Fab2, bispecific Fab2, trispecific Fab2, single-chain variable fragments (scFv), dAb, tandem scFv, VhH, V-NAR, camel antibodies (camelid), double antibodies, mini antibodies, three antibodies, or four antibodies. In some embodiments, the antigen-binding domains are selected from (a) full-length antibodies or their antigen-binding fragments, (b) Fab, (c) single-chain variable fragments (scFv), and (d) single-domain antibodies.

[0112] In some embodiments, the CAR of the present disclosure may have affinity for one or more target antigens on one or more target cells. In some embodiments, CAR may have affinity for one or more target antigens on a single target cell. In such embodiments, CAR is a bispecific CAR or a multispecific CAR. In some embodiments, CAR comprises one or more target-specific binding domains that confer affinity for one or more target antigens. In some embodiments, CAR comprises one or more target-specific binding domains that confer affinity for the same target antigen. For example, a CAR comprising one or more target-specific binding domains with affinity for the same target antigen can bind to different epitopes of the target antigen. When there are multiple target-specific binding domains in CAR, the binding domains can be arranged in series and can be separated by a linker peptide. For example, in a CAR comprising two target-specific binding domains, the binding domains are covalently linked to each other on a single polypeptide chain through a polypeptide linker, an Fc hinge region, or a membrane hinge region.

[0113] In some cases, the antigen binding domain can be derived from the same species in which the CAR will ultimately be used. For example, for use in humans, the antigen binding domain of the CAR can comprise a human antibody or fragment thereof as described elsewhere herein.

[0114] Therefore, the CAR encoded by the lentiviral vector or retroviral vector of the present disclosure can target one of the following cancer-associated antigens (tumor antigens): CD19; CD20; CD22 (Siglec 2); CD37; CD 123; CD22; CD30; CD 171; CS-1 (also known as CD2 subset 1, CRACC, SLAMF7, CD319, and 19A24); C-type lectin-like molecule-1 (CLL-1 or CLECL1); CD33; CD133; epidermal growth factor receptor (EGFR); epidermal growth factor receptor variant III (EGFRvIII); human epidermal growth factor receptor (HER1); ganglioside G2 (GD2); ganglioside GD3 (aNeu5Ac(2-8)aNeu5Ac(2-3)bDGalp(l-4)bDGlcp(ll)Cer); TNF receptor family member B cell maturation (BCMA); Tn antigen ((Tn Ag) or (GalNAca-Ser / Thr)); prostate-specific membrane antigen (PSMA); receptor tyrosine kinase-like orphan receptor 1 (ROR1); Fms-like tyrosine kinase 3 (FLT3); tumor-associated glycoprotein 72 (TAG72); CD38; CD44v6; carcinoembryonic antigen (CEA); epithelial cell adhesion molecule (EPCAM); B7H3 (CD276); KIT (CD117); interleukin-13 receptor subunit alpha-2 (IL-13Ra2 or CD213A2); mesothelin interleukin-11 receptor alpha (IL-11Ra); prostate stem cell antigen (PSCA); protease serine 21 (testisin or PRSS21); vascular endothelial growth factor receptor 2 (VEGFR2); Lewis (Y) antigen; CD24; platelet-derived growth factor receptor beta (PDGFR-β); stage-specific embryonic antigen-4 (SSEA-4); folate receptor alpha; receptor tyrosine-protein kinase ERBB2 (Her2 / neu); mucin 1, cell surface-associated (MUC) 1); GalNAca1-O-Ser / Thr(Tn)MUC 1 (TnMUC1); neural cell adhesion molecule (NCAM); prostatic enzyme; prostatic acid phosphatase (PAP); mutated elongation factor 2 (ELF2M); ephrin B2; fibroblast activation protein alpha (FAP); insulin-like growth factor 1 receptor (IGF-I receptor), carbonic anhydrase IX (CAIX); proteasome (pro, megalin factor) subunit, beta type, 9 (LMP2); glycoprotein 100 (gp100); oncogene fusion protein composed of the breakpoint cluster region (BCR) and Abelson murine leukemia virus oncogene homolog 1 (Abl) (bcr-abl); tyrosinase; ephrin type A receptor 2 (EphA2); fucosyl GM1;Sialyl Lewis adhesion molecule (sLe); ganglioside GM3 (aNeu5Ac(2-3)bDGalp(l-4)bDGlcp(ll)Cer); transglutaminase 5 (TGS5); high molecular weight melanoma-associated antigen (HMWMAA); o-acetyl-GD2 ganglioside (OAcGD2); folate receptor β; tumor endothelial marker 1 (TEM1 / CD248); tumor endothelial marker 7-related protein (TEM7R); claudin 6 (CLDN6); thyroid stimulating hormone receptor (TSHR); G protein-coupled receptor class C group 5 member D (GPRC5D); chromosome X open CXORF61; CD97; CD179a; anaplastic lymphoma kinase (ALK); polysialic acid; placenta-specific protein 1 (PLAC1); globoH glycoceramide hexose moiety (GloboH); mammary differentiation antigen (NY-BR-1); uroplakin 2 (UPK2); tyrosine-protein kinase Met (c-Met); hepatitis A virus cellular receptor 1 (HAVCR1); adrenergic receptor beta 3 (ADRB3); pan-nexin 3 (PANX3); G protein-coupled receptor 20 (GPR20); lymphocyte antigen 6 complex, locus K 9 (LY6K); olfactory receptor 51E2 (OR51E2); TCRγ alternative reading frame protein (TARP); Wilms tumor protein (WT1); cancer / testis antigen 1 (NY-ESO-1); cancer / testis antigen 2 (LAGE-1a); melanoma-associated antigen 1 (MAGE-A1); ETS translocation variant gene 6 located on chromosome 12p (ETV6-AML); sperm protein 17 (SPA17); X antigen family member 1A (XAGE1); angiopoietin-binding cell surface receptor 2 (Tie 2); melanoma cancer antigen testis-1 (MAD-CT-1); melanoma cancer antigen testis-2 (MAD-CT-2); Fos-related antigen 1; tumor antigen p53 (p53); p53 mutants; prostein; survivin; telomerase; prostate cancer tumor antigen-1 (PCTA-1 or galectin 8), melanoma antigen recognized by T cells 1 (MelanA or MARTI); rat sarcoma (Ras) mutants; human telomerase reverse transcriptase (hTERT); sarcoma translocation breakpoints; melanoma inhibitor of apoptosis (ML-IAP); ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene); N-acetylglucosaminyl-transferase V (NA17); paired box protein Pax-3 (PAX3); androgen receptor; cyclin B l; v-myc avian myelocytomatosis viral oncogene neuroblastoma-derived homolog (MYCN);Ras homolog family member C (RhoC); tyrosinase-related protein 2 (TRP-2); cytochrome P450 1B 1 (CYP1B 1); CCCTC-binding factor (zinc finger protein)-like protein (paralog of BORIS or regulator of imprinting sites), squamous cell carcinoma antigen recognized by T cells 3 (SART3); paired box protein Pax-5 (PAX5); pre-acrosin binding protein sp32 (OY-TES l); lymphocyte-specific protein tyrosine kinase (LCK); A kinase anchor protein 4 (AKAP-4); synovial sarcoma breakpoint X 2 (SSX2); receptor for advanced glycation end products (RAGE-1); renal ubiquitin 1 (RU1); renal ubiquitin 2 (RU2); legumin; human papillomavirus E6 (HPV E6); human papillomavirus E7 (HPV E7); intestinal carboxylesterase; mutant heat shock protein 70-2 (mut hsp70-2); CD79a; CD79b; CD72; leukocyte-associated immunoglobulin-like receptor 1 (LAIR1); IgA receptor Fc fragment (FCAR or CD89); leukocyte immunoglobulin-like receptor subfamily A, member 2 (LILRA2); CD300 molecule-like family member f (CD300LF); C-type lectin domain family 12, member A (CLEC12A); bone marrow stromal cell antigen 2 (BST2); mucin-like hormone receptor-like protein 2 containing an EGF-like module (EMR2); lymphocyte antigen 75 (LY75); glypican-2 (GPC2); glypican-3 (GPC3); NKG2D; KRAS; GDNF family receptor alpha-4 (GFRa4); IL13Ra2; Fc receptor-like protein 5 (FCRL5); and immunoglobulin lambda-like polypeptide 1 (IGLL1).

[0115] In some embodiments, CAR targets CD19, CD20, CD22, BCMA, CD37, mesothelin, PSMA, PSCA, Tn-MUC1, EGFR, EGFRvIII, c-Met, HER1, HER2, CD33, CD133, GD2, GPC2, GPC3, NKG2D, KRAS or WT1. In some embodiments, the antigen binding domain specifically binds to a target antigen selected from the group consisting of CD4, CD19, CD20, CD22, BCMA, CD123, CD133, EGFR, EGFRvIII, mesothelin, Her2, PSMA, CEA, GD2, IL-13Ra2, Glypican-3, GPC2, TnMuc1, CIAX, LI-CAM, CA 125, CTAG1B, mucin 1 and folate receptor-α. In some embodiments, CAR targets CD19.

[0116] Thus, one aspect of the present disclosure provides an anti-CD19 binding domain comprising a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1) of SEQ ID NO: 1, a light chain complementary determining region 2 (LC CDR2) of SEQ ID NO: 2, and a light chain complementary determining region 3 (LC CDR3) of SEQ ID NO: 3; and a heavy chain variable domain comprising a heavy chain complementary determining region 1 (HC CDR1) of SEQ ID NO: 4, a heavy chain complementary determining region 2 (HC CDR2) of SEQ ID NO: 5, and a heavy chain complementary determining region 3 (HC CDR3) of SEQ ID NO: 6. Alternatively, the anti-CD19 binding domain comprises a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1) of SEQ ID NO: 193, a light chain complementary determining region 2 (LC CDR2) of SEQ ID NO: 194, and a light chain complementary determining region 3 (LC CDR3) of SEQ ID NO: 195; and a heavy chain variable domain comprising a heavy chain complementary determining region 1 (HC CDR1) of SEQ ID NO: 196, a heavy chain complementary determining region 2 (HC CDR2) of SEQ ID NO: 197, and a heavy chain complementary determining region 3 (HC CDR3) of SEQ ID NO: 198. In another embodiment, the anti-CD19 binding domain comprises a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3) disclosed in Table 2; and a heavy chain variable domain comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3) disclosed in Table 2.

[0117] In some embodiments, the anti-CD 19 binding domain is a scFv comprising a light chain variable region comprising the amino acid sequence of SEQ ID NO: 7 or 199, or a sequence about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 7 or 199; and / or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 8 or 200, or a sequence about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 8 or 200.

[0118] One aspect of the present disclosure provides an anti-CD 19 binding domain (e.g., a scFv) comprising a light chain variable domain or a heavy chain variable domain encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, and SEQ ID NO: 216. In some embodiments, the nucleic acid sequence of the light chain variable domain or the heavy chain variable domain of the anti-CD 19 binding domain (e.g., scFv) is encoded by a nucleic acid sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, or SEQ ID NO: 216.

[0119] The K of the anti-CD19 antigen binding domain of the present disclosure off Rate (dissociation rate constant (min -1 ); (Ab-Ag) → Antibody (Ab) + antigen (Ag)) can be less than about 5 x 10 -1 s -1 , less than about 10 -1 s -1 , less than about 5x 10 -1 s -1 , less than about 10 - 1 s -1 , less than about 5x10 -1 s -1 , less than about 10 -1 s -1 , less than about 5x 10 -1 s -1 or less than about 10 -1 s -1In another embodiment, the K of the antibodies of the present disclosure is off is less than about 5 x 10 -1 s -1 , less than about 10 -1 s -1 , less than about 5x 10 -1 s -1 , less than about 10 -1 s -1 , less than about 5x 10 -1 s -1 , less than about 10 -1 s -1 , less than about 5x 10 -1 s -1 , less than about 10 -1 s -1 , less than about 5x 10 -1 s -1 , less than about 10 -1 s -1 or less than about 10 -1 s -1 .

[0120] Affinity constant or K of the anti-CD19 antigen binding domain of the present disclosure a (K on / K off ) can be at least about 10 2 M -1 , at least about 5x 10 2 M -1 , at least about 10 3 M -1 , at least about 5x 10 3 M -1 , at least about 10 4 M -1 , at least about 5x 10 4 M -1 , at least about 10 5 M -1 , at least about 5x 10 5 M -1 , at least about 10 6 M -1 , at least about 5x 10 6 M -1 , at least about 10 7 M -1 , at least about 5x 10 7 M -1 , at least about 10 8 M -1 , at least about 5x 10 8 M -1 , at least about 109 M -1 , at least about 5x 10 9 M -1 , at least about 10 10 M -1 , at least about 5x10 10 M -1 , at least about 10 11 M -1 , at least about 5x 10 11 M -1 , at least about 10 12 M -1 , at least about 5x 10 12 M -1 , at least about 10 13 M -1 , at least about 5x 10 13 M -1 , at least about 10 14 M -1 , at least about 5x 10 14 M -1 , at least about 10 15 M -1 or at least about 5x 10 15 M -1 .

[0121] The dissociation constant or K of the anti-CD19 antigen binding domain of the present disclosure D (K off / K on ) can be less than about 5x10 -2 M, less than about 10 -2 M, less than about 5x 10 -3 M, less than about 10 -3 M, less than 5x 10 -4 M, less than about 10 -4 M, less than about 5x10 -5 M, less than about 10 -5 M, less than 5x 10 -6 M, less than about 10 -6 M, less than about 5x 10 -7 M, less than about 10 -7 M, less than about 5x10 -8 M, less than about 10 -8 M, less than about 5x 10 -9 M, less than about 10 -9 M, less than about 5x 10 -10 M, less than about 10 -10 M, less than about 5x10 -11 M, less than about 10 -11M, less than about 5x 10 -12 M, less than about 10 -12 M, less than about 5x 10 -13 M, less than about 10 -13 M, less than about 5x 10 -14 M, less than about 10 -14 M, less than about 5x 10 -15 M or less than about 10 -15 M.

[0122] When used with the methods described herein, the anti-CD19 antigen binding domains of the present disclosure can be used with a dissociation constant (K) of less than about 3000 nM, less than about 2500 nM, less than about 2000 nM, less than about 1500 nM, less than about 1000 nM, less than about 750 nM, less than about 500 nM, less than about 250 nM, less than about 200 nM, less than about 150 nM, less than about 100 nM, or less than about 75 nM. d ) specifically binds to human CD19 as assessed using methods described herein or known to those skilled in the art (e.g., BIAcore assay, ELISA) (Biacore International AB, Uppsala, Sweden).

[0123] In some embodiments, the anti-CD19 antigen binding domains of the present disclosure can be expressed with a dissociation constant (K) of about 25 to about 3400 nM, about 25 to about 3000 nM, about 25 to about 2500 nM, about 25 to about 2000 nM, about 25 to about 1500 nM, about 25 to about 1000 nM, about 25 to about 750 nM, about 25 to about 500 nM, about 25 to about 250 nM, about 25 to about 100 nM, about 25 to about 75 nM, about 25 to about 50 nM, d ) specifically binds to the human CD19 antigen as assessed using methods described herein or known to those skilled in the art (e.g., BIAcore assay, ELISA). In another embodiment, the anti-CD19 antigen binding domain can be expressed with a dissociation constant (K) of at least about 500 nM, at least about 100 nM, at least about 75 nM, or at least about 50 nM. d ) specifically binds to hCD19 as assessed using methods described herein or known to those skilled in the art (e.g., BIAcore assay, ELISA). 2. Transmembrane domain

[0124] The CAR of the present disclosure can be designed to include a membrane spaning domain, which connects the antigen binding domains of CAR to the intracellular domain. The membrane spaning domain of theme CAR is the region of the plasma membrane that can span cells (e.g., immune cells or their precursors). The membrane spaning domain is used to insert into a cell membrane (e.g., a eukaryotic cell membrane). In some embodiments, the membrane spaning domain is between the antigen binding domains of CAR and the intracellular domain.

[0125] In one embodiment, the transmembrane domain is naturally associated with one or more domains in the CAR. In some cases, the transmembrane domain can be selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins, thereby minimizing interactions with other members of the receptor complex.

[0126] In some embodiments, the transmembrane domain can be derived from a natural source or from a synthetic source. Where the source is natural, the domain can be derived from any membrane-bound protein or transmembrane protein, such as a type I transmembrane protein. Where the source is synthetic, the transmembrane domain can be any artificial sequence, such as an artificial hydrophobic sequence, that facilitates insertion of the CAR into the cell membrane. In some embodiments, transmembrane domains of particular use in the present disclosure include, but are not limited to, transmembrane domains derived from the alpha, beta, or zeta chains of the T cell receptor, CD28, CD2, CD3ε, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, and killer cell immunoglobulin-like receptors (KIRs).

[0127] In some embodiments, the transmembrane domain includes at least the transmembrane region of a protein selected from the group consisting of the alpha, beta or zeta chain of a T cell receptor, CD28, CD2, CD3ε, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9 and killer cell immunoglobulin-like receptor (KIR).

[0128] In some embodiments, the transmembrane domain can be synthetic. In some embodiments, the synthetic transmembrane domain primarily comprises hydrophobic residues, such as leucine and valine. In certain exemplary embodiments, a triplet of phenylalanine, tryptophan, and valine will be found at each end of the synthetic transmembrane domain.

[0129] The transmembrane domains described herein can be combined with any antigen binding domain described herein, any costimulatory signaling domain described herein, any intracellular signaling domain described herein, or any other domain described herein that can be included in a subject CAR.

[0130] In one embodiment, the transmembrane domain comprises a CD8α transmembrane domain. In some embodiments, the transmembrane domain comprises a CD8α transmembrane domain comprising the amino acid sequence shown in SEQ ID NO: 29. In some embodiments, the transmembrane domain comprises the nucleotide sequence shown in SEQ ID NO: 30.

[0131] In some embodiments, the transmembrane domain comprises a CD28 transmembrane domain. In some embodiments, the CAR comprises a CD28 transmembrane domain comprising the amino acid sequence shown in SEQ ID NO: 31. In some embodiments, the CD28 transmembrane domain comprises the nucleotide sequence shown in SEQ ID NO: 32.

[0132] In some embodiments, the transmembrane domain comprises a CD28 transmembrane domain. In some embodiments, the CAR comprises an ICOS transmembrane domain comprising the amino acid sequence shown in SEQ ID NO: 33. In some embodiments, the ICOS transmembrane domain comprises the nucleotide sequence shown in SEQ ID NO: 34.

[0133] The permissible variations in the transmembrane domain and / or hinge domain will be known to those skilled in the art while maintaining their intended function. In some embodiments, the transmembrane domain comprises an amino acid sequence having at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity to any one of the amino acid sequences shown in SEQ ID NO: 29, 31 and / or 33. In some embodiments, the transmembrane domain is encoded by a nucleic acid sequence comprising a nucleotide sequence having at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity to any of the nucleotide sequences shown in SEQ ID NOs: 30, 32, and / or 34. The transmembrane domain can be combined with any hinge domain and / or can include one or more transmembrane domains described herein.

[0134] In some embodiments, the CAR comprises: any transmembrane domain selected from the group consisting of the alpha, beta, or zeta chain of a T cell receptor, CD28, CD2, CD3ε, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, and killer cell immunoglobulin-like receptor (KIR); any co-stimulatory signaling domain; and any intracellular or cytoplasmic domain described herein; or any other domain described herein that may be included in a CAR; and optionally a hinge domain.

[0135] In some embodiments, CAR is further included between the extracellular domain and the transmembrane domain of CAR or between the intracellular domain and the transmembrane domain of CAR. In some embodiments, the spacer domain can be a short oligopeptide linker or a polypeptide linker, for example, with a length between about 2 and about 10 amino acids. For example, a glycine-serine doublet provides a particularly suitable linker between the transmembrane domain and the intracellular signaling domain of the subject CAR. Therefore, the CAR of the present disclosure can include any one of the transmembrane domain, hinge domain or spacer domain described herein. 3. Hinge domain

[0136] In some embodiments, the CAR of the present disclosure further comprises a hinge region. The hinge region of CAR is a hydrophilic region located between the antigen binding domain and the transmembrane domain. In some embodiments, the hinge domain promotes the proper protein folding of CAR. In some embodiments, the hinge domain is an optional component of CAR. In some embodiments, the hinge domain includes a domain selected from the following: an Fc fragment of an antibody, a hinge region of an antibody, a CH2 region of an antibody, a CH3 region of an antibody, an artificial hinge sequence, or a combination thereof. In some embodiments, the hinge domain is selected from, but is not limited to, a CD8a hinge, an artificial hinge made from a polypeptide that can be as small as three glycine (Gly). In some embodiments, the hinge region is a hinge region polypeptide derived from a receptor. In some embodiments, the hinge region is a hinge region derived from CD8. In one embodiment, the hinge domain comprises an amino acid sequence derived from human CD8 or a variant thereof. In some embodiments, the subject CAR comprises a CD8α hinge domain and a CD8α transmembrane domain. In some embodiments, the CD8α hinge domain comprises an amino acid sequence shown in SEQ ID NO: 27 or 35. In some embodiments, the CD8α hinge domain comprises the nucleotide sequence shown in SEQ ID NO: 28 or 36.

[0137] In some embodiments, the hinge domain comprises an amino acid sequence having at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any one of the amino acid sequences shown in SEQ ID NO:: 27 or 35.

[0138] In some embodiments, the hinge domain is encoded by a nucleic acid sequence comprising a nucleotide sequence having at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any one of the nucleotide sequences shown in SEQ ID NO: 28 or 36.

[0139] In some embodiments, the hinge domain connects the antigen-binding domain to the transmembrane domain, which is connected to the intracellular domain. In exemplary embodiments, the hinge region can support the antigen-binding domain to recognize and bind to the target antigen on the target cell. In some embodiments, the hinge region is a flexible domain, thereby allowing the antigen-binding domain to have a structure for optimally recognizing the specific structure and density of the target antigen on the cell (such as a tumor cell). The flexibility of the hinge region allows the hinge region to adopt many different conformations.

[0140] In some embodiments, the length of the hinge domain is selected from about 4 to about 50, about 4 to about 10, about 10 to about 15, about 15 to about 20, about 20 to about 25, about 25 to about 30, about 30 to about 40, or about 40 to about 50 amino acids. Suitable hinge regions can be readily selected and can have any of a number of suitable lengths, such as from about 1 amino acid (e.g., glycine (Gly)) to about 20 amino acids, from about 2 to about 15, from about 3 amino acids to about 12 amino acids, including about 4 to about 10, about 5 to about 9, about 6 to about 8, or about 7 to about 8 amino acids, and can be about 1, about 2, about 3, about 4, about 5, about 6, or about 7 amino acids.

[0141] In some embodiments, the amino acid is glycine (Gly). Glycine and glycine-serine polymers can be used; both Gly and Ser are relatively unstructured and therefore can act as neutral tethers between components. Glycine polymers can be used; glycine is significantly larger than even alanine. In some embodiments, the hinge region includes a glycine polymer (G) n, a glycine-serine polymer. In some embodiments, the hinge region includes a glycine-serine polymer selected from (GS) n, (GSGGS) n and (GGGS) n, wherein n is an integer of at least one. In some embodiments, the hinge domain includes but is not limited to GGSG (SEQ ID NO: 121), GGSGG (SEQ ID NO: 122), GSGSG (SEQ ID NO: 123), GSGGG (SEQ ID NO: 124), GGGSG (SEQ ID NO: 125), GSSSG (SEQ ID NO: 126) amino acid sequence. In some embodiments, the hinge region includes glycine-alanine polymer, alanine-serine polymer or other flexible joints known in the art.

[0142] In some embodiments, the hinge region is an immunoglobulin heavy chain hinge region.Immunoglobulin hinge region amino acid sequences are known in the art. In some embodiments, the immunoglobulin hinge domain comprises an amino acid sequence selected from the group consisting of: DKTHT (SEQ ID NO: 130); CPPC (SEQ ID NO: 131); CPEPKSCDTPPPCPR (SEQ ID NO: 132) (see, e.g., Glaser et al., J. Biol. Chem. (2005) 280:41494-41503); ELKTPLGDTTHT (SEQ ID NO: 133); KSCDKTHTCP (SEQ ID NO: 134); KCCVDCP (SEQ ID NO: 135); KYGPPCP (SEQ ID NO: 136); EPKSCDKTHTCPPCP (SEQ ID NO: 137) (human IgG1 hinge); ERKCCVECPPCP (SEQ ID NO: 138) (human IgG2 hinge); ELKTPLGDTTHTCPRCP (SEQ ID NO: 139) (human IgG3 hinge); SPNMVPHAHHAQ (SEQ ID NO: 140). IDNO: 49) (human IgG4 hinge); etc.

