Genetically modified host cells producing L-serine
Through genetic engineering, bacteria are modified, SerA expression is increased and HGA production is reduced, and the metabolic pathway of glyceraldehyde-3-phosphate is optimized, which solves the problem of NADH and HGA accumulation in L-serine production, and improves production efficiency and yield.
Patent Information
- Application Number
- CN202380073130.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2022-10-20
- Filing Date
- 2023-10-20
- Publication Date
- 2025-08-12
AI Technical Summary
In the prior art, there are problems of NADH and hydroxyglutaric acid (HGA) accumulation in the L-serine production process, resulting in limited production efficiency and yield, and the existing methods have not effectively solved this problem.
By genetically engineering bacteria, increasing SerA expression and reducing HGA production, bacteria are engineered to reduce intracellular accumulation of NADH and HGA, and optimize the metabolic pathway of glyceraldehyde-3-phosphate.
The nominal and mass yield of L-serine is improved, the accumulation of NADH and HGA is reduced, and the metabolite production efficiency of glyceraldehyde-3-phosphate is enhanced.
Smart Images

Figure BDA0005359809890000071 
Figure BDA0005359809890000301 
Figure BDA0005359809890000311
Abstract
Description
Technical Field
[0001] The present invention relates to the microbial industry, and more specifically, to the bioindustrial production of metabolites such as L-serine and its derivatives using genetically modified bacteria. More specifically, the present disclosure describes recombinant host cells that produce metabolites from glyceraldehyde-3-phosphate via metabolic pathways engineered to reduce the intracellular accumulation of NADH and / or hydroxyglutarate (HGA), which negatively impact the metabolites. Also disclosed are recombinant polynucleotides encoding recombinant polypeptides of the pathways, and cell cultures of the host cells that produce the metabolites when cultured in a fermentation process. Fermentation compositions of the host cells and / or their metabolites produced by such methods, also referred to as bio-based compositions of metabolites, are further disclosed. Background Art
[0002] Genetically modified host cells that produce metabolites such as L-serine are known, for example, from WO2016120326 describing the production of L-serine using genetically engineered microorganisms with defects in the serine degradation pathway. WO2004 / 108894 discloses a method for producing amino acids using genetically modified bacteria, including a polypeptide similar to SEQ ID NO: 10 disclosed herein. WO2021 / 081185 describes microbial organisms with increased availability of cofactors such as NADPH for increasing the production of various products. WO2020 / 0107626 describes a method for producing L-amino acids, comprising culturing modified bacterial cells with an increased amount of NADPH compared to unmodified bacterial cells, whereby the L-amino acid yield from the modified bacterial cells is greater than the yield from the unmodified bacterial cells. WO2021 / 195705 describes a recombinant microorganism and nucleic acid construct for producing biohydrogen and a method for modifying a microorganism to enable the production of hydrogen. In this process, it is proposed to replace the gapA gene in Escherichia coli with the gapC gene from Clostridium acetobutylicum. CN103436504A describes methods and uses for constructing a Corynebacterium glutamicum strain resistant to L-serine feedback inhibition by mutating the 3-phosphoglycerate dehydrogenase enzyme. The 3-phosphoglycerate dehydrogenase has minimal similarity to SEQ ID NO: 10 of the present disclosure.
[0003] Furthermore, hydroxyglutarate (HGA) is known to be produced as a byproduct in many different organisms, including humans. In humans, it is produced by isocitrate dehydrogenase (IDH) or phosphoglycerate dehydrogenase (SerA). These enzymes oxidize NADH to NAD. + And reduce α-ketoglutarate (KGA) to HGA, such as Figure 1 As shown in a 1HGA accumulation has been found in many types of cancer and has been classified as an abnormal metabolite 2 In prokaryotes, the main source of HGA production is SerA. The reason why SerA undergoes this promiscuous reaction is still unclear and is believed to be an accidental reaction. 3 It has recently been shown that HGA production is coupled to the native SerA reaction to reduce the Gibbs free energy. SerA catalyzes the first step in the L-serine biosynthesis reaction, in which it oxidizes 3-phosphoglycerate (3-PG) to 3-hydroxyphosphopyruvate (3-PY). This is a reaction with a Gibbs free energy greater than +30 kJ / mol. 4 On the other hand, the other two reactions in L-serine biosynthesis catalyzed by SerC and SerB have negative Gibbs free energy ( Figure 1 b), thus making the SerA reaction the rate-determining step. To lower the energy barrier, it is suggested that the oxidation of 3-PG is coupled with the reduction of KGA to HGA. 3 LghO (formerly YgaF) in and many Pseudomonas species 4 HGA is oxidized back to KGA by D-hydroxyglutarate dehydrogenase (D2DHH) in the cell. The resulting reducing equivalents are supplied to cytochrome c, which is then channeled into the electron transport chain for ATP production or oxygen to produce hydrogen peroxide. 3 .
[0004] Based on different protein domains 1 Based on the presence of HGA, SerA has been classified into three types: type 1, type 2, and type 3. Some SerA homologs are known to lack KGA reduction activity. However, such SerA proteins do not necessarily belong to a specific type or class of enzymes. For example, SerA from rat, Mycobacterium tuberculosis, Corynebacterium glutamicum, and Bacillus subtilis do not appear to accumulate HGA. 4 , while human SerA belonging to the same class has a tendency to accumulate HGA 5 It is currently unknown how SerA, without the confounding KGA reducing activity, overcomes the free energy barrier to efficiently drive the reaction forward.
[0005] As mentioned above, SerA is the first key step in L-serine biosynthesis, so in order to overproduce L-serine, SerA from Escherichia coli has been used in most published works. 6 Since the oxidation of 3-PG is coupled with the reduction of KGA ( Figure 1 B), increased L-serine production leads to higher HGA 7 An obvious strategy to avoid HGA accumulation is to overexpress a heterologous SerA that lacks activity against KGA, such as in Corynebacterium glutamicum.4,6 or co-express HGA oxidase to recycle HGA back to KGA, as shown previously.
[0006] We tested two approaches, and the expression of SerA, which lacks KGA reducing activity, resulted in a decrease in growth and production of L-serine (Examples 5 and 6), while the co-expression of LghO did not result in any decrease in HGA accumulation levels (data not shown). We took a unique approach in which we hypothesized that HGA accumulation could be proportional to the available NADH pool in the cell, and that reducing this NADH pool could in turn reduce HGA accumulation. Furthermore, when coupled with the overexpression of SerA, which has no or reduced KGA activity, this approach would result in higher L-serine production.
[0007] In the literature, two strategies are applied to reduce the NADH pool: using NADH oxidase (Nox) 8 Oxidation of NADH to NAD + Alternatively, NADPH-producing enzymes may be substituted for NADH-producing enzymes, such as NADPH-dependent glutamate dehydrogenases, which may be replaced by NADH-dependent enzymes. 9 or replacing 3-phosphoglycerate dehydrogenase with a heterologous NADPH variant 10,11 Although all of the above approaches have been tried in the literature, their effects on HGA accumulation have never been investigated. We further show that reduction of the NADH pool is essential for the production of L-serine from SerA, which does not have KGA-reducing activity. Without the above approaches, cell growth and L-serine production are hampered. Furthermore, L-serine is a precursor for many amino acids such as cysteine, methionine, and tryptophan, and overexpression of SerA has been a standard strategy to increase the production of these compounds. 12,13 , the above strategies will also increase their production. Summary of the Invention
[0008] An object of the present invention is to provide a means for more efficiently producing metabolites from glyceraldehyde-3-phosphate, such as L-serine and its derivatives, in microbial cells. More specifically, an object of the present invention is to provide a method for producing metabolites such as L-serine or its derivatives from glyceraldehyde-3-phosphate with higher nominal yields and improved mass yields. This is achieved by the discovery that the production of metabolites of glyceraldehyde-3-phosphate, such as L-serine, can be enhanced by engineering microorganisms to provide for preventing or reducing or mitigating the negative effects of intracellular accumulation of NADH and / or hydroxyglutarate (HGA) on metabolite production, including engineering bacteria to have increased SerA expression and reduced hydroxyglutarate production, wherein the NADH and / or hydroxyglutarate (HGA) are produced by one or more enzymes in the pathway that produces the metabolite.
[0009] The present disclosure describes, in a first aspect, a genetically engineered host cell that produces a metabolite from 3-phosphoglycerate via a metabolic pathway, comprising one or more genetic modifications that prevent, reduce, or mitigate the negative impact of metabolite production on the intracellular accumulation of NADH and / or hydroxyglutarate (HGA) produced by one or more pathway enzymes.
[0010] In a second aspect, the present disclosure describes a cell culture comprising the host cells described herein and a growth medium.
[0011] In a third aspect, the present disclosure describes a method for producing a metabolite from 3-phosphoglycerate, comprising:
[0012] a) cultivating a cell culture as described herein under conditions that allow the host cells to produce metabolites from 3-phosphoglycerate; and
[0013] b) optionally recovering and / or isolating metabolites from 3-phosphoglycerate.
[0014] In a fourth aspect, the present disclosure describes a fermentation composition comprising biobased metabolites of the cell culture described herein and metabolites from 3-phosphoglycerate, wherein at least 20% by weight of the carbon is biobased.
[0015] In a fifth aspect, the present invention provides a genetically engineered bacterium that has been modified to have increased expression of a polypeptide having D-3-phosphoglycerate dehydrogenase activity (SerA) and reduced production of hydroxyglutarate (HGA), compared to an otherwise identical bacterium that does not carry the modification.
[0016] In a sixth aspect, the present invention provides a method for producing L-serine, comprising: culturing the bacterium according to the fifth aspect in a culture medium. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 A. The reaction catalyzed by SerA. The native reaction involves the oxidation of PGA, while the hybrid reaction involves the reduction of KGA. B. A potential reason for SerA to produce HGA is that the total Gibbs free energy of the reaction is reduced from 33 to 4.5 kJ / mol. 4 .
[0018] Figure 2 After 24 h of incubation, HGA concentrations were measured in the supernatant of batch fermentations. The strain expressing NADH oxidase (Nox) accumulated 8-fold less HGA than the strain not expressing NADH oxidase.