[0143] In some embodiments, the hinge region is an immunoglobulin heavy chain hinge region. In some embodiments, the hinge is selected from the CH1 and CH3 domains of IgG (such as human IgG4). In some embodiments, the hinge domain comprises the amino acid sequence of human IgG1, IgG2, IgG3 or IgG4 hinge domain. In some embodiments, the hinge region may comprise one or more amino acid substitutions and / or insertions and / or deletions compared to the wild-type (naturally occurring) hinge region. In some embodiments, the histidine (His229) at position 229 of the human IgG1 hinge is replaced by tyrosine (Tyr). In some embodiments, the hinge domain comprises the amino acid sequence EPKSCDKTYTCPPCP (SEQ ID NO: 137). 4. Intracellular domain

[0144] The CAR of the present disclosure also includes an intracellular domain. The intracellular domain or other cytoplasmic domain of CAR is responsible for activating cells in which CAR is expressed. Therefore, the term "intracellular domain" is intended to include any portion of the intracellular domain sufficient to transduce an activation signal. In one embodiment, the intracellular domain includes a domain responsible for effector function. The term "effector function" refers to a specialized function of a cell. The effector function of a T cell can be, for example, cytolytic activity or auxiliary activity, including the secretion of cytokines. In one embodiment, the intracellular domain of CAR includes a domain responsible for signal activation and / or transduction. The intracellular domain can transmit signal activation via protein-protein interactions, biochemical changes, or other reactions to change the metabolism, shape, gene expression, or other cellular responses to the activation of signal transduction molecules in the chimeric cell.

[0145] Examples of intracellular domains useful in the present invention include, but are not limited to, the cytoplasmic portion of the T cell receptor (TCR), and any co-stimulatory molecule, or any molecule that acts in concert with the TCR to initiate signal transduction in a T cell following antigen receptor engagement, as well as any derivatives or variants of these elements and any synthetic sequences with the same functional capability.

[0146] In certain embodiments, the intracellular domain comprises an intracellular signaling domain. Examples of intracellular domains include fragments or domains from one or more molecules or receptors, including but not limited to TCR, CD3ζ, CD3γ, CD3δ, CD3ε, CD86, common FcRγ, FcRβ (FcεRib), CD79a, CD79b, FcγR11a, DAP10, DAP12, T cell receptor (TCR), CD2, CD8, CD27, CD28, 4-1BB (CD137), OX9, OX40, CD30, CD40, PD-1, ICOS, KIR family proteins, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, ligands specifically binding to CD83, CD5, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD127, CD160, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD1Id, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD lib, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, TRANCE / RANKL, DNAM1(CD226), SLAMF4(CD244, 2B4), CD84, CD96(Tactile), CEACA M1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Lyl08), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD 162), LTBR, LAT, GADS, SLP-76, PAG / Cbp, NKp44, NKp30, NKp46, NKG2D, Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, syk family tyrosine kinases (Syk, ZAP 70, etc.), src family tyrosine kinases (Lck, Fyn, Lyn, etc.), other costimulatory molecules described herein, any derivatives, variants or fragments thereof, any synthetic sequence of a costimulatory molecule with the same functional capacity, and any combination thereof.

[0147] In some embodiments, the intracellular signaling domain comprises an intracellular domain of a cytoplasmic signaling domain selected from the group consisting of human CD2, CD3 zeta chain (CD3 zeta), FcγRIII, FcsRI, the cytoplasmic tail of an Fc receptor, a cytoplasmic receptor carrying an immunoreceptor tyrosine-based activation motif (ITAM), TCR zeta, FcRγ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d, or variants thereof. In some embodiments, the intracellular signaling domain comprises a CD3 zeta intracellular signaling domain.

[0148] Other examples of intracellular domains include, but are not limited to, intracellular signaling domains of various other immune signaling receptors of several types, including, but not limited to, first, second, and third generation T cell signaling proteins, including CD3, B7 family co-stimulatory receptors, and tumor necrosis factor receptor (TNFR) superfamily receptors. Additionally, the intracellular signaling domain can include signaling domains used by NK and NKT cells, such as NKp30 (B7-H6), and DAP 12, NKG2D, NKp44, NKp46, DAP10, and the signaling domains of CD3z.

[0149] The intracellular signaling domain of the CAR suitable for the present disclosure includes any desired signaling domain in response to the activation (i.e., activation by antigen and dimerization reagent) transduction signal of CAR. In some embodiments, unique and detectable signals include, for example, increased production of one or more cytokines of cells; changes in target gene transcription; changes in protein activity; changes in cell behavior (e.g., cell death); cell proliferation; cell differentiation; cell survival; and / or regulation of cell signaling reactions. For example, in some embodiments, the intracellular signaling domain includes a DAP10 / CD28 type signaling chain. In some embodiments, the intracellular signaling domain is not covalently attached to a membrane-bound CAR, but diffuses in the cytoplasm.

[0150] The intracellular signaling domain of the CAR suitable for the present disclosure includes an intracellular signaling polypeptide containing an immunoreceptor tyrosine activation motif (ITAM). In some embodiments, the intracellular signaling domain includes at least one, at least two, at least three, at least four, at least five or at least six ITAM motifs as described below. In some embodiments, the ITAM motif is repeated twice in the intracellular signaling domain, wherein the first and second examples of the ITAM motif are spaced 6 to 8 amino acids apart from each other. In one embodiment, the intracellular signaling domain of the subject CAR includes 3 ITAM motifs. In some embodiments, the intracellular signaling domain includes a signaling domain of a human immunoglobulin receptor containing an immunoreceptor tyrosine activation motif (ITAM), such as, but not limited to, FcγRI, FcγRIIA, FcγRIIC, FcγRIIIA, FcRL5.

[0151] Suitable intracellular signaling domains can be portions containing ITAM motifs derived from polypeptides containing ITAM motifs. For example, suitable intracellular signaling domains can be domains containing ITAM motifs from any protein containing ITAM motifs. Thus, suitable intracellular signaling domains do not need to contain the entire sequence of the entire protein from which they are derived. Examples of suitable ITAM motif-containing polypeptides include, but are not limited to, DAP12, FCER1G (Fcε receptor Iγ chain), CD3D (CD3δ), CD3E (CD3ε), CD3G (CD3γ), CD3Z (CD3ζ), and CD79A (antigen receptor complex-associated protein α chain).

[0152] In one embodiment, the intracellular signaling domain is derived from DAP12 (also known as TYROBP; TYRO protein tyrosine kinase binding protein; KARAP; PLOSL; DNAX activating protein 12; KAR-related protein; TYRO protein tyrosine kinase binding protein; killer cell activating receptor-related protein; killer cell activating receptor-related protein, etc.). In one embodiment, the intracellular signaling domain is derived from FCER1G (also known as FCRG; Fcε receptor I γ chain; Fc receptor γ chain; fc-εRI-γ; fcRγ; fceR1γ; high affinity immunoglobulin epsilon receptor subunit γ; immunoglobulin E receptor high affinity γ chain; etc.). In one embodiment, the intracellular signaling domain is derived from T cell surface glycoprotein CD3 δ chain (also known as CD3D; CD3-δ; T3D; CD3 antigen, δ subunit; CD3 δ; CD3d antigen, δ polypeptide (TiT3 complex); OKT3, δ chain; T cell receptor T3 δ chain; T cell surface glycoprotein CD3 δ chain, etc.). In one embodiment, the intracellular signaling domain is derived from the T cell surface glycoprotein CD3ε chain (also known as CD3e, T cell surface antigen T3 / Leu-4ε chain, T cell surface glycoprotein CD3ε chain, AI504783, CD3, CD3ε, T3e, etc.). In one embodiment, the intracellular signaling domain is derived from the T cell surface glycoprotein CD3 chain (also known as CD3G; T cell receptor T3γ chain; CD3-γ; T3G, γ polypeptide (TiT3 complex) etc.). In one embodiment, the intracellular signaling domain is derived from the T cell surface glycoprotein CD3ζ chain (also known as CD3Z, T cell receptor T3ζ chain, CD247, CD3-ζ, CD3H, CD3Q, T3Z, TCRZ, etc.). In one embodiment, the intracellular signaling domain is derived from CD79A (also known as B cell antigen receptor complex-associated protein α chain; CD79a antigen (immunoglobulin-associated α); MB-1 membrane glycoprotein; Ig-α; membrane-bound immunoglobulin-associated protein; surface IgM-associated protein; etc.). In one embodiment, the intracellular signaling domain of the CAR suitable for use in the present disclosure includes a DAP10 / CD28 type signaling chain. In one embodiment, the intracellular signaling domain of the subject CAR suitable for use in the present disclosure includes a ZAP70 polypeptide. In some embodiments, the intracellular signaling domain includes the cytoplasmic signaling domain of TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b or CD66d. In one embodiment, the intracellular signaling domain in the CAR includes the cytoplasmic signaling domain of human CD3ζ.

[0153] While the entire intracellular signaling domain can generally be employed, in many cases it is not necessary to use the entire chain. To the extent that a truncated portion of the intracellular signaling domain is used, such a truncated portion can be used in place of the entire chain as long as it transduces an effector function signal. The intracellular signaling domain includes any truncated portion of the intracellular signaling domain that is sufficient to transduce an effector function signal.

[0154] The intracellular signaling domain described herein can be combined with any co-stimulatory signaling domain described herein, any antigen binding domain described herein, any transmembrane domain described herein, or any other domain described herein that can be included in CAR. In some embodiments, the intracellular domain of CAR includes a dual signaling domain. The dual signaling domain can include a fragment or domain from any molecule described herein. In some embodiments, the intracellular domain includes a 4-1BB co-stimulatory domain and a CD3 ζ signaling domain; a CD28 co-stimulatory domain and a CD3 ζ signaling domain; a CD2 co-stimulatory domain and a CD3 ζ signaling domain. In some embodiments, the intracellular domain of CAR includes any portion of a co-stimulatory molecule, such as at least one signaling domain from the following: CD3, CD27, CD28, ICOS, 4-1BB, PD-1, T cell receptor (TCR), any derivative or variant thereof, any synthetic sequence thereof with the same functional capability, and any combination thereof.

[0155] In addition, variant intracellular signaling domains suitable for use with the subject CARs are known in the art. The YMFM motif is found in ICOS and is an SH2 binding motif that recruits both the p85 and p50α subunits of PI3K, thereby enhancing AKT signaling. In one embodiment, a CD28 intracellular domain variant can be generated to include a YMFM motif.

[0156] In one embodiment, the intracellular domain of the subject CAR comprises a CD3 zeta intracellular signaling domain comprising the amino acid sequence set forth in SEQ ID NO: 52 or SEQ ID NO: 54, which can be encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 53 or SEQ ID NO: 55, respectively.

[0157] The permissible variations in the intracellular domain will be known to those skilled in the art while maintaining specific activity. In some embodiments, the intracellular domain comprises an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to any one of the amino acid sequences shown in SEQ ID NO: 52 or 54. In some embodiments, the intracellular domain is encoded by a nucleic acid sequence comprising a nucleotide sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of the nucleotide sequences shown in SEQ ID NO:53 or 55. 5.Co-stimulatory domain

[0158] In some embodiments, the intracellular domain includes a costimulatory signaling domain and an intracellular signaling domain. In certain embodiments, the intracellular domain includes a costimulatory signaling domain. In one embodiment, the intracellular domain of CAR includes a costimulatory signaling domain, and the costimulatory signaling domain is selected from a portion of the signaling domain from the following: proteins in the TNFR superfamily, CD27, CD28, 4-1BB (CD137), OX40 (CD134), PD-1, CD7, LIGHT, CD83L, DAP10, DAP12, CD27, CD2, CD5, ICAM-1, LFA-1, Lck, TNFR-I, TNFR-II, Fas, CD30, CD40, ICOS (CD278), NKG2C, B7-H3 (CD276), and intracellular domains derived from cytotoxic cell immunoglobulin-like receptors (KIR), any derivatives or variants thereof, any synthetic sequences thereof with the same functional capabilities, and any combination thereof.

[0159] In some embodiments, the costimulatory domain includes one or more of the costimulatory domains of the protein selected from the group consisting of proteins in the TNFR superfamily, CD28, 4-1BB (CD137), OX40 (CD134), PD-1, CD7, LIGHT, CD83L, DAP10, DAP12, CD27, CD2, CD5, ICAM-1, LFA-1, Lck, TNFR-I, TNFR-II, Fas, CD30, CD40, ICOS (CD278), NKG2C, B7-H3 (CD276), and intracellular domains derived from cytotoxic cell immunoglobulin-like receptors (KIR), or variants thereof. In some embodiments, the costimulatory domain includes one or more of the costimulatory domains of the protein selected from the group consisting of proteins in ... In some embodiments, the costimulatory signaling domain comprises a CD2 costimulatory domain. In some embodiments, the costimulatory signaling domain comprises a CD28 costimulatory domain.

[0160] In some embodiments, the costimulatory domain comprises an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to any one of the amino acid sequences shown in SEQ ID NO:37, 39, 41, 43, 46, 48, or 50. In some embodiments, the intracellular domain is encoded by a nucleic acid sequence comprising a nucleotide sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to any one of the nucleotide sequences shown in SEQ ID NO:38, 40, 42, 44, 45, 47, 49 or 51.

[0161] In one embodiment, the intracellular domain of the subject CAR comprises an ICOS costimulatory domain and a CD3 ζ intracellular signaling domain. In one embodiment, the intracellular domain of the subject CAR comprises a CD28 costimulatory domain and a CD3 ζ intracellular signaling domain. In one embodiment, the intracellular domain of the subject CAR comprises a CD28 YMFM variant costimulatory domain and a CD3 ζ intracellular signaling domain. In one embodiment, the intracellular domain of the subject CAR comprises a CD27 costimulatory domain and a CD3 ζ intracellular signaling domain. In one embodiment, the intracellular domain of the subject CAR comprises an OX40 costimulatory domain and a CD3 ζ intracellular signaling domain. In an exemplary embodiment, the intracellular domain of the subject CAR comprises a 4-1BB costimulatory domain and a CD3 ζ intracellular signaling domain. In an exemplary embodiment, the intracellular domain of the subject CAR comprises a CD2 costimulatory domain and a CD3 ζ intracellular signaling domain. B. Additional Antigen Binding Polypeptides

[0162] In some embodiments, the modified T cells express antigen-binding polypeptides, cell surface receptor ligands or polypeptides that bind to tumor antigens. In some cases, the antigen binding domain comprises an antibody that recognizes cell surface proteins or receptors expressed on tumor cells. In some cases, the antigen binding domain comprises an antibody that recognizes tumor antigens. In some cases, the antigen binding domain comprises a full-length antibody or its antigen-binding fragment, Fab, F (ab) 2, monospecific Fab2, bispecific Fab2, trispecific Fab2, single-chain variable fragment (scFv), double antibody, three antibodies, mini antibody, V-NAR or VhH. C. Cell surface receptor ligands

[0163] In some embodiments, the lentiviral vector or retroviral vector of the present disclosure further comprises a nucleic acid encoding a cell surface receptor ligand. In some cases, the ligand binds to a cell surface receptor expressed on tumor cells. In some cases, the ligand comprises a wild-type protein or a variant thereof that binds to a cell surface receptor. In some cases, the ligand comprises a full-length protein or a functional fragment thereof that binds to a cell surface receptor. In some cases, compared to the full-length protein, the functional fragment comprises about 90%, about 80%, about 70%, about 60%, about 50% or about 40% of the length, but retains binding to the cell surface receptor. In some cases, the ligand is a de novo engineered protein that binds to a cell surface receptor. Exemplary ligands include, but are not limited to, epidermal growth factor (EGF), platelet-derived growth factor (PDGF) or Wnt3A. D. Tumor antigens

[0164] In some embodiments, the lentiviral vector or retroviral vector of the present disclosure further comprises a nucleic acid encoding a polypeptide that binds to a tumor antigen. In some embodiments, the tumor antigen is associated with a hematological malignancy. Exemplary tumor antigens include, but are not limited to, CD19, CD20, CD22, CD33 / IL3Ra, ROR1, mesothelin, c-Met, PSMA, PSCA, folate receptor alpha, folate receptor beta, EGFRvIII, GPC2, Tn-MUC1, GDNF family receptor alpha-4 (GFRa4), fibroblast activation protein (FAP), and IL13Ra2. In some cases, the tumor antigen includes CD19, CD20, CD22, BCMA, CD37, mesothelin, PSMA, PSCA, Tn-MUC1, EGFR, EGFRvIII, c-Met, HER1, HER2, CD33, CD133, GD2, GPC2, GPC3, NKG2D, KRAS, or WT1. In some cases, the polypeptide is a ligand of a tumor antigen, such as a full-length protein that binds to a tumor antigen, a functional fragment thereof, or a de novo engineered ligand that binds to a tumor antigen. In some cases, the polypeptide is an antibody that binds to a tumor antigen. E. Engineered T cell receptors

[0165] In some embodiments, the antigen binding domains of CAR described herein can be transplanted to one or more constant domains of a T cell receptor ("TCR") chain (e.g., TCR α or TCR β chain) to produce a chimeric TCR. Chimeric TCR can send a signal via a TCR complex after antigen binding. For example, scFv as disclosed herein can be transplanted to at least a portion of a constant domain or extracellular constant domain of a TCR chain, a transmembrane domain. As another example, an antibody fragment (e.g., a VL domain as described herein) can be transplanted to the constant domain of a TCR α chain. Such chimeric TCRs can be produced, for example, by methods known in the art (e.g., Willemsen RA et al., Gene Therapy 2000; 7: 1369-1377; Zhang T et al., Cancer Gene Ther 2004; 11: 487-496; Aggen et al., Gene Ther. 2012 April; 19 (4): 365-74). F. Switch receptors and dominant negative receptors

[0166] On the one hand, the lentiviral vector or retroviral vector of the present disclosure further comprises a nucleic acid encoding a dominant negative receptor, a switch receptor, or a combination thereof. In some embodiments, the lentiviral vector or retroviral vector described herein comprises a chimeric antigen receptor (CAR) and / or a dominant negative receptor. In some embodiments, the lentiviral vector or retroviral vector comprises a CAR and / or a switch receptor. In some embodiments, the lentiviral vector or retroviral vector described herein comprises an engineered TCR and a switch receptor. In some embodiments, the lentiviral vector or retroviral vector described herein comprises an engineered TCR and a dominant negative receptor. In some embodiments, the lentiviral vector or retroviral vector described herein comprises a KIR and a switch receptor. In some embodiments, the lentiviral vector or retroviral vector described herein further comprises a KIR and a dominant negative receptor. 1. Switching receptors

[0167] The present disclosure provides a fast and effective manufacturing method for engineering modified immune cells, which include CAR, or exogenous TCR and / or switch receptors. In some embodiments, CAR, TCR and / or switch receptors are encoded by one or more nucleic acids. In some embodiments, the lentiviral vector or retroviral vector disclosed herein includes one or more nucleic acid sequences encoding CAR, TCR and / or switch receptors. In some embodiments, the nucleic acid sequence encoding CAR is operably connected to the nucleic acid sequence encoding the switch receptor. In some embodiments, the switch receptor can enhance the efficiency of CAR or cells expressing CAR.

[0168] Tumor cells produce an immunosuppressive microenvironment for protecting them from immune recognition and elimination. This immunosuppressive microenvironment can limit the effectiveness of immunosuppressive therapies such as CAR-T or TCR-T cell therapy. For example, the secreted cytokine transforming growth factor β (TGFβ) directly inhibits the function of cytotoxic T cells and additionally induces the formation of regulatory T cells to further suppress the immune response. T cell immunosuppression due to TGFβ has previously been demonstrated in the context of prostate cancer. In order to reduce the immunosuppressive effect of TGF on immune cells, immune cells can be modified to express engineered TGFβR, which comprises an extracellular ligand binding domain of TGFβR fused to an intracellular signaling domain of, for example, an interleukin-12 receptor (IL12R; TGFβR-IL12R). Therefore, modified immune cells comprising a switch receptor can bind to negative signal transduction molecules in the microenvironment of modified immune cells and convert the negative signal transduction signals that inhibitory molecules may have on modified immune cells into positive signals that stimulate the modified immune cells. The switch receptors of the present disclosure can be designed to reduce the effects of negative signaling molecules, or convert negative signals into positive signals, by comprising an intracellular domain associated with a positive signal.

[0169] As used herein, the term "switch receptor" refers to a molecule designed to reduce the effect of negative signal transduction molecules on the modified immune cells of the present disclosure. The switch receptor comprises: a first domain derived from a first polypeptide associated with a negative signal (signal transduction that suppresses or inhibits cell or T cell activation); and a second domain derived from a second polypeptide associated with a positive signal (signal transduction signal that stimulates cells or T cells). In some embodiments, the protein associated with the negative signal is selected from CTLA4, PD-1, TGFβRII, BTLA, VSIG3, VSIG8, and TIM-3. In some embodiments, the protein associated with the positive signal is selected from CD28, 4-1BB, IL12Rβ1, IL12Rβ2, CD2, ICOS, and CD27.

[0170] In one embodiment, the first domain comprises at least a portion of the extracellular domain of the first polypeptide associated with the negative signal, and the second domain comprises at least a portion of the intracellular domain of the second polypeptide associated with the positive signal. Thus, the switch receptor comprises an extracellular domain associated with the negative signal, which is fused to the intracellular domain associated with the positive signal. In some embodiments, the switch receptor comprises an extracellular domain, a transmembrane domain, and an intracellular domain of a signaling protein associated with a negative signal. In some embodiments, the transmembrane domain of the switch receptor is selected from the transmembrane domain of a protein associated with a negative signal or the transmembrane domain of a protein associated with a negative signal. In some embodiments, the transmembrane domain of the switch receptor is selected from the transmembrane domain of a protein associated with a negative signal or the transmembrane domain of a protein associated with a negative signal. In some embodiments, the transmembrane domain of the switch receptor is selected from the transmembrane domain of a protein selected from CTLA4, PD-1, VSIG3, VSIG8, TGFβRII, BTLA, TIM-3, CD28, 4-1BB, IL12Rβ1, IL12Rβ2, CD2, ICOS, and CD27.

[0171] In some embodiments, the switch receptor is selected from PD-1-CD28, PD-1A132L-CD28, PD-1-CD27, PD-1A132L-CD27, PD-1-4-1BB, PD-1A132L-4-1BB, PD-1-ICOS, PD-1A132L-ICOS, PD-1-IL12Rβ1, PD-1A132L-IL12Rβ1, PD-1-IL12Rβ2, PD-1A132L-IL12Rβ2, VSIG3-CD28, VSIG8-CD28, VSIG 3-CD27, VSIG8-CD27, VSIG3-4-1BB, VSIG8-4-1BB, VSIG3-ICOS, VSIG8-ICOS, VSIG3-IL12Rβ1, VSIG8-IL12Rβ1, VSIG3-IL12 Rβ2, VSIG8-IL12Rβ2, TGFβRII-CD27, TGFβRII-CD28, TGFβRII-4-1BB, TGFβRII-ICOS, TGFβRII-IL12Rβ1, and TGFβRII-IL12Rβ2. 2. Dominant negative receptors

[0172] This disclosure provides a rapid and efficient manufacturing method for engineering modified immune cells, which include CAR, or exogenous TCR and dominant negative receptors. In some embodiments, CAR, TCR and / or switch receptors are encoded by one or more nucleic acids. In some embodiments, the lentiviral vector or retroviral vector disclosed herein includes one or more nucleic acid sequences encoding CAR, TCR and / or dominant negative receptors. In some embodiments, the nucleic acid sequence encoding CAR is operably connected to the nucleic acid sequence encoding the dominant negative receptor. In some embodiments, the dominant negative receptor enhances the efficiency of CAR or the cell expressing CAR.

[0173] As used herein, the term "dominant negative receptor" refers to a molecule designed to reduce the effect of a negative signal transduction molecule (e.g., the effect of a negative signal transduction molecule on the modified immune cells of the present disclosure). A dominant negative receptor is a truncated variant of a wild-type protein associated with a negative signal. In some embodiments, the protein associated with a negative signal is selected from CTLA4, PD-1, BTLA, TGFβRII, VSIG3, VSIG8, and TIM-3.

[0174] The dominant negative receptors of the present disclosure can bind to negative signal transduction molecules (e.g., CTLA4, PD-1, BTLA, TGFβRII, VSIG3, VSIG8, and TIM-3) with the help of extracellular domains associated with negative signals, which can reduce the effects of negative signal transduction molecules. For example, modified immune cells comprising dominant negative receptors can bind to negative signal transduction molecules in the microenvironment of the modified immune cells, but this binding does not transduce this signal inside the cell to change the activity of the modified T cells. On the contrary, the binding isolates the negative signal transduction molecules and prevents them from binding to endogenous receptors / ligands, thereby reducing the effects that negative signal transduction molecules may have on the modified immune cells. Therefore, in order to reduce the immunosuppressive effects of a certain molecule, immune cells can be modified to express dominant negative receptors that are dominant negative receptors.