[0019] Figure 3 Schematic diagram of L-serine production by recycling NADH by RocG.
[0020] Figure 4 AB. L-serine concentrations were measured in the supernatants of 48- and 70-h fed-batch fermentations of E. coli strains expressing either native gapA or heterologous gapC. Both strains expressed an L-serine pathway containing either serACB from E. coli (A) or serCB from E. coli and SerA from Corynebacterium glutamicum (B).
[0021] Figure 5 Growth curves of a genetically engineered strain expressing gapC (serHM_608) and a genetically engineered strain not expressing gapC (serHM_708) obtained by 24 h batch fermentation in baffled shake flasks. Error bars are the standard deviation of 2 / 3 biological replicates.
[0022] Figures 6a to 6c : Plasmid maps of all plasmids used in Examples 1 to 5.
[0023] Figure 7 : Plasmid map of the plasmid used in Example 6.
[0024] Figure 8 : L-serine concentration detected in the supernatant of batch fermentation after 24 h of incubation. Strains expressing truncated serA from rat showed increased L-serine production.
[0025] Figure 9 : L-serine concentrations detected in the supernatants of batch fermentations of strains expressing different NADPH glyceraldehyde 3-phosphate dehydrogenases after 24 h of incubation.
[0026] Figure 10 : Plasmid map of the plasmid used in Example 8.
[0027] Figure 11 : L-serine concentration measured in the supernatant of batch fermentations after 24 h of incubation. Strains expressing Nox from L. parakefiri showed increased L-serine production.
[0028] Figure 12: Plasmid maps of all plasmids used in Example 9.
[0029] Figures 13a to 13d : L-serine and HGA concentrations in the supernatant of batch fermentations after 24 h incubation of strains overexpressing pgl and zwf in combination with serA from Corynebacterium glutamicum in the gapC and gapA background, and serA from Escherichia coli in the gapC and gapA background.
[0030] Figure 14Shown are the effects of replacing NADH-dependent glyceraldehyde-3-phosphate dehydrogenase (gapA) with NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase (gapC and gdp1) when serA having no KGA reducing activity is expressed.
[0031] Figure 15 The pathway to L-serine is shown, including the steps from 3-phosphoglycerate.
[0032] Figure 16 The HMP shunt pathway employing glucose-6-phosphate dehydrogenase (zwf) and 6-phosphogluconolactonase (pg1) is shown. DETAILED DESCRIPTION
[0033] The terms "heterologous" or "recombinant" or "genetically modified" and their grammatical equivalents, as used interchangeably herein with respect to nucleotides, polypeptides, and cells, refer to entities "derived from a different species or cell." For example, a heterologous or recombinant polynucleotide gene is a gene that is not naturally present in a host cell, i.e., the gene is from a species or cell type different from the host cell. A heterologous or recombinant polypeptide is a polypeptide produced in a host cell that does not naturally contain the polypeptide, i.e., the polypeptide is from a species or cell type different from the host cell. When the terms used herein are with respect to a host cell, they refer to a host cell that contains and expresses a heterologous or recombinant polynucleotide. In some embodiments, when used with respect to, for example, a host cell, nucleic acid, or polypeptide, "recombinant" or "non-naturally occurring" refers to a material, or a material corresponding to the natural or native form of a material, that has been modified in a manner that would not otherwise exist in nature, or is identical thereto, but is produced or derived from a synthetic material and / or produced or derived by manipulation using recombinant technology. Non-limiting examples include, in particular, recombinant host cells that express genes not found in the natural (non-recombinant) form of the cell or that express natural genes that are otherwise expressed at different levels. As used herein, "heterologous" means that the polypeptide is not normally found in or produced (ie, expressed) by the host organism, but is derived from a different species.
[0034] The term "% identity" herein refers to the relationship between two amino acid sequences or between two nucleotide sequences using standard alignment software known in the art and applying the settings indicated by the software, including gaps, to achieve the maximum percentage identity / similarity / homology and, if necessary, taking into account any conservative substitutions according to NCIUB rules (hftp: / / www.chem.qmul.ac.uk / iubmb / misc / naseq.html; NC-IUB, Eur. J. Biochem. (1985)) as part of the sequence identity. Using such standard software, 5' or 3' extensions or insertions (for nucleic acids) or N' or C' extensions or insertions (for polypeptides) generally result in a decrease in identity, similarity or homology. Thus, "percent sequence identity," "% sequence identity," and "percent identity" may be used herein to refer to a comparison between an amino acid sequence and a reference amino acid sequence. For example, as used herein, "% sequence identification" is calculated from two amino acid sequences as follows: using version 9 of GAP (Global Alignment Program) from the Genetic Computing Group, the sequences are aligned using the default BLOSUIVI62 matrix (see below), with a gap open penalty of -12 (for the first null value of the gap) and a gap extension penalty of -4 (for each additional null value in the gap). After alignment, the percent identity is calculated by expressing the number of matches as a percentage of the number of amino acids in the reference amino acid sequence. The following BLOSUIVI62 matrix is used:
[0035]
[0036] A "reference sequence" or "reference amino acid sequence" refers to a defined sequence that is compared to another sequence. In the context of the present invention, the reference amino acid sequence may be, for example, the amino acid sequence shown in SEQ ID NO: 5 or 6.
[0037] "Substitution" or "substituted" refers to the modification of a polypeptide by replacing one amino acid residue with another, e.g., replacing a serine residue with a glycine or alanine residue in a polypeptide sequence is an amino acid substitution. When used with respect to a polynucleotide, "substitution" or "substituted" refers to the modification of a polynucleotide by replacing one nucleotide with another, e.g., replacing a cytosine with a thymine in a polynucleotide sequence is a nucleotide substitution.
[0038] When used with respect to polypeptides, "conservative substitution" refers to the replacement of an amino acid residue with a different residue having a similar side chain, and thus generally involves replacing an amino acid in a polypeptide with an amino acid within the same or similar class of amino acids. By way of example and not limitation, an amino acid having an aliphatic side chain can be substituted with another aliphatic amino acid, such as alanine, valine, leucine, and isoleucine; an amino acid having a hydroxyl side chain can be substituted with another amino acid having a hydroxyl side chain, such as serine and threonine; an amino acid having an aromatic side chain can be substituted with another amino acid having an aromatic side chain, such as phenylalanine, tyrosine, tryptophan, and histidine; an amino acid having a basic side chain can be substituted with another amino acid having a basic side chain, such as lysine and arginine; an amino acid having an acidic side chain can be substituted with another amino acid having an acidic side chain, such as aspartic acid or glutamic acid; and a hydrophobic or hydrophilic amino acid can be substituted with another hydrophobic or hydrophilic amino acid, respectively.
[0039] When used in reference to polypeptides, a "non-conservative substitution" refers to the replacement of an amino acid in a polypeptide with an amino acid having significantly different side chain properties. Non-conservative substitutions can use amino acids between, rather than within, the defined groups and affect (a) the structure of the peptide backbone in the region of the substitution (e.g., serine for glycine), (b) the charge or hydrophobicity, or (c) the bulk of the side chain. By way of example and not limitation, exemplary non-conservative substitutions can be substitutions of an acidic amino acid with a basic or aliphatic amino acid; substitutions of an aromatic amino acid with a small amino acid; and substitutions of a hydrophilic amino acid with a hydrophobic amino acid.
[0040] As used herein, the terms "pathway" or "biosynthetic pathway" or "metabolic pathway" refer interchangeably to one or more enzymes that act synergistically in a living cell to convert one or more substrate precursors into a chemical product. A pathway can include a single enzyme or multiple enzymes acting sequentially or in combination. A pathway that includes only one enzyme may also be referred to herein as a "biotransformation," particularly in connection with embodiments in which a host cell is exogenously supplied with a precursor or substrate to be converted by the enzyme into a desired end product. An enzyme is characterized by having catalytic activity that can change the chemical structure of a substrate(s). An enzyme can have more than one substrate and produce more than one product. An enzyme may also rely on cofactors, which can be inorganic chemical compounds or organic compounds (cofactors and / or coenzymes), which may or may not be considered part of a pathway.
[0041] As used herein, the term "in vivo" means within a living cell or organism, including, for example, an animal, a plant, or a microorganism.
[0042] As used herein, the term "in vitro" refers to outside a living cell or organism, including but not limited to, for example, in a microtiter plate, tube, flask, beaker, tank, reactor, and the like.
[0043] As used herein, the term "substrate" or "precursor" refers to any compound that can be converted into a different compound. For clarity, substrates and / or precursors include compounds produced in situ by enzymatic reactions in the cell or exogenously provided compounds, such as exogenously provided organic molecules that the host cell can metabolize into the desired compound.
[0044] The term "expression" includes any step involved in the production of a polypeptide (eg, encoded enzyme) including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[0045] The term "expression vector" refers to a single-stranded or double-stranded, linear or circular DNA molecule that contains a polynucleotide encoding a polypeptide and is operably linked to a control sequence that provides its expression. Expression vectors include expression cassettes for integrating genes into host cells and plasmids and / or chromosomes containing such genes. Vectors that can direct the expression of genes to which they are operably linked are referred to herein as expression vectors. "Vector" can also refer to a nucleic acid molecule that can transport another nucleic acid molecule connected thereto. One type of vector is a "plasmid," which refers to a circular double-stranded nucleic acid loop into which additional nucleic acid segments can be linked. Certain other vectors can facilitate the insertion of exogenous nucleic acid molecules into bacterial genomes. Such vectors are referred to herein as "transformation vectors." Typically, vectors useful in recombinant nucleic acid technology are typically in the form of plasmids. In this specification, "plasmid" and "vector" can be used interchangeably because plasmids are one of the most commonly used forms of vectors. A large number of suitable vectors are known to those skilled in the art and are commercially available.
[0046] The term "host cell" refers to any cell type that is susceptible to transformation, transfection, transduction, etc. with a nucleic acid construct or expression vector comprising a polynucleotide to be expressed in the host cell. A host cell encompasses any progeny of a parent cell, including progeny that are not identical to the parent cell due to mutations that occur during replication.