[0175] In some embodiments, the dominant negative receptor includes a truncated variant of a wild-type protein associated with a negative signal. In some embodiments, the dominant negative receptor includes a variant of a wild-type protein associated with a negative signal, the variant comprising an extracellular domain, a transmembrane domain and substantially lacking an intracellular signaling domain. In some embodiments, the dominant negative receptor includes an extracellular domain and a transmembrane domain of a signaling protein associated with a negative signal. In some embodiments, the dominant negative receptor is a PD-1, CTLA4, BTLA, TGFβRII, VSIG3, VSIG8 or TIM-3 dominant negative receptor. In some embodiments, the dominant negative receptor is a PD-1 or TGFβRII dominant negative receptor. The permissible changes of the dominant negative receptor will be known to those skilled in the art while maintaining its intended biological activity (e.g., blocking negative signals and / or isolating molecules with negative signals when expressed in cells). G. As an immune enhancing factor Chemokines and cytokines for improved fitness

[0176] The present disclosure provides a rapid and efficient manufacturing method for engineering modified immune cells, which contain CAR or exogenous TCR and / or immune enhancing factors that improve the fitness of engineered immune cells. In some embodiments, the immune enhancing factor or its functional derivative is a polypeptide that enhances immune cell function.

[0177] In some embodiments, the polypeptide or functional derivative thereof that enhances immune cell function is selected from chemokines, chemokine receptors, cytokines, cytokine receptors, interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-21 (IL-21), interleukin-18 (IL-18), interleukin-18 receptor (IL-18R), CCL21, CCL19 or a combination thereof. In some embodiments, chemokines, chemokine receptors, cytokines, cytokine receptors, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, IL-18R, C-C motif chemokine ligand 21 (CCL21) or C-C motif chemokine ligand 19 (CCL19) are immune function enhancing factors that improve the fitness of the modified immune cells claimed. Without wishing to be bound by theory, the addition of nucleic acids encoding chemokines, chemokine receptors, cytokines, cytokine receptors, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, IL-18R, CCL21 or CCL19 to the modified immune cells of the present disclosure enhances the immune-induction and anti-tumor activity of the modified immune cells. 1. T cell infiltration

[0178] Without wishing to be bound by theory, interleukins and chemokines can promote T cell initiation and / or T cell infiltration in increased solid tumors. For example, in colorectal cancer (CRC) with microsatellite stability and low T cell infiltration, IL-15 promotes T cell initiation. In some embodiments, the combination of CAR and chemokine / interleukin receptor complex promotes T cell initiation. In addition, IL-15 can induce NK cell infiltration. In some embodiments, the response to the IL-15 / IL-15RA complex can result in NK cell infiltration. In certain embodiments, the modified immune cells described herein further comprise an IL-15 / IL-15Ra complex. In some embodiments, the IL-15 / IL-15Ra complex is selected from NIZ985 (Novartis), ATL-803 (Altor) or CYP0150 (Cytune). In some embodiments, the IL-15 / IL-15RA complex is NIZ985. In some embodiments, IL-15 stimulates natural killer cells to eliminate (e.g., kill) pancreatic cancer cells. In some embodiments, the therapeutic response to the modified immune cells described herein that further comprise IL-15 / IL15Ra is associated with natural killer cell infiltration in an animal model of colorectal cancer. In some embodiments, the IL-15 / IL-15Ra complex comprises human IL-15 complexed with a soluble form of human IL-15Ra. The complex can comprise IL-15 covalently or non-covalently bound to a soluble form of IL-15Ra. In specific embodiments, human IL-15 is non-covalently bound to a soluble form of IL-15Ra.

[0179] The ineffectiveness of CAR T cell therapy for solid tumors is partly due to the limited recruitment and accumulation of immune cells and CAR T cells in solid tumors. One approach to address this problem is to engineer CAR T cells that mimic the function of T-zone fibroblast reticular cells (FRCs). Lymph nodes are responsible for detecting pathogens and immunogens. The T zone contains three types of cells: (1) innate immune cells, such as dendritic cells, monocytes, macrophages, and granulocytes; (2) adaptive immune cells, such as CD4 and CD8 lymphocytes, and (3) stromal cells (FRCs). These cells work together to generate an effective immune response against pathogens by promoting the activation, differentiation, and maturation of CD4 T cells. FRCs are particularly important because they form a network that allows dendritic cells and T cells to migrate throughout the lymph nodes and attract B cells. In particular, FRC provides a network for the following: (i) naive T cells, B cells and dendritic cells are recruited to lymph nodes by releasing two chemokines (CCL21 and CCL19); (ii) T cells are kept alive by secreting IL-7 (a survival factor particularly for naive T cells); (iii) CD4 T cells are transported to germinal centers (GC; different parts of lymph nodes). Therefore, CAR armed with exogenous CCL21 or CCL19 and IL-7 will enhance the recruitment of T cells, B cells and dendritic cells to solid tumors. In some embodiments, the modified immune cells engineered by the methods disclosed herein include a lentiviral vector or a retroviral vector comprising a nucleic acid encoding an immune function enhancing factor and a CAR. In this embodiment, the nucleic acid encoding the immune function enhancing factor is a nucleic acid encoding interleukin-7 and a nucleic acid encoding CCL19 or CCL21.

[0180] In some embodiments, immune function enhancing factors (i.e., chemokines, chemokine receptors, cytokines, cytokine receptors, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, CCL21 or CCL19) nucleic acid and CAR fusion. In some embodiments, chemokines, chemokine receptors, cytokines, cytokine receptors, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, CCL21 or CCL19 are fused with CAR via self-cleavage peptides (such as P2A, T2A, E2A or F2A). 2. T cell activation (IL-18)

[0181] This disclosure provides a rapid and efficient manufacturing method for engineering modified immune cells, which include CAR or exogenous TCR and / or enhance the polypeptides (i.e., T cell activation polypeptides) that activate T cells. In some embodiments, the polypeptides that enhance T cell activation (ETP) are selected from costimulatory molecules, soluble cytokines, polypeptides involved in antigen presentation, polypeptides involved in transport and / or migration, or polypeptides involved in dendritic cell targeting, or functional fragments or variants thereof. In an embodiment, the T cell priming co-stimulatory molecule is selected from CD70, CD83, CD80, CD86, CD40, CD154, CD137L (4-1BBL), CD252 (OX40L), CD275 (ICOS-L), CD54 (ICAM-1), CD49a, CD43, CD48, CD112 (PVRL2), CD150 (SLAM), CD155 (PVR), CD265 (RANK), CD270 (HVEM), TL1A, CD127, IL-4R, GITR-L, CD160, CD258, TIM-4, CD153 (CD30L), CD200R (OX2R), CD44, its ligands and functional fragments and variants thereof. In an embodiment, the soluble cytokine is selected from the group consisting of IL-2, IL-12, IL-6, IL-7, IL-15, IL-18, IL-21, GM-CSF, IL-18, IL-21, IL-27, and functional fragments and variants thereof. In an embodiment, the polypeptide involved in antigen presentation is selected from the group consisting of CD64, MHC I, MHC II, and functional fragments and variants thereof. In an embodiment, the polypeptide involved in transport and / or migration is selected from the group consisting of CD183, CCR2, CCR6, CD50, CD197, CD58, CD62L, and functional fragments and variants thereof. In an embodiment, the polypeptide involved in DC targeting is selected from the group consisting of TLR ligands, anti-DEC-205 antibodies, anti-DC-SIGN antibodies, and functional fragments and variants thereof.

[0182] In some embodiments, the T cell priming polypeptide comprises the amino acid sequence of interleukin 2 (IL-2) (e.g., GenBank Accession No. AAB46833.1) or the nucleic acid sequence of IL-2 (e.g., GenBank Accession No. S82692.1). In some embodiments, the T cell priming polypeptide comprises the amino acid sequence of interleukin 12 (IL-12) (e.g., GenBank Accession No. AAD16432.1) or the nucleic acid sequence of IL-12 (e.g., GenBank Accession No. AF101062.1). In some embodiments, the T cell priming polypeptide comprises the amino acid sequence of interleukin 6 (IL-6) (e.g., GenBank Accession No. AAD13886.1 or NP_000591.1) or the nucleic acid sequence of IL-6 (e.g., GenBank Accession No. S56892.1 or NM_000600.3). In some embodiments, the T cell activating polypeptide comprises the amino acid sequence of interleukin 7 (IL-7) (e.g., GenBank Accession No. AAH47698.1 or NP_000871.1) or the nucleic acid sequence of IL-7 (e.g., GenBank Accession No. BC047698.1 or NM_000880.3). In some embodiments, the T cell activating polypeptide comprises the amino acid sequence of interleukin 15 (IL-15) (e.g., GenBank Accession No. AAU21241.1) or the nucleic acid sequence of IL-15 (e.g., GenBank Accession No. AY720442.1). In some embodiments, the T cell activating polypeptide comprises the amino acid sequence of interleukin 18 (IL-18) (e.g., GenBank Accession No. AAK95950.1) or the nucleic acid sequence of IL-18 (e.g., GenBank Accession No. AY044641.1). In some embodiments, the T cell activating polypeptide comprises the amino acid sequence of interleukin 21 (IL-21) (e.g., GenBank Accession No. AAG29348.1) or the nucleic acid sequence of IL-21 (e.g., GenBank Accession No. AF254069.1). In some embodiments, the T cell activating polypeptide comprises the amino acid sequence of GM-CSF (e.g., GenBank Accession No. AAA52578.1) or the nucleic acid sequence of GM-CSF (e.g., GenBank Accession No. M111220.1). In some embodiments, the T cell activating polypeptide is IL-18.

[0183] In some embodiments, in armed CAR T cells, expression of one or more CARs does not substantially affect the expression level of T cell priming polypeptides. In some embodiments, CAR comprises an antigen binding domain that binds to an antigen, and in armed CAR T cells, expression of T cell priming polypeptides does not substantially affect the expression level or cell killing function of one or more CARs.

[0184] In some embodiments, lentiviral vectors or retroviral vectors disclosed herein include and deliver more than one T cell activation polypeptide.In embodiments, lentiviral vectors or retroviral vectors include 2, 3, 4, 5, 6 or more nucleic acids encoding one or more T cell activation polypeptides; And further include a nucleic acid sequence encoding CAR. In some embodiments, in armed CAR T cells or armed immune cells expressing CAR, the co-delivery of one or more T cells activating polypeptides does not affect (for example, significantly reduce or significantly suppress) co-expressed CAR expression or activity. In some embodiments, CAR does not affect (for example, significantly reduce or significantly suppress) co-expressed T cell activation polypeptide expression or activity. III. Nucleic Acids and Expression Vectors A. Nucleic acid encoding CAR

[0185] The present disclosure provides nucleic acid molecules encoding one or more CAR constructs described herein. The nucleic acid molecule can be a messenger RNA transcript. The nucleic acid molecule can also be a DNA construct.

[0186] In one aspect, the present disclosure provides an isolated nucleic acid molecule encoding a chimeric antigen receptor (CAR), which may comprise a single-chain antibody or single-chain antibody fragment containing an anti-CD19 binding domain, a transmembrane domain, a co-stimulatory and intracellular signaling domain. In some embodiments, the anti-CD19 binding domain is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, or SEQ ID NO: 216. In some embodiments, the anti-CD 19 binding domain is encoded by a nucleic acid molecule isolated from a nucleic acid that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, or SEQ ID NO: 216. In some embodiments, the anti-CD 19 binding domain comprises the nucleotide sequence of SEQ ID NO: 21. In some embodiments, the anti-CD 19 binding domain comprises the nucleotide sequence of SEQ ID NO: 24. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO: 102. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO: 103. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO: 104. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO: 114. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO: 115. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO: 116. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO: 117.In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO: 118. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO: 119. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO: 120. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO: 216. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO: 225.

[0187] In some embodiments, the CAR comprises an anti-CD19 binding domain, which comprises a light chain variable domain, which comprises a light chain complementary determining region 1 (LC CDR1) of SEQ ID NO: 1, a light chain complementary determining region 2 (LC CDR2) of SEQ ID NO: 2, and a light chain complementary determining region 3 (LC CDR3) of SEQ ID NO: 3; and a heavy chain variable domain, which comprises a heavy chain complementary determining region 1 (HC CDR1) of SEQ ID NO: 4, a heavy chain complementary determining region 2 (HC CDR2) of SEQ ID NO: 5, and a heavy chain complementary determining region 3 (HC CDR3) of SEQ ID NO: 6.

[0188] In some embodiments, the CAR comprises an anti-CD19 binding domain, which comprises a light chain variable domain, which comprises a light chain complementary determining region 1 (LC CDR1) of SEQ ID NO: 193, a light chain complementary determining region 2 (LC CDR2) of SEQ ID NO: 194, and a light chain complementary determining region 3 (LC CDR3) of SEQ ID NO: 195; and a heavy chain variable domain, which comprises a heavy chain complementary determining region 1 (HC CDR1) of SEQ ID NO: 196, a heavy chain complementary determining region 2 (HC CDR2) of SEQ ID NO: 197, and a heavy chain complementary determining region 3 (HC CDR3) of SEQ ID NO: 198. In another embodiment, the anti-CD19 binding domain comprises a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3) disclosed in Table 2; and a heavy chain variable domain comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3) disclosed in Table 2.

[0189] The light chain variable region can comprise the amino acid sequence of SEQ ID NO: 7 or 199, or an amino acid sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the amino acid sequence of SEQ ID NO: 7 or 199. Alternatively, the heavy chain variable region can comprise the amino acid sequence of SEQ ID NO: 8 or 200, or an amino acid sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to the amino acid sequence of SEQ ID NO: 8 or 200.

[0190] In some embodiments, the anti-CD19 binding domain comprises a light chain variable region and a heavy chain variable region, the light chain variable region comprising the amino acid sequence of SEQ ID NO:7, and the heavy chain variable region comprising the amino acid sequence of SEQ ID NO:8.

[0191] In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO: 199 and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 200. In some embodiments, the CD19 binding domain can be a scFv.

[0192] In some embodiments, the anti-CD 19 binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 146, or a sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146.

[0193] In some embodiments, the anti-CD 19 binding domain comprises a light chain variable region or a heavy chain variable region encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, and SEQ ID NO: 216. The anti-CD 19 binding domain can comprise a light chain variable region or a heavy chain variable region encoded by a nucleic acid sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NOs: 19-24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, or SEQ ID NO: 216.

[0194] In some embodiments of the isolated nucleic acid molecules described herein, the transmembrane domain of the CAR can comprise a transmembrane domain of a protein selected from the group consisting of the alpha, beta or zeta chain of a T cell receptor, CD2, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8 and TLR9. In some embodiments, the transmembrane domain comprises an amino acid sequence selected from SEQ ID NO: 29, 31, or 33, or an amino acid sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 29, 31, or 33. In some embodiments, the transmembrane domain comprises a nucleic acid sequence selected from SEQ ID NO: 30, SEQ ID NO: 32, or SEQ ID NO: 34, or a sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 30, 32, or 34. In some embodiments, the transmembrane domain comprises a CD8 transmembrane domain and / or an amino acid sequence of SEQ ID NO: 29, or an amino acid sequence that is about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 29. In some embodiments, the transmembrane domain comprises a nucleic acid sequence of SEQ ID NO: 30, or a sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 30.

[0195] In some embodiments of the isolated nucleic acid molecules described herein, CAR further includes a hinge domain. In some embodiments, the anti-CD19 binding domain is connected to the membrane spaning domain by a hinge region as described herein. In some embodiments, the hinge region can be from a protein selected from the group consisting of: an Fc fragment of an antibody, a hinge region of an antibody, a CH2 region of an antibody, a CH3 region of an antibody, an artificial spacer sequence, an IgG hinge, a CD8 hinge, and any combination thereof.

[0196] In some embodiments of the isolated nucleic acid molecules described herein, the CAR comprises a costimulatory domain, which can be a functional signaling domain of a protein selected from the group consisting of: TNFR superfamily members, OX40 (CD134), CD2, CD5, CD7, CD27, CD28, CD30, CD40, PD-1, CD8, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD11a, CD18, ICOS (CD278), LIGHT, NKG2C, B7-H3, a ligand that specifically binds to CD83, DAP10, DAP12, Lck, Fas, and 4-1BB (CD137). In some embodiments, the costimulatory domain comprises an amino acid sequence selected from SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:46, SEQ ID NO:48, or SEQ ID NO:50, or a sequence about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO:37, 39, 41, 43, 46, 48, or 50. In some embodiments, the costimulatory domain comprises a nucleic acid sequence selected from SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:47, or SEQ ID NO:49, or a nucleic acid sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO:38, 40, 42, 44, 45, 47, or 49.

[0197] In some embodiments of the isolated nucleic acid molecules described herein, CAR may include an intracellular signaling domain. The signaling domain may be from a protein selected from the group consisting of CD3ζ, FcγRIII, FcsRI, the cytoplasmic tail of an Fc receptor, a cytoplasmic receptor with an immunoreceptor tyrosine activation motif (ITAM), TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. In this embodiment, the intracellular signaling domain comprises the intracellular signaling domain of CD3ζ, an amino acid sequence of SEQ ID NO: 52 or 54, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 52 or 54. Alternatively, the intracellular signaling domain comprises the nucleic acid sequence of SEQ ID NO: 53 or 55, or a sequence about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to SEQ ID NO: 53 or 55.

[0198] In some embodiments, the CAR comprises a functional 4-1BB costimulatory domain and a functional CD3 zeta intracellular signaling domain. In some embodiments, the CAR comprises an amino acid sequence of SEQ ID NO: 37, SEQ ID NO: 52 or SEQ ID NO: 54, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identity to an amino acid sequence of SEQ ID NO: 37, SEQ ID NO: 52 or SEQ ID NO: 54.

[0199] The intracellular signaling domain can comprise the sequence of SEQ ID NO: 37 and the sequence of SEQ ID NO: 52 or SEQ ID NO: 54, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 37, SEQ ID NO: 52, or SEQ ID NO: 54. These sequences can be expressed in the same frame as a single polypeptide chain. In some embodiments, the nucleic acid sequence comprises the sequence of SEQ ID NO: 38, or a sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 38. In some embodiments, the nucleic acid sequence comprises the sequence of SEQ ID NO:53 or SEQ ID NO:55, or a sequence that is about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to SEQ ID NO:53 or 55.

[0200] In some embodiments of the isolated nucleic acid molecules described herein, the CAR further comprises a leader sequence. The leader sequence can comprise the amino acid of SEQ ID NO: 25.

[0201] One aspect of the present disclosure provides an isolated nucleic acid molecule comprising an scFv containing an anti-CD19 binding domain as described herein. One aspect of the present disclosure provides an isolated nucleic acid molecule comprising a CAR comprising an anti-CD19 binding domain, a transmembrane domain, a costimulatory domain, and an intracellular domain as described herein. In some embodiments, the anti-CD19 binding domain may comprise a LC CDR1 of SEQ ID NO: 1, a LC CDR2 and a LC CDR3 of SEQ ID NO: 2, a HC CDR1 of SEQ ID NO: 4, a HC CDR2 of SEQ ID NO: 5, and a HC CDR3 of SEQ ID NO: 6; or a LC CDR1 of SEQ ID NO: 193, a LC CDR2 of SEQ ID NO: 194, a LC CDR3 of SEQ ID NO: 195; a HC CDR1 of SEQ ID NO: 196, a HC CDR2 of SEQ ID NO: 197, and a HC CDR3 of SEQ ID NO: 198; or any of the LC CDR1, LC CDR2, LC CDR3, HC CDR1, HC CDR2, and HC CDR3 disclosed in Table 2. The CDR3, the transmembrane domain is selected from the group consisting of CD28 or CD8 transmembrane domain, the costimulatory domain comprises an intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB; and the intracellular signaling domain comprises CD3-ζ or FcRγ.

[0202] In another embodiment, the anti-CD19 binding domain comprises a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3) disclosed in Table 2; and a heavy chain variable domain comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3) disclosed in Table 2.

[0203] One aspect of the present disclosure provides an isolated nucleic acid molecule comprising a CAR comprising an anti-CD19 binding domain, a transmembrane domain, a costimulatory domain, and an intracellular domain. The anti-CD19 binding domain comprises an amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146. The transmembrane domain is selected from a CD28 or CD8 transmembrane domain, the costimulatory domain may comprise an intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB; and the intracellular signaling domain comprises CD3-ζ or FcRγ.

[0204] One aspect of the present disclosure provides an isolated nucleic acid molecule comprising an scFv containing an anti-CD19 binding domain. One aspect of the present disclosure provides an isolated nucleic acid molecule comprising an CAR comprising an anti-CD19 binding domain (e.g., scFv), a transmembrane domain, a costimulatory domain, and an intracellular domain. The anti-CD 19 binding domain comprises the amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168 or 146; the transmembrane domain comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 29, 31 and 33; the costimulatory domain comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 46, SEQ ID NO: 48 and SEQ ID NO: 50; and the intracellular signaling domain comprises the amino acid sequence of SEQ ID NO: 52 or SEQ ID NO: 54.

[0205] One aspect of the present disclosure provides an isolated nucleic acid molecule comprising an anti-CD 19 binding domain comprising the amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; a transmembrane domain comprising the amino acid sequence of SEQ ID NO: 29; a costimulatory domain comprising the amino acid sequence of SEQ ID NO: 37; and Contains an intracellular signaling domain of SEQ ID NO: 52 or 54.

[0206] One aspect of the present disclosure provides an isolated nucleic acid comprising an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 66, 77, 88, 148, 170, 181, 203, 214, 159, 192, 23, and 20; and / or an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 65, 76, 87, 147, 169, 180, 202, 213, 158, 191, 22, and 19.

[0207] In one aspect of the present disclosure, an isolated nucleic acid is provided, comprising a sequence selected from the group consisting of: SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216.

[0208] One aspect of the present disclosure provides an isolated polypeptide molecule encoded by a nucleic acid molecule as described herein. The isolated polypeptide can comprise a sequence selected from the group consisting of SEQ ID NO: 63, 74, 85, 145, 167, 178, 200, 211, 156, 189, 17, 8, 62, 73, 84, 144, 166, 177, 199, 210, 155, 188, 16, and 7. B. Expression vector

[0209] One aspect of the present disclosure provides a vector (e.g., an expression vector) comprising the isolated nucleic acid. Another aspect of the present disclosure provides a vector comprising a first polynucleotide comprising a constitutive promoter operably connected to a nucleic acid encoding a chimeric antigen receptor (CAR) as described herein; and (b) a second polynucleotide comprising a nucleic acid encoding a polypeptide or a functional derivative thereof that enhances immune cell function.

[0210] In some embodiments, CAR includes single-chain antibodies or single-chain antibody fragments, transmembrane domains, costimulation and intracellular signaling domains containing anti-CD19 binding domains (e.g., P1-P13). In some embodiments, the first polynucleotide is operably connected to the second polypeptide via a linker peptide.

[0211] In some embodiments, the polypeptide or functional derivative thereof that enhances immune cell function can be selected from cytokines, interferons, chemokines, antibodies or antibody fragments, checkpoint inhibitor antagonists, dominant negative receptors, switch receptors, and combinations thereof.

[0212] In some embodiments, the polypeptide or its functional derivative that enhances immune cell function can be a chemokine, a chemokine receptor, a cytokine, a cytokine receptor, and a combination thereof. Alternatively, the polypeptide or its functional derivative that enhances immune cell function can be a cytokine selected from the following: interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-11 (IL-11), interleukin-12 (IL-12), interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-18 (IL-18), interleukin-18 receptor (IL-18R), interleukin-21 (IL-21), granulocyte macrophage colony stimulating factor, alpha, beta or gamma interferon, erythropoietin, and a combination thereof. The polypeptide or functional derivative thereof that enhances immune cell function may also be a chemokine selected from CCL21, CCL19, or a combination thereof. In some embodiments, the polypeptide or functional derivative thereof that enhances immune cell function is IL-18.

[0213] In some embodiments of the methods disclosed herein, the vector encodes a CAR comprising an anti-CD19 binding domain, wherein the anti-CD19 binding domain comprises a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3) disclosed in Table 2; and a heavy chain variable domain comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3) disclosed in Table 2. In some embodiments, the anti-CD 19 binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 146, or a sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 226, 201, 179, 168, and 146.

[0214] In another embodiment, the anti-CD 19 binding domain comprises: (a) a nucleic acid sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, and SEQ ID NO: 216; or (b) a nucleic acid sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, or SEQ ID NO: 216. ID NO: 216 has a sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical.

[0215] One aspect of the present disclosure provides a vector comprising: (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding an anti-CD19 chimeric antigen receptor (CAR), wherein the CAR comprises: (i) an anti-CD19 binding domain comprising: a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3) disclosed in Table 2; and a heavy chain variable domain comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3) disclosed in Table 2; CDR3); (ii) a transmembrane domain selected from the transmembrane domain of CD28 or CD8; (iii) a costimulatory domain comprising an intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB; and (iv) an intracellular signaling domain comprising CD3-ζ; and (b) a second polynucleotide comprising a nucleic acid encoding interleukin-18 (IL-18) and / or interleukin-18 receptor (IL-18R).

[0216] In some embodiments, the first polynucleotide is operably linked to the second polypeptide via a linker peptide selected from the group consisting of: F2A, E2A, P2A, T2A, and furin-(G4S)2-T2A (F-GS2-T2A).

[0217] In some embodiments, the anti-CD19 binding domain comprises LC CDR1 of SEQ ID NO:1, LC CDR2 and LC CDR3 of SEQ ID NO:2, HC CDR1 of SEQ ID NO:4, HC CDR2 of SEQ ID NO:5, and HC CDR3 of SEQ ID NO:6; or (2) LC CDR1 of SEQ ID NO:193, LC CDR2 of SEQ ID NO:194, LC CDR3 of SEQ ID NO:195; HC CDR1 of SEQ ID NO:196, HC CDR2 of SEQ ID NO:197, and HC CDR3 of SEQ ID NO:198.

[0218] The vector may be selected from DNA, RNA, plasmid, lentiviral vector, adenoviral vector or retroviral vector.

[0219] Lentiviral vectors can be based on a virus selected from the group consisting of retroviruses, alpharetroviruses, betaretroviruses, gammaretroviruses, deltaretroviruses, and epsilonretroviruses. For example, lentiviral vectors can be based on human immunodeficiency virus (HIV), equine infectious anemia virus (EIAV), visna-maedi virus (VMV), caprine arthritis-encephalitis virus (CAEV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), visna virus, and simian immunodeficiency virus (SIV). In some embodiments, the lentiviral vector can be pseudotyped with an envelope glycoprotein (Env) from a virus selected from the group consisting of: murine leukemia virus (MLV), vesicular stomatitis virus (VSV) Indiana strain, VSV New Jersey strain, Cocal virus, Chandipura virus, Piri virus, Spring carp viremia virus (SVCV), Sigma virus, infectious hematopoietic necrosis virus (IHNV), Mokola virus, rabies virus CVS virus, Isfahan virus, Alagoas virus, Kalchagi virus, Jurona virus, La Jolla virus, Maraba virus, feline endogenous retrovirus (RD114) envelope protein, Perinet virus, Ug Bogdanovchi virus, prototype foamy virus (PFV), and gibbon ape leukemia virus (GaLV). In some embodiments, the lentiviral vector can be pseudotyped with an envelope glycoprotein (Env) selected from the group consisting of: vesicular stomatitis virus (VSV) Indiana strain, VSV New Jersey strain, and Cocal virus.

[0220] In some embodiments of the lentiviral vectors described herein, the viral envelope protein (Env) comprises a VSV-G glycoprotein selected from the group consisting of: Indiana strain VSV-G, New Jersey strain VSV-G, Kocal virus envelope protein, Isfahan virus envelope protein, Chandipura virus envelope protein, Pili virus envelope protein, murine leukemia virus (MLV) envelope glycoprotein, SVCV virus envelope protein, and variants thereof. The lentiviral vector may further comprise a nucleotide sequence encoding a heterologous VSV-G envelope protein.

[0221] The heterologous VSV G envelope protein can be codon-optimized for human expression. Alternatively, the heterologous VSV G envelope protein can be a VSV G protein variant. In some embodiments, the lentiviral vector comprises a nucleotide sequence encoding a VSV-G envelope protein or a VSV G protein variant.

[0222] In some embodiments of the lentiviral vectors described herein, the heterologous envelope protein can be under the control of a transcriptional regulatory element. The transcriptional regulatory element can be a promoter selected from a eukaryotic promoter or a constitutive promoter.

[0223] The lentiviral vectors described herein may further comprise a transcriptional regulatory element, and the transcriptional regulatory element may be upstream of the heterologous envelope glycoprotein (i.e., in the 5' direction of the nucleotide sequence encoding the heterologous envelope glycoprotein). For example, the transcriptional regulatory element may control the expression (i.e., transcription and therefore, but optionally translation) of the nucleic acid encoding the heterologous envelope glycoprotein. In some embodiments, the transcriptional regulatory element has constitutive activity or is a constitutive promoter. In exemplary embodiments, the constitutively active transcriptional regulatory element or constitutive promoter may be a cytomegalovirus (CMV) promoter, such as the CMV major immediate early promoter (CMV IE1), a mouse stem cell virus promoter, an elongation factor-1α promoter (EF-1α), a viral simian virus 40 (SV40) (e.g., early or late), Moloney murine leukemia virus (MoMLV), an ubiquitin C promoter, a phosphoglycerol kinase (PGK) promoter, a Rous sarcoma virus (RSV), or a herpes simplex virus (HSV) (thymidine kinase) promoter.

[0224] In other embodiments, the activity of the transcriptional regulatory element can be inducible, or the promoter can be an inducible promoter. In some embodiments, the transcriptional regulatory element can be a eukaryotic promoter, such as the phosphoglycerate kinase promoter. Other transcriptional regulatory elements (including prokaryotic and eukaryotic, constitutive and inducible promoters and replication origins) are known in the art.

[0225] In some embodiments, the lentiviral vectors described herein can be constructed and arranged so that the expression of proteins, enzymes, and viral elements (i.e., cis-acting genes and trans-acting genes) necessary for producing retroviral particles is under the control of transcriptional regulatory elements. In preferred embodiments, the lentiviral vector may further comprise a transcriptional regulatory element, and the transcriptional regulatory element is upstream (i.e., in the 5' direction) of the proteins, enzymes, and viral elements (i.e., cis-acting genes and trans-acting genes) necessary for producing retroviral particles, and optionally, the transcriptional regulatory element controls the expression (i.e., transcription or translation) of nucleic acids encoding proteins, enzymes, and viral elements (i.e., cis-acting genes and trans-acting genes) necessary for producing retroviral particles. In some embodiments, the transcriptional regulatory element may have constitutive activity or may be a constitutive promoter.

[0226] In some embodiments, the lentiviral vectors and nucleic acids encoding heterologous envelope proteins described herein can be amplified or produced prior to introduction into producer cells and, therefore, prior to production of viral particles. In some embodiments, the lentiviral vectors and nucleic acids encoding other proteins, enzymes, and elements necessary for retroviral particle production can be amplified or produced prior to introduction into producer cells and, therefore, prior to production of retroviral proteins.

[0227] In some embodiments, the lentiviral vector and the nucleic acid encoding the heterologous envelope protein can be constructed and arranged so that the transcriptional control element drives the transcription of the heterologous envelope protein in the production cell and thereby drives the translation to promote the production of lentiviral particles. In some embodiments, the lentiviral vector and the nucleic acid encoding the proteins, enzymes, viral elements (i.e., cis- and trans-acting genes, including rev and gag / pol) necessary for the production of retroviral particles can be structured and arranged so that the transcriptional control element can drive the transcription of the proteins, enzymes, viral elements (i.e., cis- and trans-acting genes, including rev and gag / pol) in the production cell and thereby drive their translation, thereby allowing the production cell to produce retroviral particles.

[0228] In some embodiments, retrovirus or lentiviral vector as described herein include transcriptional regulatory elements. In some embodiments, the transcriptional regulatory element is a promoter selected from a eukaryotic promoter or a constitutive promoter. Physiological promoters (e.g., EF-1α promoters) may be less likely to induce integration-mediated genotoxicity and can eliminate the ability of retroviral vectors to transform stem cells. Other physiological promoters suitable for use in retroviral vectors or lentiviral vectors are known to those skilled in the art and can be incorporated into the exemplary embodiments of nucleic acid vectors. In some embodiments, the promoter is elongation factor-1-α promoter (EF-1α promoter). The use of EF-1α promoters can increase the expression efficiency of downstream transgenics (e.g., nucleic acid sequences encoding TCR and / or CAR).

[0229] In some embodiments, the lentiviral or retroviral vector further comprises a non-essential cis-acting sequence that can improve titer and gene expression. A non-limiting example of a non-essential cis-acting sequence is a central polypurine tract and central termination sequence (cPPT / CTS), which are important for efficient reverse transcription and nuclear import. Other non-essential cis-acting sequences are known to those skilled in the art and can be incorporated into lentiviral or retroviral vector particles.

[0230] In some embodiments, the lentiviral vectors or retroviral vectors disclosed herein further comprise a post-transcriptional regulatory element. Post-transcriptional regulatory elements can improve RNA translation, improve transgene expression, and stabilize RNA transcripts. An example of a post-transcriptional regulatory element is the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). Therefore, in some embodiments, the nucleic acid vector further comprises a WPRE sequence. Various post-transcriptional regulatory elements are known to those skilled in the art and can be incorporated into lentiviral vectors or retroviral vectors.

[0231] The lentiviral vector or retroviral vector disclosed herein may further include additional elements, such as rev response element (RRE) for RNA transport, packaging sequence and 5' and 3' long terminal repeats (LTR). The term "long terminal repeat" or "LTR" refers to the domain of the base pairs located at the end of the retroviral DNA, which includes U3, R and U5 regions. LTR generally provides the functions required for retroviral gene expression (for example, promotion, initiation and polyadenylation of gene transcripts) and viral replication. In one embodiment, the lentiviral vector or retroviral vector include the LTR (a non-functional LTR) of 3'U3 deletions and / or lack functional 3' or 5'LTR. Therefore, the lentiviral vector or retroviral vector disclosed herein may include any combination of elements described herein for enhancing the functional expression efficiency of transgenic. For example, in addition to the nucleic acid encoding TCR or CAR, the lentiviral vector or retroviral vector may include WPRE sequence, cPPT sequence, RRE sequence, 5'LTR, 3'U3 deletions'LTR.

[0232] In some embodiments, the promoter further comprises a promoter, a rev response element (RRE), a poly (A) tail, a 3'UTR, a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); and / or a cPPT sequence. The promoter may be a constitutive promoter. In some embodiments, the promoter is selected from the group consisting of an EF-1α promoter, a PGK-1 promoter, a truncated PGK-1 promoter, a UBC promoter, a CMV promoter, a CAGG promoter, and an SV40 promoter. However, other constitutive promoter sequences may also be used, including but not limited to simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, and human gene promoters (for example, but not limited to, actin promoter, myosin promoter, elongation factor-1a promoter, hemoglobin promoter, and creatine kinase promoter). In addition, the present disclosure should not be limited to the use of constitutive promoters. Inducible promoters are also considered as part of the present disclosure. The use of inducible promoters provides a molecular switch that can turn on expression of an operably linked polynucleotide sequence when expression is desired, or turn off expression when expression is not desired. Examples of inducible promoters include, but are not limited to, metallothionein promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters. In some embodiments, the promoter is the EF-1 promoter. The promoter can comprise the sequence of SEQ ID NO: 101.

[0233] In some embodiments, the vector comprises an isolated nucleic acid molecule comprising a CAR described herein, which is operably linked via a linker peptide to a nucleic acid sequence encoding a switch receptor, a dominant negative receptor, or a polypeptide or functional derivative that can enhance immune cell function.

[0234] In some embodiments, the linker peptide is selected from F2A, E2A, P2A, T2A or furin-(G4S)2-T2A (F-GS2-T2A). Alternatively, the linker can comprise the amino acid sequence of SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96 or SEQ ID NO: 99. The linker can comprise the nucleic acid sequence of SEQ ID NO: 93, 95, 97 or 98. C. Methods for Introducing Nucleic Acids into Cells

[0235] Methods for introducing nucleic acids into cells include physical, biological, chemical methods and combinations thereof. An expression vector comprising a nucleic acid of the present disclosure can be introduced into a host cell by any means known to those skilled in the art. If desired, the expression vector can comprise viral sequences for transfection. Alternatively, the expression vector can be introduced by fusion, electroporation, gene gun method (e.g., gene gun), transfection, liposome transfection (e.g., cationic liposome), polymer encapsulation, and the like. Prior to the introduction of the expression vector, the host cell (e.g., immune cell or CD4 T cell) can be injected into the host cell. + and CD8 + Cells) can be grown and expanded in culture and then appropriately treated to introduce and integrate the vector. Host cells (e.g., immune cells) can then be expanded and screened for markers present in the vector. Methods for generating cells containing vectors and / or exogenous nucleic acids are well known in the art.

[0236] In some embodiments, host cells (e.g., immune cells, CD4 T cells, and CD8 T cells) can be modified using any method known in the art (e.g., activation, expansion, induction of apoptosis, genetic manipulation, induction of antigen specificity). + and CD8 + cells) or host cell populations (e.g., immune cells or CD4 + and CD8 + In some embodiments, host cells (e.g., immune cells, CD4 T cells, CD8 T cells, CD9 T cells, CD10 T cells, CD11 T cells, CD12 T cells, CD16 T cells, CD17 T cells, CD18 T cells, CD19 T cells, CD20 T cells, CD21 T cells, CD22 T cells, CD23 T cells, CD24 T cells, CD25 T cells, CD26 T cells, CD27 T cells, CD28 T cells, CD29 ... + and CD8 + cells) or host cell populations (e.g., immune cells or CD4 + and CD8+ In some embodiments, the introduction of exogenous nucleic acid molecules comprises viral transfection (transduction), non-viral transfection, electroporation, lipofection, cationic lipid-mediated transfection using lipofection, polymer encapsulation, peptide-mediated transfection, or a biolistic particle delivery system such as a "gene gun."

[0237] Regardless of the method used to introduce the isolated nucleic acid molecules described herein into host cells or otherwise expose cells to the CD19 CAR of the present invention, in order to confirm the presence of nucleic acid in the host cell, a variety of determinations can be performed. Such determinations include, for example, molecular biological determinations well known to those skilled in the art, such as Southern blotting and Northern blotting, RT-PCR and PCR; biochemical determinations, such as detecting the presence or absence of specific peptides, for example, by immunological means (ELISA and Western blotting); or by determinations as described herein to identify agents falling within the scope of the present invention.

[0238] In addition, nucleic acid can be introduced by any means, such as transduction of amplified host cells (e.g., immune cells), transfection of amplified host cells (e.g., immune cells), and electroporation of amplified host cells (e.g., immune cells). An isolated nucleic acid molecule can be introduced by one method, and another nucleic acid can be introduced into a host cell (e.g., immune cell) by a different method. 1. Biological methods

[0239] Biological methods for introducing a polynucleotide of interest into a host cell (e.g., an immune cell) include the use of DNA and RNA vectors. Viral vectors, particularly retroviral vectors (viral transfection), have become the most widely used methods for inserting genes into mammalian (e.g., human) cells. Viral vectors can be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, and adeno-associated viruses, among others.

[0240] In some embodiments, the nucleic acid of the theme polypeptide of coding theme CAR, theme engineering TCR, theme KIR, theme antigen-binding polypeptides, theme cell surface receptor ligand, theme tumor antigen, theme switch receptor, theme dominant negative receptor and / or enhancing immune function (for example, T cell starts or T cell infiltration) is introduced into the cell with expression vector (viral transfection). Provided herein is an expression vector (for example, lentiviral vector or retroviral vector) for the nucleic acid of the theme polypeptide of coding theme CAR, theme engineering TCR, theme KIR, theme antigen-binding polypeptides, theme cell surface receptor ligand, theme tumor antigen, theme switch receptor, theme dominant negative receptor and / or enhancing immune function (for example, T cell starts or T cell infiltration).Suitable expression vector includes lentiviral vector, gamma retroviral vector, foamy virus vector, adeno-associated virus (AAV) vector, adenoviral vector, engineered hybrid virus, naked DNA, including but not limited to transposon-mediated vector, such as Sleeping Beauty, Piggyback and integrase (such as Phi31). Some other suitable expression vectors include herpes simplex virus (HSV) and retroviral expression vectors.

[0241] In some embodiments, the nucleic acid encoding theme CAR (for example, CD-19CAR), theme engineered TCR, theme KIR, theme antigen binding polypeptides, theme cell surface receptor ligands, theme tumor antigens, theme switch receptors, theme dominant negative receptors and / or enhance immune function (for example, T cell starts or T cell infiltration) theme polypeptides are introduced into immune cells by viral transduction. In some embodiments, viral vectors are selected from retroviral vectors, Sendai virus vectors, adenoviral vectors, adeno-associated virus vectors and lentiviral vectors. Various markers that can be used are known in the art, and can include hprt, neomycin resistance, thymidine kinase, hygromycin resistance, etc.

[0242] The modified immune cells, CD4 + and CD8 + cells or immune cells or CD4 + and CD8 + Cell populations (e.g., comprising nucleic acids encoding a subject CAR, a subject engineered TCR, a subject KIR, a subject antigen-binding polypeptide, a subject cell surface receptor ligand, a subject tumor antigen, a subject switch receptor, a subject dominant negative receptor, and / or a subject polypeptide that enhances immune function (e.g., T cell priming or T cell infiltration)) can be generated by stably transfecting host cells (e.g., immune cells) with an expression vector comprising a nucleic acid of the present disclosure.

[0243] The cells (i.e. immune cells) expressing the nucleic acid encoding CAR, KIR, TCR, KIR, antigen-binding polypeptides, cell surface receptor ligands, tumor antigens, theme switch receptors, theme dominant negative receptors and / or theme polypeptides that enhance immune function (e.g., T cell activation or T cell infiltration) of the present disclosure can be expanded in vitro. In some embodiments, the cells (i.e. immune cells) expressing the nucleic acid encoding CAR, KIR, TCR, KIR, antigen-binding polypeptides, cell surface receptor ligands, tumor antigens, theme switch receptors, theme dominant negative receptors and / or theme polypeptides that enhance immune function (e.g., T cell activation or T cell infiltration) of the present disclosure are not expanded in vitro.

[0244] Additional methods for generating modified cells of the present disclosure include, but are not limited to, chemical transformation methods (e.g., using calcium phosphate, dendrimers, liposomes, and / or cationic polymers), non-chemical transformation methods (e.g., electroporation, optical transformation, gene electrotransfer, and / or hydrodynamic delivery), and / or particle-based methods (e.g., puncture transfection, use of a gene gun, and / or magnetofection). 2. Physical methods

[0245] Physical methods for introducing polynucleotides (RNA or DNA) or expression vectors into host cells (e.g., immune cells) include lipofection, particle bombardment, microinjection, electroporation, etc. Commercially available methods can be used to introduce expression vectors or polynucleotides into target cells, including electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), ECM 830 (BTX) (Harvard Instruments, Boston, MA) or Gene Pulser II (BioRad, Denver, CO), Multiporator (Eppendorf, Hamburg, Germany).

[0246] Regardless of the method used to introduce the isolated nucleic acid molecules described herein into host cells or otherwise expose cells to the CD19 CAR of the present invention, in order to confirm the presence of nucleic acid in the host cell, a variety of determinations can be performed. Such determinations include, for example, molecular biological determinations well known to those skilled in the art, such as Southern blotting and Northern blotting, RT-PCR and PCR; biochemical determinations, such as detecting the presence or absence of specific peptides, for example, by immunological means (ELISA and Western blotting); or by determinations as described herein to identify agents falling within the scope of the present invention.

[0247] In addition, nucleic acid can be introduced by any means, such as transduction of amplified host cells (e.g., immune cells), transfection of amplified host cells (e.g., immune cells), and electroporation of amplified host cells (e.g., immune cells). An isolated nucleic acid molecule can be introduced by one method, and another nucleic acid can be introduced into a host cell (e.g., immune cell) by a different method. IV. CAR T cells

[0248] One aspect of the present disclosure provides a modified cell, a modified immune cell, or a modified CD4 + and CD8 + The modified cells are modified immune cells, modified natural killer (NK) cells, modified natural killer T (NKT) cells or modified T cells. The modified cells are modified T cells or modified human T cells. The modified T cells can be CD8 + T cells. The modified cells contemplated herein can be autologous, xenogeneic, or allogeneic cells.

[0249] In some embodiments, the modified cells (e.g., modified immune cells or modified CD4 + and CD8 + The cell) comprises a chimeric antigen receptor (CAR) comprising a single-chain antibody or single-chain antibody fragment comprising an anti-CD19 binding domain, a transmembrane domain, a costimulatory and intracellular signaling domain

[0250] In some embodiments, the modified cells (e.g., modified immune cells or modified CD4 + and CD8 +In some embodiments, the cell comprises an isolated nucleic acid molecule described herein. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, and SEQ ID NO: 216. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO:21, 24SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216.

[0251] In some embodiments, the modified cells (e.g., modified immune cells or modified CD4 + and CD8 + cells) comprises an isolated polypeptide encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216.

[0252] In some embodiments, the modified cells (e.g., modified immune cells or modified CD4 + and CD8 +Cells) comprise a CAR comprising a single-chain antibody or single-chain antibody fragment containing an anti-CD19 binding domain, a transmembrane domain, a co-stimulatory and intracellular signaling domain. In this embodiment, the anti-CD19 binding domain comprises a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1) of SEQ ID NO: 1, a light chain complementary determining region 2 (LC CDR2) of SEQ ID NO: 2, and a light chain complementary determining region 3 (LC CDR3) of SEQ ID NO: 3; and a heavy chain variable domain comprising a heavy chain complementary determining region 1 (HC CDR1) of SEQ ID NO: 4, a heavy chain complementary determining region 2 (HC CDR2) of SEQ ID NO: 5, and a heavy chain complementary determining region 3 (HC CDR3) of SEQ ID NO: 6. In another embodiment, the anti-CD19 binding domain comprises a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1) of SEQ ID NO: 193, a light chain complementary determining region 2 (LC CDR2) of SEQ ID NO: 194, and a light chain complementary determining region 3 (LC CDR3) of SEQ ID NO: 195; and a heavy chain variable domain comprising a heavy chain complementary determining region 1 (HC CDR1) of SEQ ID NO: 196, a heavy chain complementary determining region 2 (HC CDR2) of SEQ ID NO: 197, and a heavy chain complementary determining region 3 (HC CDR3) of SEQ ID NO: 198. In another embodiment, the anti-CD19 binding domain comprises a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3) disclosed in Table 2; and a heavy chain variable domain comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3) disclosed in Table 2.

[0253] In some embodiments, the anti-CD 19 binding domain comprises a light chain variable region comprising the amino acid sequence of SEQ ID NO: 7 or 199; or an amino acid sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 7 or 199; and / or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 8 or 200, or an amino acid sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 8 or 200.

[0254] In some embodiments, the modified cells (e.g., modified immune cells or modified CD4 + and CD8 + Cells) comprise a CAR comprising a light chain variable region comprising the amino acid sequence of SEQ ID NO: 7 and a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 8. Alternatively, the light chain variable region comprises the amino acid sequence of SEQ ID NO: 199 and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 200. In some embodiments, the modified cell (e.g., a modified immune cell or a modified CD4 + and CD8 + The cell) comprises a CAR comprising a CD-19 scFv. The anti-CD19 binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 146, or a sequence having 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146.

[0255] In some embodiments, the modified cells (e.g., modified immune cells or modified CD4 + and CD8 +The cell) comprises a CAR comprising an anti-CD 19 binding domain encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO: 21 and SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, and SEQ ID NO: 216. In some embodiments, the anti-CD 19 binding domain is encoded by a nucleic acid sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 21 or 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, or SEQ ID NO: 216.

[0256] In some embodiments, the modified cells (e.g., modified immune cells or modified CD4 + and CD8 +The invention further comprises a cell) comprising a CAR comprising an anti-CD 19 binding domain comprising a light chain variable region or a heavy chain variable region encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, and SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, and SEQ ID NO: 216. Alternatively, the anti-CD 19 binding domain comprises a light chain variable region or a heavy chain variable region encoded by a nucleic acid sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to SEQ ID NOs: 19-24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225 or SEQ ID NO: 216.

[0257] In some embodiments, the modified cells (e.g., modified immune cells or modified CD4 + and CD8 +A cell) comprises a CAR comprising an anti-CD 19 binding domain and a transmembrane domain, wherein the anti-CD 19 binding domain comprises a light chain variable region or a heavy chain variable region encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225 and SEQ ID NO: 226. NO:216, and the transmembrane domain comprises a transmembrane domain of a protein selected from the group consisting of: α, β or ζ chain of a T cell receptor, CD2, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD 154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8 and TLR9. In this embodiment, the transmembrane domain can comprise an amino acid sequence selected from SEQ ID NO: 29, 31, or 33, or an amino acid sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 29, 31, or 33. Alternatively, the transmembrane domain can comprise a nucleic acid sequence selected from SEQ ID NO: 30, SEQ ID NO: 32, or SEQ ID NO: 34, or a sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 30, 32, or 34. The transmembrane domain can comprise a CD8 transmembrane domain and / or the amino acid sequence of SEQ ID NO: 29; or an amino acid sequence that is about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to SEQ ID NO: 29.The transmembrane domain can comprise the nucleic acid sequence of SEQ ID NO:30, or a sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO:30.