[0047] The terms "nucleic acid" or "polynucleotide" are used interchangeably herein to refer to a polymer of at least two nucleic acid monomer units or bases (e.g., adenine, cytosine, guanine, thymine) covalently linked by phosphodiester bonds, regardless of length or base modifications.
[0048] The term "polynucleotide construct" refers to a single-stranded or double-stranded polynucleotide that is isolated from a naturally occurring gene, or modified to contain a nucleic acid segment that does not occur in nature, or is synthetic, and which comprises a polynucleotide encoding a polypeptide and one or more control sequences.
[0049] The term "operably linked" refers to a configuration in which a control sequence is placed at an appropriate position relative to a coding polynucleotide such that the control sequence directs the expression of the coding polynucleotide. More generally, "operably linked" refers to a juxtaposition in which the described components are in a relationship that permits them to function in their intended manner. A control sequence that is "operably linked" to a coding sequence is linked in a manner that achieves expression of the coding sequence under conditions compatible with the control sequences. A promoter sequence is "operably linked" to a gene when the promoter sequence is sufficiently close to the transcription start site of the gene to regulate transcription of the gene.
[0050] As used herein, "promoter" refers to a DNA sequence, typically upstream (5') of the coding region of a structural gene, which controls the expression of the coding region by providing recognition and binding sites for RNA polymerase and other factors that may be required for transcription initiation. The choice of promoter will depend on the nucleic acid sequence of interest. A suitable "promoter" is typically a promoter that can support transcription initiation and cause the production of mRNA molecules in the bacteria of the present invention.
[0051] "Polypeptide" and "protein" are used interchangeably herein to refer to a polymer of at least two amino acids covalently linked by an amide bond, without regard to length or post-translational modifications (e.g., glycosylation, phosphorylation, lipidation, myristylation, ubiquitination, etc.). This definition includes both D- and L-amino acids, as well as mixtures of D- and L-amino acids.
[0052] As used herein, the term "biobased" is used to characterize a biobased product where:
[0053] a) the total carbon content of the product is at least 30%, and
[0054] b) The carbon content of the renewable raw material (biobased) is at least 20%.
[0055] The development of biobased materials is crucial if the EU is to achieve the climate targets set out in the European Green Deal, as recognized by the Circular Biobased Europe Joint Commitment (CBE Joint Commitment) established in 2021. The present disclosure provides a method for efficiently providing fatty alcohols and fatty aldehydes with a high biobased carbon content (%).
[0056] Both fossil and renewable raw materials are composed primarily of carbon (C). Carbon exists in several isotopes. 14 C is radioactive and occurs naturally in all living organisms (plants, animals, etc.) at a fixed relative concentration that is almost the same as that in the atmosphere. 14 C concentration is the same. At this concentration, 14The radioactivity level of C is 100%. Once the organism is no longer alive, this concentration and the rate of radioactivity decay, with a half-life of about 5700 years. Therefore, the radioactivity of the unknown substance 14 C levels can help determine how old the carbon contained in the material is.
[0057] "Young" carbon (0 to 10 years old) derived from renewable feedstocks such as plants or animals has a relative 14 C concentrations are almost identical relative isotopes 14 C concentration, and therefore the radioactivity of this young carbon 14 C levels are around 100%.
[0058] "Old" carbon (millions of years old) from synthetic or fossil (petrochemical) sources isotopically 14 C is heavily depleted, as the ages of such synthetic and fossil sources far exceed the isotopic 14 The half-life of C is about 5700 years. Therefore, carbon derived from synthetic or fossil sources has a relative isotopic content of about 0%. 14 C concentration, and therefore the radioactivity of this old carbon 14 C levels are approximately 0%.
[0059] In one embodiment, the term "radioactive 14 "C Level" means the total radioactivity of a given substance, product or composition as defined above 14 C level.
[0060] isotope 14 Method C can be used to determine the concentration of young (renewable) materials compared to the concentration of old (fossil) resources. The carbon content of renewable raw materials is called "biobased carbon content." The carbon content or "biobased carbon content" of renewable raw materials can be determined as follows.
[0061] When measuring biobased carbon content, the result can be reported as "% Biobased Carbon". This represents the percentage of carbon that is derived from "natural" (plant or animal by-product) sources relative to "synthetic" or "fossil" (petrochemical) sources. For reference, 100% Biobased Carbon means the material is derived entirely from plants or animal by-products, and 0% Biobased Carbon means the material does not contain any carbon from plants or animal by-products. Values in between represent a mixture of natural and fossil sources. For example: if a product's radioactive 14 The C level is 80%, which means that the product is composed of 80% renewable carbon and 20% fossil carbon (C). In other words, the product is 80% biobased. The analytical measurement value can be quoted as "percent modern carbon (pMC)". This is the amount of carbon measured in the sample. 14The percentage of C relative to a modern reference standard (NIST4990C). The % biobased carbon content is calculated by comparing the percentage of carbon dioxide in today's air to the percentage of carbon dioxide in today's air. 14 C is calculated from pMC using a small adjustment factor. 14 All internationally recognized standards for pMC assume that the plant or biomass raw material is obtained from the natural environment. pMC can be analyzed by standard test methods such as "ASTM D6866".