[0258] In some embodiments, the modified cells (e.g., modified immune cells or modified CD4 + and CD8 +The invention further comprises a cell) comprising a CAR comprising an anti-CD19 binding domain comprising a light chain variable region or a heavy chain variable region encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225 and SEQ ID NO: 216; and the anti-CD19 binding domain can be connected to the transmembrane domain by a hinge region. The hinge region may be derived from a protein selected from the group consisting of an Fc fragment of an antibody, a hinge region of an antibody, a CH2 region of an antibody, a CH3 region of an antibody, an artificial spacer sequence, an IgG hinge region, a CD8 hinge, and any combination thereof. The hinge may comprise the amino acid sequence of SEQ ID NO: 27 or SEQ ID NO: 35, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 27 or 35. The hinge region may comprise the CD8 hinge region and / or the amino acid sequence of SEQ ID NO: 27, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 27. In this embodiment, the CAR further comprises a functional signaling domain (e.g., a co-stimulatory domain) of a protein selected from the group consisting of: TNFR superfamily members, OX40 (CD134), CD2, CD5, CD7, CD27, CD28, CD30, CD40, PD-1, CD8, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD11a, CD18, ICOS (CD278), LIGHT, NKG2C, B7-H3, a ligand that specifically binds to CD83, DAP10, DAP12, Lck, Fas, and 4-1BB (CD137).

[0259] In some embodiments, the modified cells (e.g., modified immune cells or modified CD4 + and CD8 +cells) include CD19-4BBz CAR, CD19CD2z, CD19CD2z CAR, CD19CD27z CAR, CD19Ox40z CAR, CD1928z YMFM, CD19ICOSz, and CD19ICOS-1z.

[0260] One aspect of the present disclosure provides a modified cell, a modified immune cell, or a modified CD4 + and CD8 + Cells comprising a chimeric antigen receptor (CAR) comprising an anti-CD19 binding domain, a switch receptor, a dominant negative receptor, and / or a polypeptide that enhances immune cell function. In some embodiments, the switch receptor comprises a first polypeptide conjugated to a second polypeptide, the first polypeptide comprising at least a portion of an inhibitory molecule selected from PD1, TGFβR, TIM-2, and BTLA, the second polypeptide comprising a positive signal from an intracellular signaling domain selected from OX40, CD27, CD28, IL-12R, ICOS, and 4-1BB. In some embodiments, the switch receptor is selected from PD-1-CD28, PD-1A132L-CD28, PD-1-CD27, PD-1A132L-CD27, PD-1-4-1BB, PD-1A132L-4-1BB, PD-1-ICOS, PD-1A132L-ICOS, PD-1-IL12Rβ1, PD-1A132L-IL12Rβ1, PD-1-IL12Rβ2, PD-1A132L-IL12Rβ2, VSIG3-CD28, VSIG8-CD28, VSIG 3-CD27, VSIG8-CD27, VSIG3-4-1BB, VSIG8-4-1BB, VSIG3-ICOS, VSIG8-ICOS, VSIG3-IL12Rβ1, VSIG8-IL12Rβ1, VSIG3-IL12 Rβ2, VSIG8-IL12Rβ2, TGFβRII-CD27, TGFβRII-CD28, TGFβRII-4-1BB, TGFβRII-ICOS, TGFβRII-IL12Rβ1, and TGFβRII-IL12Rβ2.

[0261] In some embodiments, the dominant negative receptor comprises a truncated variant of a receptor selected from PD1, TGFβR, TIM-2, and BTLA. In some embodiments, the dominant negative receptor is a PD-1, CTLA4, BTLA, TGFβRII, VSIG3, VSIG8, or TIM-3 dominant negative receptor.

[0262] In some embodiments, the polypeptide or functional derivative thereof that enhances immune cell function is selected from chemokines, chemokine receptors, cytokines, cytokine receptors, interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-21 (IL-21), interleukin-18 (IL-18), interleukin-18 receptor (IL-18R), CCL21, CCL19 or a combination thereof. In some embodiments, chemokines, chemokine receptors, cytokines, cytokine receptors, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, IL-18R, C-C motif chemokine ligand 21 (CCL21) or C-C motif chemokine ligand 19 (CCL19) are immune function enhancing factors that improve the fitness of the modified immune cells claimed. Without wishing to be bound by theory, the addition of nucleic acids encoding chemokines, chemokine receptors, cytokines, cytokine receptors, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, IL-18R, CCL21 or CCL19 to the modified immune cells of the present disclosure enhances the immune-induction and anti-tumor activity of the modified immune cells.

[0263] In some embodiments, the polypeptide or functional derivative thereof that enhances immune cell function is selected from chemokines, chemokine receptors, cytokines, cytokine receptors, interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-21 (IL-21), interleukin-18 (IL-18), interleukin-18 receptor (IL-18R), CCL21, CCL19, and combinations thereof.

[0264] In some embodiments, the modified cell, modified immune cell, or modified CD4 + and CD8 + The cell comprises a CAR (e.g., a CD19 CAR), an engineered TCR (e.g., a CD19 TCR), a KIR (CD19 KIR), an antigen binding polypeptide, a cell surface receptor ligand, a tumor antigen, a switch receptor, a dominant negative receptor, and / or a polypeptide that enhances immune function (e.g., T cell priming or T cell infiltration).

[0265] In some embodiments, the polypeptide that enhances immune function is selected from a chemokine, a chemokine receptor, a cytokine, a cytokine receptor, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, IL-18R, CCL21, CCL19, or a combination thereof.

[0266] Another aspect of the present disclosure provides a modified cell population, a modified immune cell population, or a modified CD4 + and CD8 + A cell population comprising a lentiviral vector as described herein. In some embodiments, the engineered modified CD4 + and CD8 + The cells are used to produce a protein of interest (e.g., CD19 CAR).

[0267] In the engineered modified CD4 + and CD8 + In some embodiments of the cell, the protein of interest can be selected from industrial proteins or therapeutic proteins. In some embodiments, the protein of interest can be selected from enzymes, regulatory proteins, receptors, peptides, peptide hormones, cytokines, membrane or transport proteins, vaccine antigens, antigen binding proteins, immunostimulatory proteins, allergens, full-length antibodies or antibody fragments or derivatives; single-chain antibodies (scFv), Fab fragments, Fv fragments, single domain antibodies (VH or VL fragments), domain antibodies, camelid single domain antibodies (VHH), nanobodies and combinations thereof.

[0268] One aspect of the present disclosure provides a method for preparing a modified cell, the method comprising transfecting a cell with an isolated nucleic acid molecule as described herein. In some embodiments, the isolated nucleic acid molecule encodes a CAR as described herein. In some embodiments, the isolated nucleic acid molecule comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, and SEQ ID NO: 216.

[0269] In some embodiments, the isolated nucleic acid molecule comprises a nucleic acid sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216.

[0270] One aspect of the present disclosure provides a method of making a modified cell, the method comprising transfecting a cell with a nucleic acid encoding an anti-CD 19 binding domain as described herein; or a vector comprising an isolated nucleic acid as described herein. V. Methods for Generating Modified T Cells

[0271] One aspect of the present disclosure provides a method for manufacturing an engineered immune cell group comprising a novel CD19 binding agent disclosed herein. Another aspect of the present disclosure provides a method for preparing a modified cell, comprising transfecting cells with any vector described herein. In some embodiments, the carrier comprises a first polynucleotide comprising a constitutive promoter operably connected to a nucleic acid encoding a chimeric antigen receptor (CAR); and (b) a second polynucleotide comprising a nucleic acid encoding a polypeptide or a functional derivative thereof that enhances immune cell function. In this embodiment, CAR comprises a single-chain antibody or a single-chain antibody fragment, a transmembrane domain, costimulation, and an intracellular signaling domain containing an anti-CD19 binding domain. In some embodiments, the first polynucleotide is operably connected to the second polypeptide via a linker peptide.

[0272] In some embodiments, the polypeptide or functional derivative thereof that enhances immune cell function can be selected from cytokines, interferons, chemokines, antibodies or antibody fragments, checkpoint inhibitor antagonists, dominant negative receptors, switch receptors, and combinations thereof.

[0273] In some embodiments, the polypeptide or its functional derivative that enhances immune cell function can be a chemokine, a chemokine receptor, a cytokine, a cytokine receptor, and a combination thereof. Alternatively, the polypeptide or its functional derivative that enhances immune cell function can be a cytokine selected from the following: interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-11 (IL-11), interleukin-12 (IL-12), interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-18 (IL-18), interleukin-18 receptor (IL-18R), interleukin-21 (IL-21), granulocyte macrophage colony stimulating factor, alpha, beta or gamma interferon, erythropoietin, and a combination thereof. The polypeptide or functional derivative thereof that enhances immune cell function may also be a chemokine selected from CCL21, CCL19, or a combination thereof. In some embodiments, the polypeptide or functional derivative thereof that enhances immune cell function is IL-18.

[0274] In some embodiments of the methods disclosed herein, the vector encodes a CAR comprising an anti-CD19 binding domain, wherein the anti-CD19 binding domain comprises a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3) disclosed in Table 2; and a heavy chain variable domain comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3) disclosed in Table 2. In some embodiments, the anti-CD 19 binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 146, or a sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 146. In another embodiment, the anti-CD 19 binding domain comprises: (a) a nucleic acid sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, and SEQ ID NO: 216; or (b) a nucleic acid sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, or SEQ ID NO: 216. NO:216 has a sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical. VI. Composition

[0275] One aspect of the present disclosure provides a composition comprising a modified cell, a modified lymphocyte, a modified immune cell, or a modified CD4 T cell produced by the methods described herein. + and CD8 + Another aspect of the present disclosure provides a composition comprising a modified lymphocyte population, a modified cell population, a modified immune cell population, or a modified CD4 + and CD8 + Another aspect of the present disclosure provides a composition comprising a lentiviral vector as described herein. In some embodiments, the composition further comprises one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients.

[0276] In some embodiments, the compositions described herein are used in medicines for use in treating diseases described herein or (e.g., cancers of cells or tissues expressing tumor antigens as described herein, any malignant tumors, autoimmune diseases). In some embodiments, the compositions described herein are used in methods of treatment for treating diseases described herein or (e.g., cancers of cells or tissues expressing tumor antigens as described herein, any malignant tumors, autoimmune diseases). In some embodiments, provided herein are pharmaceutical compositions comprising cells expressing CAR (e.g., a variety of cells expressing CAR) prepared by a manufacturing method as described herein (e.g., a cytokine method or an activation method as described herein). VII. Treatment Methods

[0277] In one aspect, the present disclosure provides a method for adoptive cell transfer therapy, comprising administering to a subject in need thereof a modified immune cell engineered by the methods described herein. In some embodiments, disclosed herein are methods for treating a disease or condition in a subject, comprising administering to the subject a modified T cell population described herein, e.g., a modified unstimulated T cell population or a modified stimulated T cell population described herein. In some embodiments, the present disclosure includes methods for treating a disease or condition in a subject, comprising administering to a subject in need thereof a composition comprising the modified immune cell described herein.

[0278] One aspect of the present disclosure provides a method of treating a disease or condition in a subject, the method comprising administering to a subject in need thereof a therapeutically effective amount of a modified cell, a modified immune cell, or a modified CD4 + and CD8 +Cells, thereby treating a disease or condition in a subject. The method of treating a disease or condition in a subject may also include administering to a subject in need thereof a therapeutically effective amount of a modified cell population, a modified immune cell population, or a modified CD4 T cell population prepared by the methods described herein. + and CD8 + Cell populations. The methods of treating a disease or condition in a subject can also include administering to a subject in need thereof a therapeutically effective amount of a composition described herein.

[0279] In some embodiments, the modified immune cells or modified CD4 + and CD8 + In some embodiments, the modified immune cells or modified CD4 + and CD8 + The cells are allogeneic to the subject. In some embodiments, the modified immune cells or modified CD4 + and CD8 + The cell is xenogeneic to the subject.In some embodiments, the subject is human. A. Diseases and Conditions

[0280] One aspect of the present disclosure provides a method for providing anti-tumor immunity in a mammal, the method comprising administering to the mammal an effective amount of a composition as described herein or a modified cell. In some embodiments, the composition comprises a modified cell expressing a CAR as described herein. The composition may also comprise a modified cell or a modified cell population.

[0281] Another aspect of the present disclosure provides a method for treating a mammal suffering from a disease associated with CD19 expression, the method comprising administering to a mammal an effective amount of a composition as described herein or a modified cell. In some embodiments, the composition comprises a modified cell expressing a CAR as described herein.

[0282] The modified cells can be autologous modified T cells or allogeneic modified T cells.In some embodiments, the mammal is a human.

[0283] In some embodiments, the disease associated with CD19 expression is selected from a proliferative disease, a malignancy, a precancerous condition, or a non-cancer related indication associated with CD19 expression. In some embodiments, the disease associated with CD19 expression is cancer, atypical and / or non-classical cancer, myelodysplasia, myelodysplastic syndrome, or preleukemia.

[0284] In some embodiments, the disease is a blood cancer selected from the group consisting of acute leukemia, chronic leukemia, hematological disorders, and combinations thereof. The disease can also be B-cell acute lymphoblastic leukemia ("BALL"), T-cell acute lymphoblastic leukemia ("TALL"), acute lymphocytic leukemia (ALL), chronic myelogenous leukemia (CML), chronic lymphocytic leukemia (CLL), B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt's lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative disorders, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndrome, non-Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom's macroglobulinemia, ineffective production (or developmental abnormalities) of myeloid blood cells, and combinations thereof.

[0285] In some embodiments, the modified cells or compositions are administered in combination with an agent that increases the efficacy of cells expressing CAR molecules. In some embodiments, the modified cells or compositions are administered in combination with an agent that improves one or more side effects associated with the administration of cells expressing CAR molecules. In some embodiments, the modified cells or compositions are administered in combination with an agent for treating a disease associated with CD19.

[0286] One aspect of the present disclosure provides methods for adoptive cell transfer therapy of a disease or condition. In some embodiments, the disease or condition can be selected from cancer, autoimmune diseases, lupus, neurodegenerative diseases or conditions, Alzheimer's disease, multiple sclerosis, infectious diseases, fibrotic conditions, liver fibrosis, pulmonary fibrosis, post-ischemic fibrosis, genetic disorders, sickle cell anemia, hemophilia, and / or beta-thalassemia. In some embodiments, the disease or condition is selected from cancer, any malignant tumor, or an autoimmune disease involving cells or tissues expressing a tumor antigen as described herein. B. Combination therapy

[0287] In some embodiments, the method for treating a disease further comprises administering an additional therapeutic agent or additional therapy to the subject. In some cases, the additional therapeutic agent disclosed herein includes a chemotherapeutic agent, an immunotherapeutic agent, a targeted therapy, a radiotherapy, or a combination thereof. Illustrative additional therapeutic agents include, but are not limited to, alkylating agents such as hexamethylmelamine, busulfan, carboplatin, carmustine, chlorambucil, cisplatin, cyclophosphamide, dacarbazine, lomustine, melphalan, oxaliplatin, temozolomide, or thiotepa; antimetabolites such as 5-fluorouracil (5-FU), 6-mercaptopurine (6-MP), capecitabine, cytarabine, floxuridine, fludarabine, gemcitabine, hydroxyurea, methotrexate, or pemetrexed; anthracyclines In some cases, the first-line therapy includes first-line therapy. As used herein, "first-line therapy" includes the main treatment for a subject with cancer. In some cases, the cancer is a primary cancer. In other cases, the cancer is a metastatic or recurrent cancer. In some cases, the first-line therapy includes chemotherapy. In other cases, the first-line treatment includes radiotherapy. It will be readily understood by those skilled in the art that different first-line treatments may be applicable to different types of cancer. In some cases, the other therapeutic agent includes an immune checkpoint inhibitor. In some cases, immune checkpoint inhibitors include inhibitors directed against the following, such as antibodies or fragments thereof (e.g., monoclonal antibodies, human antibodies, humanized antibodies, or chimeric antibodies), RNAi molecules, or small molecules: PD-1, PD-L1, CTLA4, PD-L2, LAG3, B7-H3, KIR, CD137, PS, TFM3, CD52, CD30, CD20, CD33, CD27, OX40, GITR, ICOS, BTLA (CD272), CD160, 2B4, LAIR1, TIGHT, LIGHT, DR3, CD226, CD2, or SLAM. Exemplary checkpoint inhibitors include pembrolizumab, nivolumab, tremelimumab, or ipilimumab. In some embodiments, additional therapy includes radiotherapy.

[0288] In some embodiments, the additional therapy comprises surgery. VIII. Kit

[0289] One aspect of the present disclosure provides a kit comprising a modified immune cell population or a modified CD4 + and CD8+ A cell population or a population engineered by the methods described herein. Another aspect of the present disclosure provides a kit comprising a lentiviral vector comprising a CAR described herein. IX. Definitions

[0290] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0291] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described herein. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting.

[0292] Unless otherwise indicated, the present disclosure will employ conventional techniques of tissue culture, immunology, molecular biology, microbiology, cell biology, and recombinant DNA, which are within the skill of the art. See, for example, Green and Sambrook, eds. (2012) Molecular Cloning: A Laboratory Manual, 4th ed.; Ausubel et al., eds. (2015) Current Protocols in Molecular Biology; Methods in Enzymology (Academic Press, Inc., NY); Antibodies, A Laboratory Manual; Greenfield, ed. (2014) Antibodies, A Laboratory Manual; Freshney (2010); Lundblad and Macdonald, eds. (2010) Handbook of Biochemistry and Molecular Biology, 4th ed.

[0293] As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly indicates otherwise. For example, the term "a cell" includes a plurality of cells, including mixtures thereof, and means one cell or more than one cell.

[0294] As used herein, the term "about" means that a value includes the standard deviation of error for the device or method used to determine the value. When used before a numerical expression (e.g., temperature, time, amount, and concentration, including ranges), the term "about" indicates an approximate value that can vary by (+) or (-) (±) 20%, 15%, 10%, 5%, 3%, 2%, or 1%. Preferably, ±5%, more preferably ±1%, and even more preferably ±0.1% of the specified value, as such variations are suitable for performing the disclosed methods.

[0295] As used herein, the term "activated" refers to a state of T cells that have been sufficiently stimulated to induce detectable cell proliferation. Activation can also be associated with induced cytokine production and detectable effector function. The term "activated T cells" particularly refers to T cells that are undergoing cell division.

[0296] As used herein, the term "affinity" means a measure of the binding strength between an antibody and a simple hapten or antigenic determinant. Without being bound by theory, affinity depends on the tightness of the stereochemical fit between the antibody binding site and the antigenic determinant, the size of the contact area between them, and the distribution of charged and hydrophobic groups. Affinity also includes the term "avidity," which refers to the intensity of the antigen-antibody bond after the reversible complex is formed. Methods for calculating the affinity of an antibody for an antigen are known in the art and include calculating affinity using binding experiments. In the case where an antibody (Ab) is combined with an antigen (Ag), an affinity constant (expressed as the inverse dissociation constant) is used.

[0297] Ab+Ag=AbAg Ka=i[AbAg][Ab][Ag]=1K a

[0298] The chemical equilibrium of antibody binding is also the binding rate constant (k 正向 ) and the dissociation rate constant (k 反向 Two antibodies can have the same affinity, but one antibody can have both a high association rate constant and a high dissociation rate constant, while the other antibody can have both a low association rate constant and a low dissociation rate constant.

[0299] Antibody activity in functional assays (e.g., cell lysis assays) can also reflect antibody affinity. In some embodiments, the antigen recognition receptor has low affinity. Low affinity includes micromolar and nanomolar affinities. Low affinity can include 10 -3 , 10 -4 , 10 -5 , 5×10 -5 , 5x 10 -6 , 10 -6 , 5×10 -7 , 10-7 , 5×10 -8 , 10 -8 , 5×10 -9 or 10 -9 M. Functional assays (cell lysis assays) can be used to phenotypically characterize and compare antibodies and affinities. Various methods for determining binding affinity are known in the art. An exemplary method for determining binding affinity employs surface plasmon resonance. Surface plasmon resonance is an optical phenomenon that allows for analysis of real-time biospecific interactions by detecting changes in protein concentration within a biosensor matrix, for example using a BIAcore system (Pharmacia Biosensor AB, Uppsala, Sweden and Piscataway, New Jersey).

[0300] As used herein, the term "allogeneic" refers to any material that originates from an animal of the same species as the individual into which the material is introduced. Two or more individuals are said to be allogeneic to one another when the genes at one or more loci differ. In some embodiments, allogeneic material from individuals of the same species may be sufficiently genetically distinct to interact antigenically.

[0301] As used herein, the term "analog" with respect to a polypeptide or polynucleotide includes any mimetic, i.e., a chemical compound that has at least one endogenous function of the polypeptide or polynucleotide that it mimics. Typically, amino acid substitutions, e.g., 1, 2, or 3 to 10 or 20 substitutions, can be made, provided that the modified sequence retains the desired activity or ability. Amino acid substitutions can include the use of non-naturally occurring analogs.

[0302] The proteins used in this disclosure may also have deletions, insertions, or substitutions of amino acid residues, thereby producing silent changes and generating functionally equivalent proteins. Careful amino acid substitutions can be made based on similarity in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic properties of the residues, as long as the endogenous function is preserved. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with non-charged polar head groups that have similar hydrophilicity values include asparagine, glutamine, serine, threonine, and tyrosine. Conservative substitutions can be made.

[0303] As used herein, the term "antibody" refers to an immunoglobulin molecule that specifically binds to an antigen. An antibody can be a complete immunoglobulin derived from a natural or recombinant source, and can be an immunoreactive portion of a complete immunoglobulin. An antibody is typically a tetramer of an immunoglobulin molecule. The antibodies in this disclosure can exist in a variety of forms, including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab, and F(ab)2, as well as single-chain antibodies (scFv) and humanized antibodies. In some embodiments, an antibody refers to an assembly (e.g., a complete antibody molecule, an immunoadhesin, or a variant thereof) that has a significant known specific immunoreactivity to an antigen of interest (e.g., a tumor-associated antigen). Antibodies and immunoglobulins comprise a light chain and a heavy chain, with or without an interchain covalent connection. The basic immunoglobulin structure in vertebrate systems is relatively well understood.

[0304] The term "antibody fragment" refers to a portion of an intact antibody and refers to the antigen-determining variable region of an intact antibody. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments, linear antibodies, scFv antibodies, and multispecific antibodies formed from antibody fragments.

[0305] In some embodiments, the term antibody fragment refers to at least a portion of an intact antibody or a recombinant variant thereof, and refers to an antigen binding domain (e.g., the antigen-determining variable region of an intact antibody) that is sufficient to confer recognition and specific binding to the target (e.g., an antigen) on the antibody fragment. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2 and Fv fragments, scFv antibody fragments, linear antibodies, single domain antibodies such as sdAb (VL or VH), camel VHH domains, and multispecific antibodies formed from antibody fragments. The term "scFv" refers to a fusion protein comprising at least one antibody fragment containing a light chain variable region and at least one antibody fragment containing a heavy chain variable region, wherein the light chain variable region and the heavy chain variable region are adjacently connected via a short flexible polypeptide linker and can be expressed as a single chain polypeptide, and wherein the scFv retains the specificity of the intact antibody from which it is derived. Unless otherwise specified, as used herein, an scFv can have the VL and VH variable regions in any order (e.g., with respect to the N-terminus and C-terminus of the polypeptide) and can comprise VL-linker-VH or can comprise VH-linker-VL.

[0306] The part comprising antibody or its antibody fragment of the CAR compositions of the present disclosure can exist in various forms, wherein the antigen binding domain is expressed as a part of a continuous polypeptide chain, including, for example, single domain antibody fragment (sdAb), single chain antibody (scFv), humanized antibody and humanized antibody. On the one hand, the antigen binding domain of the CAR compositions of the present disclosure includes antibody fragment. On the other hand, CAR includes an antibody fragment containing scFv.

[0307] As used herein, the term "antibody heavy chain" refers to the larger of the two types of polypeptide chains found in their naturally occurring conformations in all antibody molecules.

[0308] As used herein, "antibody light chain" refers to the smaller of the two types of polypeptide chains that exist in their naturally occurring conformations in all antibody molecules. α and β light chains refer to the two main antibody light chain isotypes. The antigen-binding domains of (e.g., chimeric antigen receptors) include antibody variants. As used herein, the term "antibody variant" includes synthetic and engineered forms of antibodies that are altered so that they are not naturally occurring, such as antibodies comprising at least two heavy chain portions but not containing two complete heavy chains (e.g., domain-deleted antibodies or minibodies); multispecific forms of antibodies (e.g., bispecific, trispecific, etc.) that are altered to bind to two or more different antigens or to different epitopes on a single antigen; heavy chain molecules engaged with scFv molecules, etc. In addition, the term "antibody variant" includes multivalent forms of antibodies (e.g., trivalent, tetravalent, etc.), i.e., antibodies that bind to three, four, or more copies of the same antigen.

[0309] As used herein, the term "antigen" or "Ag" is defined as a molecule that elicits an immune response. This immune response may involve the production of antibodies or the activation of specific immunocompetent cells, or both. It will be understood by those skilled in the art that any macromolecule (including almost all proteins or peptides) can be used as an antigen. In addition, antigens can be derived from recombinant or genomic DNA. It will be understood by those skilled in the art that any DNA comprising a nucleotide sequence or partial nucleotide sequence encoding a protein that elicits an immune response is therefore encoded as an "antigen" as the term used herein. In addition, it will be understood by those skilled in the art that antigens do not need to be encoded only by the full-length nucleotide sequence of a gene. It is easy to see that the present disclosure includes but is not limited to the use of partial nucleotide sequences of more than one gene, and these nucleotide sequences are arranged in various combinations to elicit a desired immune response. In addition, it will be understood by those skilled in the art that antigens do not need to be encoded by a "gene" at all. It is easy to see that antigens can be produced synthetically, or can be derived from a biological sample. This biological sample can include but is not limited to a tissue sample, a tumor sample, a cell or a biological fluid.

[0310] As used herein, the term "antigen presenting cell" or "APC" refers to a cell of the immune system, such as a helper cell (e.g., B cell, dendritic cell, etc.), that displays a foreign antigen in complex with a major histocompatibility complex (MHC) on its surface. T cells can recognize these complexes using their T cell receptors (TCR). APCs process antigens and present them to T cells.

[0311] As used herein, the term "anti-tumor effect" refers to a biological effect that can be manifested as a reduction in tumor volume, a reduction in the number of tumor cells, a reduction in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with a cancerous condition. In some embodiments, an "anti-tumor effect" can also be manifested as the ability of the peptides, polynucleotides, cells, and antibodies of the present disclosure to prevent tumorigenesis in the first place.

[0312] As used herein, the term "autoimmune disease" is defined as an obstacle caused by an autoimmune response. Autoimmune diseases are the result of inappropriate overreaction to self-antigens. Examples of autoimmune diseases include, but are not limited to, Addison's disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune mumps, cancer, Crohn's disease, diabetes (type I), dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain-Barré syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjögren's syndrome, spondyloarthropathies, thyroiditis, vasculitis, vitiligo, myxedema, pernicious anemia, ulcerative colitis, etc.

[0313] As used herein, the term "autologous" is intended to refer to any material originating from the same individual into which the material may subsequently be reintroduced.

[0314] As used herein, the term "cancer" refers to a disease characterized by the rapid and uncontrolled growth of abnormal cells. Cancer cells can spread locally or to other parts of the body through the bloodstream and lymphatic system. As used herein, the term "cancer" refers to a disease characterized by the rapid and uncontrolled growth of abnormal cells. Cancer cells can spread locally or to other parts of the body through the bloodstream and lymphatic system. Examples of various cancers include, but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer, metastatic castration-resistant prostate cancer, melanoma, synovial sarcoma, advanced TnMuc1-positive solid tumors, neuroblastoma, neuroendocrine tumors, etc. In certain embodiments, the CD19-positive tumor is medullary thyroid carcinoma. In certain embodiments, the cancer is prostate cancer. In certain embodiments, the cancer is mesothelioma or a cancer that expresses mesothelin. In some embodiments, the cancer is metastatic castration-resistant prostate cancer. The terms "cancer" and "tumor" are used interchangeably herein, and both terms encompass solid tumors and liquid tumors, diffuse or circulating tumors. In some embodiments, cancer or tumor includes pre-malignant as well as malignant cancers and tumors.

[0315] As used herein, the term "cancer associated antigen" or "tumor antigen" refers interchangeably to a molecule (typically a protein, carbohydrate, or lipid) that is fully expressed or expressed as a fragment (e.g., MHC / peptide) on the surface of a cancer cell, and can be used to preferentially target a drug to a cancer cell. In some embodiments, a tumor antigen is a marker (e.g., a lineage marker, such as CD19 on a B cell) expressed by both normal cells and cancer cells. In some embodiments, a tumor antigen is a cell surface molecule that is overexpressed (e.g., 1-fold overexpression, 2-fold overexpression, 3-fold overexpression, or more) in a cancer cell compared to a normal cell. In some embodiments, a tumor antigen is a cell surface molecule that is inappropriately synthesized in a cancer cell, for example, a molecule that contains deletions, additions, or mutations compared to a molecule expressed on a normal cell. In some embodiments, a tumor antigen will be fully expressed or expressed as a fragment (e.g., MHC / peptide) only on the cell surface of a cancer cell, and will not be synthesized or expressed on the surface of a normal cell. In some embodiments, the CAR of the present disclosure includes a CAR comprising an antigen binding domain (e.g., an antibody or antibody fragment) that is bound to a peptide presented by MHC. Typically, peptides derived from endogenous proteins fill the pocket of major histocompatibility complex (MHC) class I molecules and are taken up by CD8 +T cell receptor (TCR) recognition on T lymphocytes. MHC class I complex is constitutively expressed by all nucleated cells. In cancer, virus-specific and / or tumor-specific peptide / MHC complex represents a class of unique cell surface targets for immunotherapy. TCR-like antibodies targeting peptides derived from viruses or tumor antigens in the context of human leukocyte antigen (HLA)-A1 or HLA-A2 have been described. For example, TCR-like antibodies can be identified by screening libraries (such as human scFv phage display libraries).

[0316] As used herein, the terms "cancer-supporting antigens" or "tumor-supporting antigens" refer interchangeably to molecules (typically proteins, carbohydrates, or lipids) expressed on the surface of cells that are not themselves cancerous but support cancer cells by promoting their growth or survival (e.g., against immune cells). Exemplary cells of this type include stromal cells and myeloid-derived suppressor cells (MDSCs). Tumor-supporting antigens themselves do not need to function in supporting tumor cells, as long as the antigen is present on cells that support cancer cells.

[0317] As used herein, "cell surface marker" refers to any molecule expressed on the surface of a cell. Cell surface expression generally requires that the molecule possess a transmembrane domain. Many naturally occurring cell surface markers are referred to as "CD" or "cluster of differentiation" molecules. Cell surface markers generally provide antigenic determinants to which antibodies can bind.

[0318] As used herein, the term "chimeric antigen receptor" or alternatively "CAR" refers to a recombinant polypeptide construct comprising at least an extracellular antigen binding domain, a transmembrane domain, and a cytoplasmic signaling domain (also referred to herein as an "intracellular signaling domain") comprising a functional signaling domain derived from a stimulatory molecule as defined below.

[0319] In some embodiments, CAR refers to an artificial T cell receptor that is engineered to express and specifically bind to an antigen on an immune effector cell or its precursor cell. CAR can be used in adoptive cell therapy with adoptive cell transfer. In some embodiments, adoptive cell transfer (or therapy) includes removing T cells from a patient and modifying the T cells to express receptors specific for a specific antigen. In some embodiments, CAR is specific for selected targets, such as CD19, ROR1, mesothelin, c-Met, PSMA, PSCA, folate receptor alpha, folate receptor beta, EGFR, EGFRvIII, GPC2, GPC2, mucin 1 (MUC1), Tn antigen ((Tn Ag) or (GalNAca-Ser / Thr)), TnMUC1, GDNF family receptor alpha-4 (GFRa4), fibroblast activation protein (FAP) or interleukin-13 receptor subunit alpha-2 (IL-13Ra2 or CD213A2).

[0320] In some embodiments, the stimulatory molecule is a zeta chain associated with a T cell receptor complex. In some embodiments, the cytoplasmic signaling domain further comprises one or more functional signaling domains derived from at least one costimulatory molecule as defined below. In some embodiments, the costimulatory molecule is selected from 4-1BB (i.e., CD137), CD27, and / or CD28. In some embodiments, CAR comprises a chimeric fusion protein comprising an extracellular antigen recognition domain, a transmembrane domain, and an intracellular signaling domain, wherein the intracellular signaling domain comprises a functional signaling domain derived from a stimulatory molecule. On the one hand, CAR comprises a chimeric fusion protein comprising an extracellular antigen recognition domain, a transmembrane domain, and an intracellular signaling domain, wherein the intracellular signaling domain comprises a functional signaling domain derived from a costimulatory molecule and a functional signaling domain derived from a stimulatory molecule.

[0321] As used herein, the term "signaling domain" refers to a functional portion of a protein that acts by transmitting information within the cell to regulate cellular activity through defined signaling pathways by generating second messengers, or by functioning as an effector by responding to such messengers.

[0322] As used herein, the term "CD19" refers to a cluster of differentiation 19 protein, which is an antigenic determinant that can be detected on leukemia precursor cells. Human and mouse amino acid and nucleic acid sequences can be found in public databases such as GenBank, UniProt, and Swiss-Prot. For example, the amino acid sequence of human CD19 can be found as UniProt / Swiss-Prot accession number P15391, and the nucleotide sequence encoding human CD19 can be found as accession number NM_001178098. CD19 is expressed in most B-lineage cancers, including, for example, acute lymphoblastic leukemia, chronic lymphocytic leukemia, and non-Hodgkin's lymphoma. Other cells expressing CD19 are provided below in the definition of "diseases associated with CD19 expression." CD19 is also an early marker for B cell progenitors. See, for example, Nicholson et al. Mol. Immun. 34 (16-17): 1157-1165 (1997). In some embodiments, the antigen binding portion of CART recognizes and binds to an antigen within the extracellular domain of a CD19 protein. In some embodiments, the CD19 protein is expressed on cancer cells.

[0323] As used herein, the term "conservative sequence modifications" is intended to refer to amino acid modifications that do not significantly affect or change the binding characteristics of the antibody containing the amino acid sequence. Such conservative modifications include amino acid substitutions, additions, and deletions. Modifications can be introduced into the antibodies of the present disclosure by standard techniques known in the art (such as site-directed mutagenesis and PCR-mediated mutagenesis). Conservative amino acid substitutions are amino acid substitutions in which the amino acid residue is replaced by an amino acid residue with a similar side chain. Families of amino acid residues with similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), amino acids with acidic side chains (e.g., aspartic acid, glutamic acid), amino acids with uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), amino acids with non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), amino acids with β-branched side chains (e.g., threonine, valine, isoleucine) and amino acids with aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, one or more amino acid residues within the CDR region of an antibody can be replaced with other amino acid residues from the same side chain family, and the altered antibody's ability to bind to antigen can be tested using the functional assays described herein.

[0324] As used herein, the term "costimulatory ligand" includes molecules on antigen presenting cells (e.g., aAPCs, dendritic cells, B cells, etc.) that specifically bind to cognate costimulatory molecules on T cells, thereby providing a signal that mediates T cell responses, including but not limited to proliferation, activation, differentiation, etc., in addition to the primary signal provided by, for example, the binding of the TCR / CD3 complex to the peptide-loaded MHC molecule. Costimulatory ligands can include, but are not limited to, CD2, CD7, B7-1 (CD80), B7-2 (CD86), PD-L1, PD-L2, 4-1BBL, OX40L, inducible co-stimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM, lymphotoxin beta receptor, 3 / TR6, ILT3, ILT4, HVEM, agonists or antibodies that bind to Toll ligand receptors, and ligands that specifically bind to B7-H3. Co-stimulatory ligands also particularly encompass antibodies that specifically bind to co-stimulatory molecules present on T cells (such as, but not limited to, CD27, CD28, 4-1BB, OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3), as well as ligands that specifically bind to CD83.

[0325] As used herein, " costimulatory molecules " refer to the cognate binding partner on T cell, which is specifically bound to costimulatory ligands, so as to mediate the costimulatory response (such as but not limited to proliferation) of T cells.Costimulatory molecules are cell surface molecules that contribute to effective immune response except antigen receptors or their ligands.Costimulatory molecules include but are not limited to MHC class I molecules, BTLA, Toll ligand receptors, CD28, 4-1BB (CD137), OX40 (CD134), PD-1, CD7, LIGHT, CD83L, DAP10, DAP12, CD27, CD2, CD5, ICAM-1, LFA-1, Lck, TNFR-I, TNFR-II, Fas, CD30, CD40, ICOS (CD278), NKG2C, B7-H3 (CD276) and the intracellular domain derived from cytotoxic cell immunoglobulin-like receptor (KIR). In some embodiments, costimulatory molecules include OX40, CD27, CD2, CD28, ICOS (CD278), and 4-1BB (CD137). Other examples of such costimulatory molecules include CDS, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD160, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, NKG2D, NKG2C, TNFR2, TRANCE RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, LAT, GADS, SLP-76, PAG / Cbp, CD19a and ligands that specifically bind to CD83.

[0326] As used herein, the term "costimulatory signal" refers to a signal that is combined with a primary signal (such as TCR / CD3 connection) to cause T cell proliferation and / or upregulation or downregulation of key molecules. The costimulatory intracellular signaling domain can be the intracellular part of a costimulatory molecule. Costimulatory molecules can be represented in the following protein families: TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocyte activation molecules (SLAM proteins) and activating NK cell receptors. Examples of such molecules include CD27, CD28, 4-1BB (CD137), OX40, GITR, CD30, CD40, ICOS, BAFFR, HVEM, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD2, CDS, CD7, CD287, LIGHT, NKG2C, NKG2D, SLAMF7, NKp80, NKp30, NKp44, NKp46, CD160, B7-H3, and ligands that specifically bind to CD83, etc.

[0327] As used herein, the term "derived from" refers to the relationship between a first molecule and a second molecule. It generally also refers to the structural similarity between the first molecule and the second molecule, and does not imply or include any limitation on the process or source of the first molecule derived from the second molecule. For example, in the case of an intracellular signaling domain derived from a CD3 zeta molecule, the intracellular signaling domain retains sufficient CD3 zeta structure so that it has the desired function, i.e., the ability to generate a signal under appropriate conditions. It does not imply or include any limitation on a particular process for generating the intracellular signaling domain, for example, it does not mean that in order to provide an intracellular signaling domain, one must start with a CD3 zeta sequence and delete unwanted sequences or impose mutations to obtain the intracellular signaling domain.

[0328] As used herein, the term "disease" refers to a state of health in an animal in which the animal is unable to maintain homeostasis and in which the animal's health will continue to deteriorate if the disease is not ameliorated. In contrast, the term "disorder" in an animal refers to a state of health in which the animal is able to maintain homeostasis, but in which the animal's health is less favorable than it would be in the absence of the disorder. A disorder does not necessarily result in further deterioration of the animal's health if left untreated.

[0329] As used herein, "diseases associated with tumor antigen expression" include, but are not limited to, diseases associated with tumor antigen expression or conditions associated with cells expressing tumor antigens, the diseases or conditions including, but not limited to, proliferative diseases (such as cancer or malignant tumors) or precancerous conditions (such as myelodysplasia, myelodysplastic syndrome, or preleukemia); or non-cancer related indications associated with cells expressing tumor antigens. In some embodiments, the cancer associated with the expression of tumor antigens is a blood cancer. In some embodiments, the cancer associated with the expression of tumor antigens is a solid cancer. Other diseases associated with tumor antigen expression include, but are not limited to, atypical and / or non-classical cancers, malignant tumors, precancerous conditions, or proliferative diseases associated with tumor antigen expression. Non-cancer related indications associated with tumor antigen expression include, but are not limited to, autoimmune diseases (e.g., lupus), inflammatory disorders (allergies and asthma), and transplantation. In some embodiments, tumor antigen-expressing cells express or express at any time mRNA encoding a tumor antigen. In some embodiments, tumor antigen-expressing cells produce tumor antigen proteins (e.g., wild type or mutant), and the tumor antigen proteins may be present at normal levels or at reduced levels. In some embodiments, the tumor antigen-expressing cells produce detectable levels of tumor antigen protein at one point and subsequently produce substantially no detectable tumor antigen protein.

[0330] As used herein, the term "disease associated with CD19 expression" includes, but is not limited to, diseases associated with CD19 expression or conditions associated with cells expressing CD19, including proliferative diseases (such as cancer or malignant tumors) or precancerous conditions (such as myelodysplasia, myelodysplastic syndrome, or preleukemia); or non-cancer related indications associated with cells expressing CD19. In some embodiments, the cancer associated with CD19 expression is a blood cancer. In one aspect, the blood cancer is a leukemia or lymphoma. In one aspect, the cancer associated with CD19 expression includes cancer and malignant tumors, including, but not limited to, for example, one or more acute leukemias, including, but not limited to, for example, B-cell acute lymphoblastic leukemia ("BALL"), T-cell acute lymphoblastic leukemia ("TALL"), acute lymphoblastic leukemia (ALL); one or more chronic leukemias, including, but not limited to, for example, chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL). Additional cancers or hematological disorders associated with CD19 expression include, but are not limited to, B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt's lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative disorders, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndrome, non-Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom's macroglobulinemia, and "preleukemia" (a diverse collection of hematological disorders associated with ineffective production (or dysplasia) of myeloid blood cells), etc. Other diseases associated with CD19 expression include, but are not limited to, atypical and / or non-classical cancers, malignancies, precancerous conditions, or proliferative diseases associated with CD19 expression. Non-cancer related indications associated with CD19 expression include, but are not limited to, for example, autoimmune diseases (eg, lupus), inflammatory disorders (allergies and asthma), and transplantation.

[0331] As used herein, the term "downregulate" refers to the reduction or elimination of gene expression of one or more genes.

[0332] As used herein, the term "encoding" refers to the inherent properties of a specific nucleotide sequence in a polynucleotide (such as a gene, cDNA or mRNA) as a template for synthesizing other polymers and macromolecules in a biological process, and the other polymers and macromolecules have a determined nucleotide sequence (for example, rRNA, tRNA and mRNA) or a determined amino acid sequence and the resulting biological properties. Therefore, if the transcription and translation of the mRNA corresponding to a gene, cDNA or RNA produces a protein in a cell or other biological system, the gene encodes the protein. It can be said that the coding strand (its nucleotide sequence is identical to the mRNA sequence, and is generally provided in a sequence table) and the non-coding strand (used as a template for transcription of a gene or cDNA) both encode the protein or other products of the gene or cDNA. Unless otherwise specified, "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate forms and encode the same amino acid sequence. The phrase encoding a protein or RNA nucleotide sequence can also include introns, meaning that the nucleotide sequence encoding a protein can contain one or more introns in some forms.

[0333] As used herein, the terms "effective amount" or "therapeutically effective amount" are used interchangeably herein and refer to an amount of a compound, formulation, material, medicament or composition as described herein that is effective to achieve a desired physiological, therapeutic or preventive outcome in a subject in need thereof. Such outcomes may include, but are not limited to, an amount that, when administered to a mammal, causes a detectable level of immune response compared to the immune response detected in the absence of the compositions of the present disclosure. Immune responses can be readily assessed by a number of art-recognized methods. Those skilled in the art will appreciate that the amount of the compositions administered herein varies and can be readily determined based on many factors, such as the disease or condition being treated, the age and health and physical condition of the mammal being treated, the severity of the disease, the specific compound being administered, and the like. The effective amount can vary between subjects based on the health and physical condition of the subject to be treated, the taxonomic group of the subject to be treated, the formulation of the composition, the assessment of the subject's medical condition, and other relevant factors.

[0334] As used herein, the term "endogenous" refers to any material that originates from, or is produced within, an organism, cell, tissue, or system.

[0335] As used herein, the term "expression" refers to the transcription and / or translation of a specific nucleotide sequence driven by a promoter.

[0336] As used herein, the term "exogenous" refers to any material that is introduced from outside of an organism, cell, tissue, or system or that is generated outside of an organism, cell, tissue, or system.

[0337] As used herein, the term "expression vector" refers to a vector comprising a recombinant polynucleotide comprising an expression control sequence operably linked to a nucleotide sequence to be expressed. The expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., Sendai virus, lentivirus, retrovirus, adenovirus, and adeno-associated virus) that incorporate recombinant polynucleotides.

[0338] As used herein, the term "extended packaging signal" or "extended packaging sequence" refers to sequences that extend further into the gag gene using the psi sequence surrounding it. The inclusion of these additional packaging sequences can increase the efficiency of inserting the vector RNA into the viral particle. As an example, for murine leukemia virus (MoMLV), the minimal core packaging signal is encoded by a sequence from approximately nucleotide 144 to the Pst I site (nucleotide 567) (counted from the 5' LTR capping site). The extended packaging signal of MoMLV includes sequences extending beyond nucleotide 567 to the start of the gag / pol gene (nucleotide 621) and beyond nucleotide 1040. These sequences include approximately one-third of the gag gene sequence.

[0339] As used herein, the term "ex vivo" refers to cells that have been removed from a living organism (eg, a human) and propagated outside of the organism (eg, in a culture dish, test tube, or bioreactor).

[0340] As used herein, "Fab" refers to a fragment of an antibody structure that binds to an antigen but is monovalent and does not have an Fc portion, e.g., papain digestion of an antibody produces two Fab fragments and one Fc fragment (e.g., a heavy (H) chain constant region; the Fc region that does not bind to an antigen).

[0341] As used herein, the term "flexible polypeptide linker" or "linker" used in the context of scFv refers to a peptide linker composed of amino acids (such as glycine and / or serine residues) used alone or in combination to link the variable heavy chain region and the variable light chain region together. In one embodiment, the flexible polypeptide linker is a Gly / Ser linker and comprises the amino acid sequence (Gly-Gly-Gly-Ser) n , wherein n is a positive integer equal to or greater than 1. For example, n = 1, n = 2, n = 3, n = 4, n = 5 and n = 6, n = 7, n = 8, n = 9 and n = 10. Exemplary linkers are shown in Table 1.

[0342] As used herein, "fragment" is also a variant, and the term typically refers to a selected region of interest in a polypeptide or polynucleotide, either functionally or, for example, in an assay. Thus, a "fragment" refers to an amino acid or nucleic acid sequence that is a portion of a full-length polypeptide or polynucleotide.

[0343] As used herein, "functional variant" refers to a polypeptide having an amino acid sequence substantially identical to a reference amino acid sequence, or encoded by a substantially identical nucleotide sequence, and capable of having one or more activities of the reference amino acid sequence.

[0344] As used herein, the term "host cell" includes cells transfected, infected, or transduced with a recombinant vector or polynucleotide of the present disclosure in vivo, ex vivo, or in vitro. Host cells may include packaging cells, production cells, and cells infected with viral vectors. In some embodiments, host cells infected with a lentiviral vector of the present disclosure are administered to a subject in need of therapy. In some embodiments, the term "target cell" is used interchangeably with host cell and refers to a transfected, infected, or transduced cell of a desired cell type. In a preferred embodiment, the target cell is a T cell.

[0345] As used herein, the term "homologous" refers to the subunit sequence identity between two polymeric molecules (e.g., between two nucleic acid molecules (such as two DNA molecules or two RNA molecules)) or between two polypeptide molecules. When a subunit position in both of the two sequences is occupied by the same monomeric subunit, the molecules are homologous at that position. For example, if one position in each of two DNA molecules is occupied by adenine, the two DNA molecules are homologous. The homology between two sequences is a direct function of the number of matching positions or homologous positions. For example, if half of the positions in the two sequences (e.g., five positions in a polymer that is ten subunits in length) are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., 9 out of 10) are matched or homologous, the two sequences are 90% homologous.

[0346] As used herein, the term "homologue" means an entity having a certain homology with a wild-type amino acid sequence and a wild-type nucleotide sequence. The term "homology" can be equivalent to "identity". In the context of the present invention, homologous sequences are considered to include amino acid sequences that are at least 50%, 55%, 65%, 75%, 85% or 90% identical, preferably at least 95% or 97% or 99% identical to the subject sequence. Typically, a homologue will comprise the same active site, etc., as the subject amino acid sequence. Although homology can also be considered based on similarity (i.e., amino acid residues with similar chemical properties / functions), in the context of the present disclosure, homology is preferably represented based on sequence identity.

[0347] Homologous sequences are considered to comprise nucleotide sequences that are at least 50%, 55%, 65%, 75%, 85% or 90% identical, preferably at least 95% or 97% or 99% identical to the subject sequence. Although homology can also be considered in terms of similarity, in the context of the present disclosure, homology is preferably represented in terms of sequence identity. Homology can be relatively carried out by the naked eye, or more usually by means of readily available sequence comparison programs. These commercially available computer programs can calculate homology or identity percentages between two or more sequences.

[0348] The percent homology of consecutive sequences can be calculated, that is, one sequence is aligned with the other sequence and each amino acid in one sequence is directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is called a "gapless" alignment. Typically, such a gapless alignment is performed only for a relatively small number of residues. Although this is a very simple and consistent method, it does not take into account that, for example, an insertion or deletion in a nucleotide sequence of a pair of sequences that are otherwise identical may cause subsequent codons to not align, and therefore may cause the percent homology to be significantly reduced when a global alignment is performed. Therefore, most sequence comparison methods are designed to produce an optimal alignment that takes into account possible insertions and deletions without excessively penalizing the overall homology score. This is achieved by inserting "gaps" in the sequence alignment in an attempt to maximize local homology.