[0062] The terms "nucleotide sequence" and "polynucleotide" are used interchangeably herein.
[0063] As used throughout the specification and appended hereto, the terms "comprise" and "comprising" and variations such as "have," "include," "include," and "includes" should be interpreted inclusively. Where the context permits, these words are intended to convey that additional elements or integers not specifically recited may be included.
[0064] As used herein, the articles "a" and "an" refer to one or to more than one (ie, to one or at least one) of the grammatical object of the article. For example, "an element" can mean one element or more than one element.
[0065] Terms such as "preferably," "generally," "particularly," and "typically" are not used herein to limit the scope of the invention or to imply that certain features are critical, essential, or even important to the structure or function of the invention. Rather, these terms are merely intended to highlight alternative or additional features that may or may not be utilized in a particular embodiment of the invention.
[0066] As used herein, the term "cell culture" refers to a culture medium containing a plurality of host cells as described herein. The cell culture may contain a single host cell strain or may contain two or more different host cell strains. The culture medium may be any medium that can contain a recombinant host, such as a liquid culture medium (i.e., culture broth) or a semi-solid culture medium, and may contain additional components, such as a carbon source; a nitrogen source; a phosphate source; vitamins; trace elements; salts; amino acids; nucleobases; and the like.
[0067] As used herein, the term "endogenous" or "native" refers to a gene or polypeptide in a host cell that originates from the same host cell.
[0068] As used herein, the terms "substantially" or "approximately" or "about" refer to reasonable deviations around a value or parameter such that the value or parameter is not significantly changed. These deviation terms should be interpreted as including deviations from the value, wherein the deviation does not negate the meaning of the deviation. For example, with respect to a reference value, a degree term can include a range of values plus or minus 10% from the value. For example, a deviation from a value can include a specified value plus or minus a certain percentage of the value, such as plus or minus 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% from the specified value.
[0069] Where a numerical limitation or range is stated herein, the endpoints are included. Furthermore, all values and subranges within the numerical limitation or range are specifically included as if expressly written.
[0070] As used herein, the term "and / or" is intended to mean an inclusive "or." The phrase X and / or Y means either X or Y as well as both X and Y. Furthermore, the phrase X, Y, and / or Z means X, Y, and Z individually or in any combination.
[0071] As used herein, the term "isolated" with respect to a compound refers to any compound that has been placed into a form or environment different from that in which it is found in nature through human intervention. Isolated compounds include, but are not limited to, compounds of the present disclosure in which the ratio of the compound to the other components with which it is associated in nature is increased or decreased. In an important embodiment, the amount of the compound is increased relative to the other components with which the compound is associated in nature. In one embodiment, the compounds of the present disclosure can be isolated into pure or substantially pure forms. In this article, a substantially pure compound refers to the separation of the compound from other foreign or unwanted materials that exist from the time the compound is produced or that are produced during the manufacturing process. Such a substantially pure compound preparation contains less than 10% by weight, such as less than 8% by weight, such as less than 6% by weight, such as less than 5% by weight, such as less than 4% by weight, such as less than 3% by weight, such as less than 2% by weight, such as less than 1% by weight, such as less than 0.5% by weight of other foreign or unwanted substances that are typically associated with the compound when expressed naturally or recombinantly. In one embodiment, the isolated compound is at least 90% pure, such as at least 91% pure, such as at least 92% pure, such as at least 93% pure, such as at least 94% pure, such as at least 95% pure, such as at least 96% pure, such as at least 97% pure, such as at least 98% pure, such as at least 99% pure, such as at least 99.5% pure, for example, 100% pure by weight.
[0072] The term "cDNA" refers to a DNA molecule that can be prepared by reverse transcription from a mature, spliced mRNA molecule obtained from a eukaryotic or prokaryotic cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA. The initial, primary RNA transcript is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature, spliced mRNA.
[0073] As used herein, the term "GAPDH" refers to glyceraldehyde-3-phosphate dehydrogenase, which converts glyceraldehyde 3-phosphate to 1,3-bisphosphoglycerate; + or NADP + GapA is co-converted into NADH or NADPH. + An example of GAPDH producing 1,3-diphosphoglycerate under co-conversion to NADH, while GapC produces 1,3-diphosphoglycerate under co-conversion to NADH. + Example of co-conversion of GAPDH to produce 1,3-diphosphoglycerate under NADPH.
[0074] As used herein, the term "Nox" refers to the conversion of NADH to NAD + NADH oxidase.
[0075] As used herein, the term "PGDH" or "3-PGDH" or "PHGDH" refers to 3-phosphoglycerate dehydrogenase, which catalyzes the conversion of 3-phosphoglycerate to 3-phosphohydroxypyruvate while converting NAD + Reduced to NADH. An example of a PGDH is serA in the serine pathway.
[0076] The term "GDH" as used herein refers to glutamate dehydrogenase, which catalyzes the conversion of α-ketoglutarate to glutamate.
[0077] As used herein in the context of polynucleotides and genes, the term "deletion" refers to the manipulation of a gene so that it is no longer expressed in a host cell. When used with reference to a polypeptide, "deletion" or "deleted" refers to the modification of a polypeptide by removing one or more amino acids in the reference polypeptide. Deletion can include the removal of one or more amino acids, two or more amino acids, five or more amino acids, ten or more amino acids, fifteen or more amino acids, or twenty or more amino acids, up to 10% of the total number of amino acids, or up to 20% of the total number of amino acids that constitute the polypeptide while retaining enzymatic activity and / or retaining improved properties of the engineered enzyme. Deletion can be directed to internal and / or terminal portions of a polypeptide, and in various embodiments, deletion can comprise a continuous segment or can be discontinuous.
[0078] The term "disruption" as used herein refers to the manipulation of a gene, or any machinery involved in gene expression, so that it is no longer expressed in the host cell.
[0079] As used herein, the term "attenuation" refers to the manipulation of a gene or any machinery involved in the expression of a gene such that the expression of the gene is reduced compared to expression without the manipulation.
[0080] When used with reference to a polypeptide, "insertion" or "inserted" refers to the modification of a polypeptide by adding one or more amino acids to a reference polypeptide. Insertion can include the addition of 1 or more amino acids, 2 or more amino acids, 5 or more amino acids, 10 or more amino acids, 15 or more amino acids, or 20 or more amino acids. The insertion can be internal to the polypeptide, or to the carboxyl or amino terminus. The insertion can be a continuous stretch of amino acids or separated by one or more amino acids in the reference polypeptide. As used herein, the phrase "a bacterium modified to have increased expression of a polypeptide having D-3-phosphoglycerate dehydrogenase activity (serA) and decreased HGA production" means that the bacterium has been modified in the following manner: a) the modified bacterium has a higher level of expression of D-3-phosphoglycerate dehydrogenase (serA) compared to otherwise identical bacteria that do not carry the modification, and b) the modified bacterium has decreased HGA production compared to otherwise identical bacteria that do not carry the modification. It should be understood that "modification" can encompass one or more separate genetic modifications to achieve the effect.
[0081] The presence or absence of a gene on the chromosome of a bacterium can be detected by known methods, including PCR, Southern blotting, etc. In addition, the level of gene expression can be estimated by measuring the amount of mRNA transcribed from the gene using various known methods, including Northern blotting, quantitative RT-PCR, etc. The amount of protein encoded by the gene can be measured by known methods, including immunoblotting (Western blot analysis) after SDS-PAGE, etc.
[0082] As used herein, "genetically engineered bacteria" means bacteria into which genetic modifications have been introduced, such as the introduction of new genes, extra copies of genes, modified genes, changes in sequences that regulate gene expression, and the like.
[0083] As used herein, "L-serine derivatives" refers to compounds produced by the reaction of L-serine at an amino group, a carboxyl group, or a hydroxyl group, such as an amino acid, or compounds produced by replacing any hydrogen of L-serine with a heteroatom. Non-limiting examples of "L-serine derivatives" include L-cysteine, L-methionine, L-glycine, O-acetylserine, L-tryptophan, thiamine, ethanolamine, and ethylene glycol. Other examples of "L-serine derivatives" are described by the Chemical Entities of Biological Interest (CHEBI) [https: / / www.ebi.ac.uk / chebi / init.do], for example, under ChEBI ID CHEBI:84135.
[0084] All methods described herein can be performed in any suitable order of steps, unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples or exemplary language (e.g., "such as") provided herein is intended only to better illustrate the present invention and does not limit the scope of the invention as otherwise claimed. Any language in the specification should not be construed as indicating any unclaimed element that is essential to the practice of the present invention.
[0085] All percentages, ratios and proportions herein are by weight unless otherwise indicated. Unless specifically indicated to the contrary, the weight percent (weight %) of a component is based on the total weight of the composition in which the component is contained (e.g., based on the total weight of the reaction mixture).
[0086] Unless specifically defined herein, all technical and scientific terms used have the same meanings as commonly understood by one of ordinary skill in the fields of biochemistry, genetics, and microbiology.
[0087] All methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, wherein suitable methods and materials are described herein. All publications, patent applications, patents and other references mentioned herein are incorporated herein by reference in their entirety. In the event of a conflict, the present specification, including definitions, will prevail. Furthermore, unless otherwise indicated, the materials, methods and examples are illustrative only and are not intended to be limiting.