[0349] In some embodiments, the present invention relates to the sequence alignment of amino acid residues.For example, the sequence alignment of amino acid residues is more preferably a plurality of residues, and the sequence alignment of residues is more preferably a plurality of residues.For example, the sequence alignment of residues is more preferably a plurality of residues, and the sequence alignment of residues is more preferably a plurality of residues.For example, the sequence alignment of residues is more preferably a plurality of residues, and the sequence alignment of residues is more preferably a plurality of residues.For example, the sequence alignment of residues is more preferably a plurality of residues, and the sequence alignment of residues is more preferably a plurality of residues.For example, the sequence alignment of residues is more preferably a plurality of residues, and the sequence alignment of residues is more preferably a plurality of residues.For example, the sequence alignment of residues is more preferably a plurality of residues, and the sequence alignment of residues is more preferably a plurality of residues.For example, the sequence alignment of residues is more preferably a plurality of residues, and the sequence alignment of residues is more preferably a plurality of residues.

[0350] The calculation of maximum homology percentage first needs to produce the best comparison taking into account gap penalty.The suitable computer program for carrying out this comparison is GCG Wisconsin Bestfit software package (University of Wisconsin, the U.S.; Devereux et al. (1984) Nucleic Acids Research 12:387). The example of other software that can carry out sequence comparison includes but is not limited to BLAST software package, FASTA and GENEWORKS comparison tool suite. Both BLAST and FASTA can be used for offline and online search. However, for some applications, it is preferred to use GCG Bestfit program. Another kind of tool called BLAST 2 sequence also can be used for comparing protein and nucleotide sequence.

[0351] In some embodiments, the comparison of the sequences of the present invention is carried out according to the present invention.Although the final homology percentage can be measured according to identity, the comparison process itself is usually not based on an all-or-nothing paired comparison.On the contrary, a similarity score matrix of scaling is usually used, which assigns scores to each paired comparison based on chemical similarity or evolutionary distance.An example of this matrix commonly used is the BLOSUM62 matrix, which is the default matrix for the BLAST program suite.The GCG Wisconsin program usually uses public default values or a custom symbol comparison table (if provided) (for further details, referring to the user manual).For some applications, it is preferred to use the public default values of the GCG software package, or in the case of other software, use a default matrix such as BLOSUM62.Once the software has produced the best comparison, it is possible to calculate the homology percentage, preferably the sequence identity percentage.The software usually uses this as a part for sequence comparison and produces a numerical result.

[0352] As used herein, the term "hybrid vector" refers to a vector, LTR, or other nucleic acid that contains both retroviral sequences (e.g., lentiviral) and non-retroviral sequences (e.g., lentiviral sequences). In one embodiment, a hybrid vector refers to a vector or transfer plasmid that contains retroviral (e.g., lentiviral) sequences for reverse transcription, replication, integration, and / or packaging.

[0353] Such variants can be prepared using standard recombinant DNA techniques (such as site-directed mutagenesis). In the case of inserting, synthetic DNA can be prepared that encodes insertion and corresponding to the 5' and 3' flanking regions of the naturally occurring sequence on either side of the insertion site. The flanking regions will contain convenient restriction sites corresponding to the site in the naturally occurring sequence, making it possible to cut the sequence with one or more appropriate enzymes, and the synthetic DNA will be connected to the nick. The DNA is then expressed according to the present disclosure to prepare the encoded protein. These methods only illustrate many standard techniques known in the art for operating dna sequences, and other known technologies can also be used.

[0354] As used herein, the term "identity" refers to the subunit sequence identity between two polymer molecules, in particular between two amino acid molecules, such as between two polypeptide molecules. When two amino acid sequences have the same residue at the same position, they are identical at that position. For example, if one position in each of the two polypeptide molecules is occupied by arginine, the two polypeptides are identical. The identity or the degree to which two amino acid sequences have the same residue at the same position in the alignment is usually expressed as a percentage. The identity between two amino acid sequences is a direct function of the number of matching positions or identical positions. For example, if half of the positions in the two sequences (e.g., five positions in a polymer of ten amino acids in length) are identical, the two sequences are 50% identical; if 90% of the positions (e.g., 9 out of 10) are matched or identical, the two amino acid sequences are 90% identical.

[0355] As used herein, the term "immunoglobulin" or "Ig" defines a class of proteins that act as antibodies. Antibodies expressed by B cells are sometimes referred to as BCRs (B cell receptors) or antigen receptors. The five members included in this class of proteins are IgA, IgG, IgM, IgD, and IgE. IgA is a primary antibody present in body secretions (such as saliva, tears, breast milk, gastrointestinal secretions, and mucous secretions of the respiratory and urogenital tracts). IgG is the most common circulating antibody. IgM is the main immunoglobulin produced in the primary immune response of most subjects. It is the most effective immunoglobulin in agglutination, complement fixation, and other antibody responses, and is important in defending against bacteria and viruses. IgD is an immunoglobulin that does not have known antibody functions but can serve as an antigen receptor. IgE is an immunoglobulin that mediates immediate hypersensitivity reactions by causing mast cells and basophils to release mediators after exposure to allergens.

[0356] As used herein, the term "immune response" is defined as a cellular response to the presence of an antigen when lymphocytes recognize the antigen molecule as foreign and induce antibody formation and / or activate lymphocytes to remove the antigen.

[0357] As used herein, the term "immune effector cell" refers to a cell that participates in an immune response (e.g., participates in promoting immune effector responses). Examples of immune effector cells include T cells (e.g., α / β T cells and γ / δ T cells), B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, and myeloid-derived phagocytes.

[0358] As used herein, the term "immune effector function or immune effector response" refers to a function or response that enhances or promotes an immune attack on a target cell. In some embodiments, an immune effector function or response refers to a property of a T cell or NK cell that promotes killing of a target cell or inhibition of its growth or proliferation. In the case of T cells, primary stimulation and co-stimulation are examples of immune effector functions or responses.

[0359] As used herein, the term "inhibitory molecule" refers to a molecule that, when activated, causes or contributes to the inhibition of cell survival, activation, proliferation, and / or function; and a gene encoding the molecule and its associated regulatory elements (e.g., promoter). In some embodiments, an inhibitory molecule is a molecule expressed on an immune effector cell (e.g., on a T cell). Non-limiting examples of inhibitory molecules are PD-1, PD-L1, PD-L2, CTLA4, TIM3, LAG3, CEACAM (e.g., CEACAM-1, CEACAM-3 and / or CEACAM-5), VISTA, TGFβIIR, VSIG3, VSIG 8, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGFβ. It should be understood that the term inhibitory molecule refers to a gene (and its associated regulatory elements) encoding an inhibitory molecule protein when used in conjunction with a target sequence or gRNA molecule. In some embodiments, the gene encoding the inhibitory molecule is BTLA, PD-1, TIM-3, VSIG3, VSIG8, CTLA4, or TGFβIIR. In some embodiments, the gene encoding the inhibitory molecule is VSIG3. In some embodiments, the gene encoding the inhibitory molecule is PD-1. In some embodiments, the gene encoding the inhibitory molecule is TGFβIIR.

[0360] As used herein, the term "induced pluripotent stem cells" or "iPS cells" refers to pluripotent stem cells generated from adult cells such as immune cells (i.e., T cells). Expression of reprogramming factors (such as Klf4, Oct3 / 4, and Sox2) in adult cells converts the cells into pluripotent cells that can reproduce and differentiate into a variety of cell types.

[0361] As used herein, the term "isolated" means altered or removed from its natural state. For example, a nucleic acid or peptide naturally present in a living animal is not "isolated," but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is "isolated." An isolated nucleic acid or protein can exist in a substantially pure form or can exist in a non-natural environment (such as, for example, a host cell).

[0362] As used herein, "in vitro transcribed RNA" refers to RNA that has been synthesized in vitro. In some embodiments, the RNA is mRNA. Typically, the in vitro transcribed RNA is produced by an in vitro transcription vector. The in vitro transcription vector comprises a template for producing the in vitro transcribed RNA.

[0363] As used herein, the term "knockout" refers to the elimination of gene expression of one or more genes.

[0364] As used herein, the term "K D ” refers to the equilibrium dissociation constant between an antibody and its antigen. In particular, K D is the equilibrium dissociation constant between the antibody protein and its antigen, i.e. K off / K on The ratio of K D Negatively correlated with affinity. K D The value is related to the antibody concentration (the amount of antibody required for a specific experiment), so K D The lower the value (the lower the concentration), the higher the affinity of the antibody. D In low micromolar (10 -6 ) to nanomolar (10 -7 to 10 -9 ) range. High affinity antibodies are generally considered to be in the low nanomolar range (10 -9 ), and very high affinity antibodies are in the picomolar (10 -12 ) range.

[0365] The term "K on ” or “association reaction” is the “on-rate,” which is a constant that characterizes how quickly an antibody binds to its target.

[0366] The term "Koff" or "dissociation reaction" is "off-rate," which is a constant used to characterize how quickly an antibody dissociates from its target. The ratio of the off-rate to the on-rate (K) measured experimentally is used to determine the off-rate. off / K on ) to calculate K D value.

[0367] As used herein, the term "lentiviral vector" refers to a viral vector or plasmid containing structural and functional genetic elements primarily derived from a lentivirus, or portions thereof (including LTRs). In some embodiments, the terms "lentiviral vector" and "lentiviral expression vector" may be used to refer to lentiviral transfer plasmids and / or infectious lentiviral particles. Elements such as cloning sites, promoters, regulatory elements, heterologous nucleic acids, and the like are mentioned herein. In some embodiments, the sequences of these elements are present in the lentiviral particles of the present disclosure in RNA form and in the DNA plasmids of the present disclosure in DNA form.

[0368] As used herein, a lentivirus or lentiviral vector is a vector comprising at least one component that is derivable from a lentivirus. Preferably, the component is involved in the biological mechanism by which the vector infects cells, expresses genes, or replicates. A lentiviral vector may be a "non-primate" vector, i.e., a virus that is derived from a virus that does not primarily infect primates, especially humans. A non-primate lentivirus may be any member of the family Lentiviridae that does not naturally infect primates and may include feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), caprine arthritis encephalitis virus (CAEV), maedi vesna virus (MVV), or equine infectious anemia virus (EIAV).

[0369] As used herein, the term "lentivirus" refers to a genus of the Retroviridae family. Lentiviruses are unique among retroviruses in their ability to infect non-dividing cells; they can deliver large amounts of genetic information into the host cell's DNA, making them one of the most efficient gene delivery vectors. HIV, SIV, and FIV are all examples of lentiviruses.

[0370] As used herein, the term "modified" refers to an altered state or structure of a molecule or cell of the present disclosure. Molecules can be modified in a variety of ways, including chemical, structural, and functional modifications. Cells can be modified by the introduction of nucleic acids.

[0371] As used herein, the term "modulate" means mediating a detectable increase or decrease in the level of a response in a subject compared to the level of the response in the absence of the treatment or compound, and / or compared to the level of response in an otherwise identical but untreated subject. The term encompasses interfering with and / or influencing a natural signal or response in a subject (preferably a human) thereby mediating a beneficial therapeutic response.

[0372] In the context of this disclosure, the following abbreviations for ubiquitous nucleic acid bases are used: "A" refers to adenosine, "C" refers to cytosine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.

[0373] As used herein, "naive T cells" refer to T cells that have not experienced an antigen. In some embodiments, naive T cells encounter their cognate antigen in the thymus rather than in the periphery. In some embodiments, naive T cells are precursors to memory cells. In some embodiments, naive T cells express both CD45RA and CCR7, but do not express CD45RO. In some embodiments, naive T cells may be characterized by expression of CD62L, CD27, CCR7, CD45RA, CD28, and CD127, and the absence of CD95 or CD45RO isoforms. In some embodiments, naive T cells express CD62L, IL-7 receptor-α, IL-6 receptor, and CD132, but do not express CD25, CD44, CD69, or CD45RO. In some embodiments, naive T cells express CD45RA, CCR7, and CD62L, and do not express CD95 or IL-2 receptor β. In some embodiments, surface expression levels of markers are assessed using flow cytometry.

[0374] Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence. The phrase "nucleotide sequence encoding a protein or RNA" may also include introns, meaning that a nucleotide sequence encoding a protein may contain one or more introns.

[0375] As used herein, the term "operably linked" refers to a functional connection between a regulatory sequence and a heterologous nucleic acid sequence, resulting in expression of the latter. For example, a first nucleic acid sequence is operably linked to a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For example, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Typically, operably linked DNA sequences are contiguous and, in the case of joining two protein coding regions, are in the same reading frame.

[0376] As used herein, the term "overexpressed" tumor antigen or "overexpression" of a tumor antigen is intended to refer to abnormal expression levels in cells from a diseased area (such as a solid tumor) within a particular tissue or organ of the patient relative to the level of expression of the tumor antigen in normal cells from that tissue or organ. Patients with solid tumors or hematological malignancies characterized by overexpression of a tumor antigen can be identified by standard assays known in the art.

[0377] As used herein, the term "parenteral" administration of an immunogenic composition includes, for example, subcutaneous (sc), intravenous (iv), intramuscular (im) or intrasternal injection or infusion techniques.

[0378] As used herein, the terms "peptide," "polypeptide," and "protein" are used interchangeably and refer to compounds composed of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit on the maximum number of amino acids that can constitute a protein sequence or peptide sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the terms refer to both short chains, which are also commonly referred to in the art as, for example, peptides, oligopeptides, and oligomers; and long chains, which are commonly referred to in the art as proteins, of which there are many types. "Polypeptide" includes, among others, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins. Polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.

[0379] As used herein, "poly (A)" is a series of adenosines attached to an mRNA by polyadenylation. In some embodiments of constructs for transient expression, the poly (A) is between 50 and 5000. In some embodiments, the poly (A) is greater than 64. In some embodiments, the poly (A) is greater than 100. In some embodiments, the poly (A) is greater than 300. In some embodiments, the poly (A) is greater than 400. The poly (A) sequence can be chemically or enzymatically modified to modulate mRNA functionality, such as localization, stability, or translation efficiency.

[0380] As used herein, "polyadenylation" refers to the covalent attachment of a polyadenylyl moiety or its modified variants to a messenger RNA molecule. In eukaryotes, most messenger RNA (mRNA) molecules are polyadenylated at the 3' end. The 3' poly (A) tail is a long sequence of adenine nucleotides (usually hundreds) added to the pre-mRNA by the action of an enzyme (polyadenylate polymerase). In higher eukaryotes, the poly (A) tail is added to transcripts containing a specific sequence (polyadenylation signal). The poly (A) tail and the proteins bound thereto help protect the mRNA from being degraded by exonucleases. Polyadenylation is also important for transcription termination, export of mRNA from the nucleus, and translation. Polyadenylation occurs in the nucleus immediately after DNA is transcribed into RNA, but can also occur later in the cytoplasm. After transcription is terminated, the mRNA chain is cut by the action of an endonuclease complex associated with RNA polymerase. The cleavage site is typically characterized by the presence of the base sequence AAUAAA near the cleavage site. After the mRNA is cleaved, an adenosine residue is added to the free 3' end at the cleavage site.

[0381] As used herein, the term "transient" refers to the expression of a non-integrated transgene over a period of hours, days, or weeks, wherein the expression period is less than the expression period if the gene is integrated into the genome or contained within a stable plasmid replicon in the host cell.

[0382] As used herein, the term "polynucleotide" is defined as a chain of nucleotides. In addition, nucleic acids are polymers of nucleotides. Therefore, nucleic acids and polynucleotides as used herein are interchangeable. It is common knowledge to those skilled in the art that nucleic acids are polynucleotides and that polynucleotides can be hydrolyzed into monomeric "nucleotides." Monomeric nucleotides can be hydrolyzed into nucleosides. As used herein, polynucleotides include, but are not limited to, all nucleic acid sequences obtained by any means available in the art, including, but not limited to, recombinant means (i.e., using conventional cloning techniques and PCR). TM etc.) and by synthetic means.

[0383] As used herein, the term "promoter" is defined as a DNA sequence that is recognized by the synthetic machinery of the cell or introduced synthetic machinery to initiate specific transcription of a polynucleotide sequence.

[0384] As used herein, the term "promoter / regulatory sequence" refers to a nucleic acid sequence required for expression of a gene product operably linked to the promoter / regulatory sequence. In some cases, this sequence may be a core promoter sequence, and in other cases, this sequence may also include an enhancer sequence and other regulatory elements required for expression of the gene product. A promoter / regulatory sequence may be, for example, a sequence that expresses a gene product in a tissue-specific manner.

[0385] As used herein, the term "constitutive promoter" is a nucleotide sequence that, when operably linked to a polynucleotide that encodes or specifies a gene product, causes the gene product to be produced in the cell under most or all physiological conditions of the cell.

[0386] As used herein, the term "inducible promoter" is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes the gene product to be produced in a cell essentially only when an inducer corresponding to the promoter is present in the cell.

[0387] As used herein, the term "tissue-specific promoter" is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specified by a gene, causes the gene product to be produced in a cell substantially only if the cell is of the tissue type corresponding to the promoter.

[0388] As used herein, the term "pseudotype" or "pseudotyping" refers to a virus whose viral envelope protein has been replaced with an envelope protein of another virus with preferred characteristics. For example, HIV can be pseudotyped with the vesicular stomatitis virus G protein (VSV-G) envelope protein, which allows HIV to infect a wider range of cells because the HIV envelope protein (encoded by the env gene) normally targets the virus to CD4 + Presenting cells. In a preferred embodiment of the present disclosure, the lentiviral envelope protein is pseudotyped with VSV-G. In one embodiment, the present disclosure provides packaging cells that produce recombinant retroviruses, such as lentiviruses, pseudotyped with VSV-G envelope glycoprotein.

[0389] As used herein, the term "recombinant antibody" refers to an antibody produced using recombinant DNA technology, such as, for example, an antibody expressed by a phage or yeast expression system. The term should also be interpreted as meaning an antibody that has been produced by synthesizing a DNA molecule encoding the antibody (and which expresses the antibody protein) or synthesizing the amino acid sequence of a specified antibody, wherein the DNA or amino acid sequence is obtained using recombinant DNA or amino acid sequence technology available and well known in the art.

[0390] As used herein, the term "recombinant viral vector" (RRV) refers to a vector that has sufficient viral genetic information to allow the RNA genome to be packaged into viral particles capable of infecting target cells in the presence of packaging components. RRV carries non-viral coding sequences to be delivered to target cells by the vector. RRV cannot replicate independently in the final target cell to produce infectious viral particles. Typically, RRV lacks functional gag-pol and / or env genes and / or other genes necessary for replication. The vector of the present disclosure can be configured as a split-intron vector. Preferably, the RRV vector of the present disclosure has a minimal viral genome.

[0391] As used herein, the term "retroviral vector" refers to a viral vector or plasmid that contains structural and functional genetic elements primarily derived from a retrovirus, or portions thereof.

[0392] In some embodiments, additional safety enhancement is provided by replacing the U3 region of the 5'LTR with a heterologous promoter to drive transcription of the viral genome during viral particle production. The heterologous promoter can be selected from the group consisting of simian virus 40 (SV40) (e.g., early or late) promoter, cytomegalovirus (CMV) (e.g., immediate early) promoter, Moloney murine leukemia virus (MoMLV) promoter, Rous sarcoma virus (RSV) promoter, and herpes simplex virus (HSV) (thymidine kinase) promoter. Typical promoters are capable of driving high levels of transcription in a Tat-independent manner. This replacement reduces the likelihood of recombinant production of replication-competent viruses because the intact U3 sequence is not present in the viral production system. In some embodiments, heterologous promoters have additional advantages in terms of how the viral genome is transcribed. For example, the heterologous promoter can be inducible, so that transcription of all or part of the viral genome will only occur in the presence of an inducing factor. Inducing factors include, but are not limited to, one or more chemical compounds or physiological conditions under which the host cell is cultured, such as temperature or pH.

[0393] As used herein, the term "signal transduction pathway" refers to the biochemical relationships between various signal transduction molecules that play a role in transmitting a signal from one part of a cell to another. The phrase "cell surface receptor" includes molecules and molecular complexes that are capable of receiving a signal and transmitting the signal across the cell's plasma membrane.

[0394] As used herein, the term "single-chain antibody" refers to an antibody formed by recombinant DNA technology in which immunoglobulin heavy and light chain fragments are linked to the Fv region via an engineered amino acid span. Various methods for producing single-chain antibodies are known in the art.

[0395] As used herein, the term "single-chain variable fragment" or "scFv" is a fusion protein in which the variable regions of the heavy chain (VH) and light chain (VL) of an immunoglobulin (e.g., mouse or human) are covalently linked to form a VH::VL heterodimer. The heavy chain (VH) and light chain (VL) are directly joined or joined by a peptide-encoded linker or spacer that connects the N-terminus of VH to the C-terminus of VL, or connects the C-terminus of VH to the N-terminus of VL. The terms "linker" and "spacer" are used interchangeably herein. In some embodiments, the antigen binding domain (e.g., a Tn-MUC1 binding domain, a PSMA binding domain, or a mesothelin binding domain) comprises an scFv having a VH-linker-VL configuration from N-terminus to C-terminus. In some embodiments, the antigen binding domain (e.g., a Tn-MUCl binding domain, a PSMA binding domain, or a mesothelin binding domain) comprises an scFv having a VL-linker-VH configuration from N-terminus to C-terminus. One skilled in the art will be able to select an appropriate configuration for use with the present disclosure.

[0396] The joint is usually rich in glycine to have flexibility, and rich in serine or threonine to have solubility.The joint can connect the heavy chain variable region and the light chain variable region of the extracellular antigen-binding domain.Various joint sequences are known in the art, including but not limited to glycine serine (GS) joints, such as (GS) n, (GSGGS) n, (GGGS) n and (GGGGS) n, wherein n represents an integer of at least 1.Exemplary joint sequences can include but are not limited to following amino acid sequence: GGSG (SEQ ID NO: 121), GGSGG (SEQ ID NO: 122), GSGSG (SEQ ID NO: 123), GSGGG (SEQ ID NO: 124), GGGSG (SEQ ID NO: 125), GSSSG (SEQ ID NO: 126), GGGGS (SEQ ID NO: 127) or GGGGSGGGGSGGGGS (SEQ ID NO: 128) etc. Those skilled in the art will be able to select the appropriate joint sequence for the present disclosure. In one embodiment, an antigen binding domain of the present disclosure (e.g., a CD19 binding domain) comprises a heavy chain variable region (VH) and a light chain variable region (VL). In some embodiments, VH and VL are separated by a linker sequence having the amino acid sequence GGGGSGGGGSGGGGS (SEQ ID NO: 128). In some embodiments, the linker nucleic acid sequence comprises the nucleotide sequence GGTGGCGGTGGCTCGGGCGGTGGTGGGTCGGGTGGCGGCGGA TCT (SEQ ID NO: 129).

[0397] Despite the removal of the constant region and the introduction of a linker, the scFv protein retains the specificity of the original immunoglobulin. Single-chain Fv polypeptide antibodies can be expressed from a nucleic acid comprising VH and VL coding sequences. Antagonistic scFvs with inhibitory activity have been described.

[0398] As used herein, the term "specificity" refers to the ability to specifically bind to (e.g., immunoreact with) a given target antigen (e.g., a human target antigen). A chimeric antigen receptor can be monospecific and contain one or more binding sites that specifically bind to a target, or a chimeric antigen receptor can be multispecific and contain two or more binding sites that specifically bind to the same or different targets. In certain embodiments, a chimeric antigen receptor is specific for two different (e.g., non-overlapping) portions of the same target. In certain embodiments, a chimeric antigen receptor is specific for more than one target.

[0399] As used herein, the term "spacer domain" generally refers to any oligopeptide or polypeptide that functions to connect a transmembrane domain to an extracellular domain or an intracellular domain in a polypeptide chain. The spacer domain can comprise up to about 300 amino acids, such as about 10 to about 100 amino acids, or about 25 to about 50 amino acids.

[0400] As used herein, the term "specific binding" with respect to an antibody means an antibody or its binding fragment (e.g., scFv) that recognizes a specific antigen but does not substantially recognize or bind to other molecules in the sample. For example, an antibody that specifically binds to an antigen from one species may also bind to the antigen from one or more species. However, this cross-species reactivity itself does not change the classification of an antibody as specific. In another example, an antibody that specifically binds to an antigen may also bind to different allele forms of the antigen. However, this cross-reactivity itself does not change the classification of an antibody as specific. In some cases, the term "specific binding" or "specifically binds" can be used with respect to the interaction of an antibody, protein, chimeric antigen receptor or peptide with a second chemical substance to mean that the interaction depends on the presence of a specific structure (e.g., antigenic determinant or epitope) on the chemical substance; for example, a chimeric antigen receptor recognizes and binds to a specific protein structure, rather than generally recognizing and binding to a protein. If an antibody is specific for epitope "A," the presence of molecules containing epitope A (or free, unlabeled A) in a reaction containing labeled "A" and the antibody will reduce the amount of labeled A bound to the antibody.

[0401] As used herein, the term "stimulation" refers to a primary response induced by the binding of a stimulatory molecule (e.g., a TCR / CD3 complex) to its cognate ligand, thereby mediating a signal transduction event (e.g., but not limited to, signal transduction via the TCR / CD3 complex). Stimulation can mediate changes in the expression of certain molecules, such as downregulation of TGF-β and / or reorganization of cytoskeletal structure, clonal expansion, and differentiation into different subsets.

[0402] As used herein, the term "stimulatory molecule" means a molecule on a T cell that specifically binds to a cognate stimulatory ligand present on an antigen presenting cell. Stimulatory molecules can be expressed by T cells, which provide one or more primary cytoplasmic signaling sequences that regulate the primary activation of the TCR complex in a stimulating manner for at least some aspect of the T cell signaling pathway. For example, the primary signal is initiated by the binding of, for example, the TCR / CD3 complex to the MHC molecule loaded with peptides, and it results in mediating T cell responses, including but not limited to proliferation, activation, differentiation, etc. The primary cytoplasmic signaling sequence (also referred to as a "primary signaling domain") that acts in a stimulating manner can contain a signaling motif known as an immunoreceptor tyrosine-based activation motif or ITAM. Examples of primary cytoplasmic signaling sequences containing ITAMs that are particularly useful in the present disclosure include, but are not limited to, those derived from: TCR ζ, FcR γ, FcR β, CD3 γ, CD3 δ, CD3 ε, CD5, CD22, CD79a, CD79b, CD278 (also referred to as "ICOS"), and CD66d. In the specific CARs of the present disclosure, the intracellular signaling domain in any one or more CARs of the present disclosure comprises an intracellular signaling sequence, such as the primary signaling sequence of CD3-ζ. In the specific CARs of the present disclosure, the primary signaling sequence of CD3-ζ is a sequence provided as SEQ ID NO: 52, or an equivalent residue from a non-human species (e.g., mouse, rodent, monkey, ape, etc.). In the specific CARs of the present disclosure, the primary signaling sequence of CD3-ζ is a sequence as provided in SEQ ID NO: 54, or an equivalent residue from a non-human species (e.g., mouse, rodent, monkey, ape, etc.).

[0403] As used herein, the term "stimulatory ligand" means a ligand that, when present on an antigen-presenting cell (e.g., aAPC, dendritic cell, B cell, etc.), can specifically bind to a cognate binding partner on a T cell (referred to herein as a "stimulatory molecule"), thereby mediating a primary response of the T cell (including but not limited to activation, initiation of an immune response, proliferation, etc.). Stimulatory ligands are well known in the art and particularly encompass peptide-loaded MHC class I molecules, anti-CD3 antibodies, superagonist anti-CD28 antibodies, and superagonist anti-CD2 antibodies.

[0404] As used herein, the term "subject" refers to a vertebrate. A vertebrate can be a mammal, such as a non-primate (e.g., cattle, pigs, horses, cats, dogs, rats, etc.) or a primate (e.g., monkeys and humans). Mammals can include, but are not limited to, humans, non-human primates, wild animals, untamed animals, farm animals, sports animals, and pets. In some embodiments, "subject" and "patient" are used interchangeably. Any living organism that can elicit an immune response can be a subject or a patient. In certain exemplary embodiments, the subject is a huma...

Claims

1. A vector comprising: (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding a chimeric antigen receptor (CAR), wherein the CAR comprises a single-chain antibody or single-chain antibody fragment comprising an anti-CD19 binding domain, a transmembrane domain, and costimulatory and intracellular signaling domains; and (b) a second polynucleotide comprising a nucleic acid encoding a polypeptide that enhances immune cell function or a functional derivative thereof; wherein the first polynucleotide is operably linked to the second polypeptide via a linker peptide; wherein the anti-CD19 binding domain comprises: (a) a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1) of SEQ ID NO: 1, a light chain complementary determining region 2 (LC CDR2) of SEQ ID NO: 2, and a light chain complementary determining region 3 (LC CDR3) of SEQ ID NO: 3; and a heavy chain variable domain comprising a heavy chain complementary determining region 1 (HC CDR1) of SEQ ID NO: 4, a heavy chain complementary determining region 2 (HC CDR2) of SEQ ID NO: 5, and a heavy chain complementary determining region 3 (HC CDR3) of SEQ ID NO: 6; or (b) a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1) of SEQ ID NO: 193, a light chain complementary determining region 2 (LC CDR2) of SEQ ID NO: 194, and a light chain complementary determining region 3 (LC CDR3) of SEQ ID NO: 195; and a heavy chain variable domain comprising a heavy chain complementary determining region 1 (HC CDR1) of SEQ ID NO: 196, a heavy chain complementary determining region 2 (HC CDR2) of SEQ ID NO: 197, and a heavy chain complementary determining region 3 (HC CDR3) of SEQ ID NO: 198; or (c) a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3) disclosed in Table 2; and A heavy chain variable domain comprising a heavy chain complementarity determining region 1 (HC CDR1), a heavy chain complementarity determining region 2 (HC CDR2), and a heavy chain complementarity determining region 3 (HC CDR3) disclosed in Table 2.

2. The vector according to claim 1, wherein the polypeptide or functional derivative thereof that enhances immune cell function is selected from cytokines, interferons, chemokines, antibodies or antibody fragments, checkpoint inhibitor antagonists, dominant negative receptors, switch receptors, and combinations thereof.

3. The vector according to claim 1 or 2, wherein the polypeptide or its functional derivative that enhances immune cell function is: (a) chemokines, chemokine receptors, cytokines, cytokine receptors, and combinations thereof; (b) a cytokine selected from the group consisting of interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-11 (IL-11), interleukin-12 (IL-12), interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-18 (IL-18), interleukin-18 receptor (IL-18R), interleukin-21 (IL-21), granulocyte macrophage colony-stimulating factor, interferon alpha, beta or gamma, erythropoietin, and combinations thereof; or (c) a chemokine selected from CCL21, CCL19, or a combination thereof.

4. The vector according to any one of claims 1 to 3, wherein the polypeptide or functional derivative thereof that enhances immune cell function further comprises a leader sequence selected from the group consisting of an IL-2 signal sequence, an IL-12 signal sequence, a κ leader sequence, a CD8 leader sequence, or any equivalent thereof.

5. The vector according to any one of claims 1 to 4, wherein the polypeptide or functional derivative thereof that enhances immune cell function comprises an IL-18 polypeptide, or a polypeptide having the amino acid sequence of SEQ ID NO: 105, SEQ ID NO: 215, SEQ ID NO: 106, SEQ ID NO: 107, or an amino acid sequence that is about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to SEQ ID NO: 105, SEQ ID NO: 215, SEQ ID NO: 106 or SEQ ID NO:

107.

6. The vector of claim 5, wherein the IL-18 polypeptide further comprises a CD8 leader sequence or the amino acid sequence of SEQ ID NO: 25, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:

25.

7. The vector according to claim 5 or 6, wherein the IL-18 polypeptide comprises a mutation at a position selected from the group consisting of positions 42, 74, 85, 87, 89, 104, 112, 10, 132, 143, 149, 163 and 189 of SEQ ID NO:

107.

8. The vector of any one of claims 5-7, wherein the IL-18 polypeptide comprises E42A; E42K; K89A; E42A and K89A; E42K and K89A; E42A and C74S; E42A, C74S and K89A; C74S and K89A; C74S, C112S and C112S; E42A, C74S, C112S and C112S; E42A, K89A, C74S, C112S and C112S of SEQ ID NO:

107.

9. The vector according to claim 7 or 8, wherein the IL-18 polypeptide: (a) exhibits at least about a 2-fold increased activity when compared to WT IL-18; (b) is resistant to IL18BP inhibition when compared to WT IL-18; and / or (c) At least about 4-fold higher concentrations of IL-18BP are required for neutralization when compared to WT IL-18.

10. The vector according to any one of claims 1 to 9, wherein the vector is selected from DNA, RNA, plasmid, lentiviral vector, adenoviral vector or retroviral vector.

11. The vector according to any one of claims 1 to 10, wherein the vector is a lentiviral vector.

12. The vector according to any one of claims 1 to 11, wherein the vector is an in vitro transcribed vector.

13. The vector according to any one of claims 1 to 12, wherein the constitutive promoter comprises a promoter selected from the group consisting of an EF-1α promoter, a PGK-1 promoter, a truncated PGK-1 promoter, a UBC promoter, a CMV promoter, a CAGG promoter, and an SV40 promoter.

14. The vector according to any one of claims 1 to 13, wherein the constitutive promoter: (a) is the EF-1 promoter; or (b) A sequence comprising SEQ ID NO:

101.

15. The vector according to any one of claims 1 to 14, further comprising a rev response element (RRE), a poly(A) tail, a 3'UTR, a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) and / or a cPPT sequence. The vector according to claim 15 , wherein the WPRE comprises the sequence of SEQ ID NO:

100.

17. The vector of any one of claims 1-16, wherein the anti-CD19 binding domain comprises: a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1) of SEQ ID NO: 1, a light chain complementary determining region 2 (LC CDR2) of SEQ ID NO: 2, and a light chain complementary determining region 3 (LC CDR3) of SEQ ID NO: 3; and A heavy chain variable domain comprising a heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO: 4, a heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 5, and a heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO:

6.

18. The vector of claim 17, wherein the light chain variable region comprises the amino acid sequence of SEQ ID NO: 7 or 199, or an amino acid sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 7 or 199.

19. The vector of claim 17 or 18, wherein the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 8 or 200, or an amino acid sequence that is at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 8 or 200.

20. The vector of any one of claims 17-19, wherein the light chain variable region comprises the amino acid sequence of SEQ ID NO: 7 and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:

8.

21. The vector of any one of claims 17-20, wherein the light chain variable region comprises the amino acid sequence of SEQ ID NO: 199 and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:

200.

22. The vector of any one of claims 1-21, wherein the CD19 binding domain is a scFv.

23. The vector of any one of claims 1-22, wherein the anti-CD 19 binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 146, or a sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 226, 201, 179, 168, and 146.

24. The vector of any one of claims 1-23, wherein the anti-CD19 binding domain comprises: (a) a nucleic acid sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216; or (b) a sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225 or SEQ ID NO:

216.

25. The vector of any one of claims 1-24, wherein the anti-CD 19 binding domain comprises a nucleic acid sequence selected from the group consisting of: SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225, and SEQ ID NO: 216; or (b) a sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to SEQ ID NOs: 19-24, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 225 or SEQ ID NO:

216.

26. The vector of any one of claims 1-25, wherein the transmembrane domain comprises a transmembrane domain of a protein selected from the group consisting of the alpha, beta, or zeta chain of a T cell receptor, CD2, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9.

27. The vector of any one of claims 1-26, wherein the transmembrane domain comprises an amino acid sequence selected from SEQ ID NO: 29, 31 or 33, or an amino acid sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to SEQ ID NO: 29, 31 or 33.

28. The vector of any one of claims 1-27, wherein the transmembrane domain comprises a nucleic acid sequence selected from SEQ ID NO: 30, SEQ ID NO: 32, or SEQ ID NO: 34, or a nucleic acid sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 30, 32, or 34.

29. The vector of any one of claims 1-28, wherein the transmembrane domain comprises a CD8 transmembrane domain and / or the amino acid sequence of SEQ ID NO: 29, or an amino acid sequence that is about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO:

29.

30. The vector of any one of claims 1-29, wherein the transmembrane domain comprises the nucleic acid sequence of SEQ ID NO: 30, or a nucleic acid sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO:

30.

31. The vector of any one of claims 1-30, wherein the encoded anti-CD19 binding domain is connected to the transmembrane domain via a hinge region.

32. The vector of claim 31 , wherein the hinge region: (a) from a protein selected from the group consisting of: an Fc fragment of an antibody, a hinge region of an antibody, a CH2 region of an antibody, a CH3 region of an antibody, an artificial spacer sequence, an IgG hinge, a CD8 hinge, and any combination thereof; or (b) an amino acid sequence comprising SEQ ID NO: 27 or SEQ ID NO: 35, or an amino acid sequence that is about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to SEQ ID NO: 27 or 35.

33. The vector of any one of claims 1-32, wherein the hinge region comprises a CD8 hinge region and / or the amino acid sequence of SEQ ID NO: 27, or an amino acid sequence that is about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to SEQ ID NO:

27.

34. The vector of any one of claims 1-33, wherein the hinge region comprises a nucleic acid sequence selected from SEQ ID NO: 28 or SEQ ID NO: 36, or a nucleic acid sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to SEQ ID NO: 28 or 36.

35. The vector of any one of claims 1 to 34, wherein the costimulatory domain is a functional signaling domain of a protein selected from the group consisting of: a TNFR superfamily member, OX40 (CD134), CD2, CD5, CD7, CD27, CD28, CD30, CD40, PD-1, CD8, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD11a, CD18, ICOS (CD278), LIGHT, NKG2C, B7-H3, a ligand that specifically binds to CD83, DAP10, DAP12, Lck, Fas, and 4-1BB (CD137).

36. The vector of any one of claims 1-35, wherein the costimulatory domain comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 46, SEQ ID NO: 48, or SEQ ID NO: 50, or an amino acid sequence that is about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 37, 39, 41, 43, 46, 48, or 50.

37. The vector of any one of claims 1-36, wherein the costimulatory domain comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 47, or SEQ ID NO: 49, or a nucleic acid sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 38, 40, 42, 44, 45, 47, or 49.

38. The vector of any one of claims 1-37, wherein the intracellular signaling domain comprises a signaling domain of a protein selected from the group consisting of CD3ζ, FcγRIII, FcεRI, a cytoplasmic tail of an Fc receptor, a cytoplasmic receptor with an immunoreceptor tyrosine-based activation motif (ITAM), TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d.

39. The vector of any one of claims 1-38, wherein the intracellular signaling domain comprises the intracellular signaling domain of CD3 zeta, the amino acid sequence of SEQ ID NO: 52 or 54, or an amino acid sequence that is about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 52 or 54.

40. The vector of any one of claims 1-39, wherein the intracellular signaling domain comprises the nucleic acid sequence of SEQ ID NO: 53 or 55, or a nucleic acid sequence about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 53 or 55.

41. The vector of any one of claims 1-40, wherein the CAR comprises a functional signaling 4-1BB co-stimulatory domain and a functional CD3 zeta intracellular signaling domain.

42. The vector of any one of claims 1-41, wherein the CAR comprises the amino acid sequence of SEQ ID NO: 37, SEQ ID NO: 52 or SEQ ID NO: 54, or an amino acid sequence that is about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to SEQ ID NO: 37, SEQ ID NO: 52 or SEQ ID NO:

54.

43. The vector of any one of claims 1-42, wherein the intracellular signaling domain comprises the amino acid sequence of SEQ ID NO: 37 and the amino acid sequence of SEQ ID NO: 52 or SEQ ID NO: 54, or an amino acid sequence that is about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 37, SEQ ID NO: 52, or SEQ ID NO: 54, wherein the sequences are expressed in the same frame as a single polypeptide chain.

44. The vector according to any one of claims 1 to 43, wherein: (a) the nucleic acid sequence comprises the sequence of SEQ ID NO:38, or a nucleic acid sequence that is 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to SEQ ID NO:38, and / or (b) the nucleic acid sequence comprises the sequence of SEQ ID NO:53 or SEQ ID NO:55, or a nucleic acid sequence that is about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to SEQ ID NO:53 or 55.

45. The vector of any one of claims 1-44, wherein the CAR further comprises a leader sequence.

46. The vector of claim 45, wherein the leader sequence comprises SEQ ID NO:

25.

47. The vector according to any one of claims 1 to 46, wherein the linker peptide: (a) selected from F2A, E2A, P2A, T2A or furin-(G4S)2-T2A (F-GS2-T2A); and / or (b) an amino acid sequence comprising SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96 or SEQ ID NO: 99; and / or (c) a nucleic acid sequence comprising SEQ ID NO:93, SEQ ID NO:95, SEQ ID NO:97 or SEQ ID NO:

98.

48. A vector comprising: (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding an anti-CD19 chimeric antigen receptor (CAR), wherein the CAR comprises: (i) an anti-CD19 binding domain comprising: (1) LC CDR1 of SEQ ID NO: 1, LC CDR2 and LC CDR3 of SEQ ID NO: 2, HC CDR1 of SEQ ID NO: 4, HC CDR2 of SEQ ID NO: 5, and HC CDR3 of SEQ ID NO: 6; or (2) LC CDR1 of SEQ ID NO: 193, LC CDR2 of SEQ ID NO: 194, LC CDR3 of SEQ ID NO: 195; HC CDR1 of SEQ ID NO: 196, HC CDR2 of SEQ ID NO: 197, and HC CDR3 of SEQ ID NO: 198; or (c) a light chain variable domain comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3) disclosed in Table 2; and a heavy chain variable domain comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3) disclosed in Table 2; (ii) a transmembrane domain selected from the group consisting of CD28 or CD8 transmembrane domains; (iii) a costimulatory domain comprising an intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB; and (iv) contains the intracellular signaling domain of CD3-ζ; (b) a second polynucleotide comprising a nucleic acid encoding interleukin-18 (IL-18) and / or interleukin-18 receptor (IL-18R); The first polynucleotide is operably linked to the second polypeptide via a linker peptide selected from the group consisting of F2A, E2A, P2A, T2A and furin-(G4S)2-T2A (F-GS2-T2A).

49. A vector comprising: (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding an anti-CD19 chimeric antigen receptor (CAR), wherein the CAR comprises: (i) an anti-CD19 binding domain comprising the amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168 or 146; (ii) a transmembrane domain selected from the group consisting of CD28 or CD8 transmembrane domains; (iii) a costimulatory domain comprising an intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB; and (iv) comprising an intracellular signaling domain of CD3-ζ; and (b) a second polynucleotide comprising a nucleic acid encoding interleukin-18 (IL-18) and / or interleukin-18 receptor (IL-18R); The first polynucleotide is operably linked to the second polypeptide via a linker peptide selected from the group consisting of F2A, E2A, P2A, T2A, or furin-(G4S)2-T2A (F-GS2-T2A).

50. A vector comprising: (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding an anti-CD19 chimeric antigen receptor (CAR), wherein the CAR comprises: (i) an anti-CD19 binding domain comprising the amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168 or 146; (ii) a transmembrane domain comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 29, 31 and 33; (iii) a costimulatory domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:46, SEQ ID NO:48, and SEQ ID NO:50; and (iv) an intracellular signaling domain comprising the amino acid sequence of SEQ ID NO: 52 or SEQ ID NO: 54; and (b) a second polynucleotide comprising: (i) a nucleic acid encoding the amino acid of SEQ ID NO: 105, 215, 106 or 107, and / or (ii) an IL-18 polypeptide comprising E42A; E42K; K89A; E42A and K89A; E42K and K89A; E42A and C74S; E42A, C74S and K89A; C74S and K89A; C74S, C112S and C112S; E42A, C74S, C112S and C112S; E42A, K89A, C74S, C112S and C112S of SEQ ID NO: 107; The first polynucleotide is operably linked to the second polypeptide via a linker peptide selected from the group consisting of F2A, E2A, P2A, T2A and furin-(G4S)2-T2A (F-GS2-T2A).

51. A vector comprising: (a) a first polynucleotide comprising a constitutive promoter operably linked to a nucleic acid encoding an anti-CD19 chimeric antigen receptor (CAR), wherein the CAR comprises: (i) an anti-CD19 binding domain comprising the amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168 or 146; (ii) a transmembrane domain comprising the amino acid sequence of SEQ ID NO: 29; (iii) a costimulatory domain comprising the amino acid sequence of SEQ ID NO: 37; and (iv) an intracellular signaling domain of SEQ ID NO: 52 or SEQ ID NO: 54; and (b) a second polynucleotide comprising: (i) a nucleic acid encoding the amino acid sequence of SEQ ID NO: 105, 215, 106 or 107, and / or (ii) an IL-18 polypeptide comprising E42A; E42K; K89A; E42A and K89A; E42K and K89A; E42A and C74S; E42A, C74S and K89A; C74S and K89A; C74S, C112S and C112S; E42A, C74S, C112S and C112S; E42A, K89A, C74S, C112S and C112S of SEQ ID NO: 107; The first polynucleotide is operably linked to the second polypeptide via a linker peptide selected from the group consisting of F2A, E2A, P2A, T2A and furin-(G4S)2-T2A (F-GS2-T2A).

52. The vector of any one of claims 1-51, wherein the first polynucleotide comprises: (a) an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 66, 77, 88, 148, 170, 181, 203, 214, 159, 192, 23 and 20; and / or (b) an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 65, 76, 87, 147, 169, 180, 202, 213, 158, 191, 22 and 19.

53. A modified cell comprising the vector of any one of claims 1-52.

54. The modified cell of claim 53, wherein the modified cell is an immune cell or a precursor cell thereof.

55. The modified cell of claim 53 or 54, wherein the modified cell is selected from the group consisting of T cells, natural killer (NK) cells, cytotoxic T lymphocytes (CTLs), regulatory T cells, natural killer T (NKT) cells, dendritic cells, macrophages, human embryonic stem cells, and pluripotent stem cells from which lymphoid cells can be differentiated.

56. The modified cell of any one of claims 53-55, wherein the modified cell is an autologous cell, a heterologous cell, or an allogeneic cell.

57. The modified cell of any one of claims 53-56, wherein the cell is a modified T cell or a modified human T cell.

58. The modified cell of any one of claims 53-55, wherein the modified T cell is a CD8 + T cells.

59. The modified cell of any one of claims 53-58, wherein the modified cell is a cell having a central memory phenotype (CD44 - ;Ly6C + ) of CD8 + T cells, with M1 phenotype (MHC-II + ) macrophages, or macrophages with a mature and activated phenotype (CD86 + ;MHC - II + ) of dendritic cells.

60. The modified cell of any one of claims 53-59, further comprising: (a) a switch receptor comprising a first polypeptide conjugated to a second polypeptide, the first polypeptide comprising at least a portion of an inhibitory molecule selected from PD1, TGFβR, TIM-2, and BTLA, and the second polypeptide comprising an intracellular signaling domain of a molecule selected from OX40, CD27, CD28, IL-12R, ICOS, and 4-1BB; (b) a dominant negative receptor comprising a truncated variant of a receptor selected from the group consisting of PD1, TGFβR, TIM-2, and BTLA; and / or (c) a polypeptide or a functional derivative thereof that enhances immune cell function, wherein the polypeptide or the functional derivative thereof is selected from chemokines, chemokine receptors, cytokines, cytokine receptors, interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-21 (IL-21), CCL21, CCL19 and combinations thereof.

61. A composition comprising a modified cell or modified cell population according to any one of claims 53-60.

62. A method of preparing a modified cell, the method comprising transfecting a cell with a vector according to any one of claims 1-52.

63. A method of providing anti-tumor immunity to a mammal, the method comprising administering to the mammal an effective amount of: (a) a composition comprising a modified cell according to any one of claims 53 to 60 or a modified cell prepared by the method of claim 62; (b) a modified cell according to any one of claims 53 to 60; or a modified cell prepared by the method of claim 62; or (c) The composition according to claim 61.

64. A method of treating a mammal having a disease associated with CD19 expression, the method comprising administering to the mammal an effective amount of: (a) a composition comprising a modified cell according to any one of claims 53 to 60 or a modified cell prepared by the method of claim 62; (b) a modified cell according to any one of claims 53 to 60; or a modified cell prepared by the method of claim 62; or (c) The composition according to claim 61.

65. The method of claim 63 or 64, wherein the modified cells are autologous modified T cells.

66. The method of any one of claims 63-65, wherein the modified cells are allogeneic modified T cells.

67. The method of any one of claims 63-66, wherein the mammal is a human.

68. The method of any one of claims 63-67, wherein the disease associated with CD19 expression is selected from: (a) proliferative diseases, malignancies, precancerous conditions or non-cancer related indications associated with CD19 expression; or (b) cancer, atypical and / or nonclassical cancer, myelodysplasia, myelodysplastic syndrome, or preleukemia.

69. The method of any one of claims 63-68, wherein the disease is a blood cancer selected from: (a) acute leukemia, chronic leukemia, hematological disorders, and combinations thereof; or (b) B-cell acute lymphoblastic leukemia ("BALL"), T-cell acute lymphoblastic leukemia ("TALL"), acute lymphoblastic leukemia (ALL), chronic myelogenous leukemia (CML), chronic lymphocytic leukemia (CLL), B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative disorders, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndrome, non-Hodgkin lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom's macroglobulinemia, ineffective production (or dysplasia) of myeloid blood cells, and combinations thereof.

70. The method of any one of claims 63-69, wherein the modified cell or the composition is administered in combination with: (a) an agent that increases the efficacy of a modified cell comprising a vector according to any one of claims 1 to 52, a modified cell according to any one of claims 53 to 60, or a modified cell prepared by the method according to claim 62; (b) an agent that ameliorates one or more side effects associated with administration of a modified cell comprising a vector according to any one of claims 1 to 52, a modified cell according to any one of claims 53 to 60, or a modified cell prepared by the method according to claim 62; or (c) an agent for treating the disease associated with CD19.

Images