[0088] Unless otherwise indicated, the practice of the present invention will employ conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, and recombinant DNA, which are available to those skilled in the art and are fully explained in the literature. See, for example, Current Protocols in Molecular Biology (Frederick M. AUSUBEL, 2000, Wiley and son Inc, Library of Congress, USA); Molecular Cloning: ALaboratory Manual, Third Edition, (Sambrook et al, 2001, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press); Oligonucleotide Synthesis (MJ Gaited., 1984); Mullis et al. al.USPat.No.4,683,195; Nucleic Acid Hybridization (BD Harries&S.J.Higgins eds.1984); Transcription And Translation (BDHames&S.J.Higgins eds.1984); Culture OfAnimal Cells (RIFreshney, Alan R.Liss, Inc., 1987); Immobilized Cells And Enzymes(IRL Press, 1986); B.Perbal, A Practical Guide To Molecular Cloning (1984); the series, Methods In ENZYMOLOGY (J.Abelsonand M.Simon, eds.-in-chief, Academic Press, Inc., New York), specifically, Vols.154and 155 (Wu et al.eds.) and Vol.185, "Gene Expression Technology"(D.Goeddel,ed.); Gene Transfer Vectors For Mammalian Cells(JHMiller andM.P.Calos eds., 1987, Cold Spring Harbor Laboratory); Immunochemical Methods InCell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (DMWeir and CCBlackwell, eds., 1986); Harbor, NY, 1986). .
[0089] Genetically engineered host cells
[0090] As described above in the first aspect, the genetically engineered host cells described herein produce metabolites from 3-phosphoglycerate via a metabolic pathway comprising one or more genetic modifications that prevent, reduce, or mitigate the negative effects of the intracellular accumulation of NADH and / or hydroxyglutarate (HGA) produced by one or more pathway enzymes. In a preferred embodiment, the metabolite is L-serine or a derivative thereof. The pathway for L-serine is shown in Figure 15 middle.
[0091] In some embodiments, the host cell is genetically engineered to comprise one or more, optionally two or more, optionally three or more, optionally four or more, optionally five or more, optionally seven genetic modifications selected from:
[0092] 1. Expression of a first heterologous NADPH-generating enzyme that converts glyceraldehyde 3-phosphate to 1,3-diphosphoglycerate or a downstream precursor in the metabolite pathway;
[0093] II. Converting NADH to NAD + Expression of heterologous enzymes;
[0094] III. Expression of a heterologous enzyme in the metabolite pathway having reduced or eliminated NADH-consuming side activities compared to the corresponding pathway enzyme native to the host cell;
[0095] IV. Expression of heterologous enzymes that convert byproducts of enzymes in the metabolite pathway into substrates for metabolite pathway enzymes that consume NADH or NADPH;
[0096] V. Overexpression of native enzymes that convert byproducts of enzymes in the metabolite pathway into substrates for NADH- or NADPH-consuming metabolite pathway enzymes;
[0097] VI. expression of a second heterologous NADPH-generating enzyme that is not included in the metabolite pathway; and / or
[0098] VII. Overexpression of a native NADPH-generating enzyme that is not involved in the metabolite pathway.
[0099] The present inventors have found that inhibiting the accumulation of NADH in the cell effectively improves the downstream pathway for producing metabolites from 3-phosphoglycerate, particularly L-serine and / or its derivatives, and therefore in another embodiment, the genetic modification of the host cell includes the expression of a first heterologous NADPH-generating enzyme that converts glyceraldehyde 3-phosphate into 1,3-bisphosphoglycerate or a downstream precursor in the metabolite pathway.
[0100] The present inventors have also found that combining two or more of the above modifications I) to VII) is particularly advantageous and synergistic for the host cell to produce metabolites from 3-phosphoglycerate, and in another embodiment, the genetic modification of the host cell comprises:
[0101] a) expression of the first heterologous NADPH-generating enzyme to convert glyceraldehyde 3-phosphate to 1,3-bisphosphoglycerate or a downstream precursor in the metabolite pathway; and
[0102] b) expression of the heterologous metabolite pathway enzyme with reduced or eliminated NADH-consuming side activities compared to the corresponding metabolite pathway enzyme native to the host cell.
[0103] The present inventors have also found that combining three or more of the above modifications I) to VII) is particularly advantageous and synergistic for the host cell to produce metabolites from 3-phosphoglycerate, and in another embodiment, the genetic modification of the host cell comprises:
[0104] a) expression of the first heterologous NADPH-generating enzyme to convert glyceraldehyde 3-phosphate to 1,3-bisphosphoglycerate or a downstream precursor in the metabolite pathway;
[0105] b) expression of the heterologous metabolite pathway enzyme with reduced or eliminated NADH-consuming side activity compared to the corresponding metabolite pathway enzyme native to the host cell; and
[0106] c) Convert NADH into NAD + Expression of heterologous enzymes.
[0107] The present inventors have also found that combining four or more of the above modifications I) to VII) is particularly advantageous and synergistic for the host cell to produce metabolites from 3-phosphoglycerate, and in another embodiment, the genetic modification of the host cell comprises:
[0108] a) expression of the first heterologous NADPH-generating enzyme to convert glyceraldehyde 3-phosphate to 1,3-bisphosphoglycerate or a downstream precursor in the metabolite pathway;
[0109] b) expression of the heterologous metabolite pathway enzyme with reduced or eliminated NADH-consuming side activity compared to the corresponding metabolite pathway enzyme native to the host cell;
[0110] c) Convert NADH into NAD + expression of heterologous enzymes; and
[0111] d) Expression of heterologous enzymes and / or overexpression of native enzymes to convert byproducts of enzymes in the metabolite pathway into substrates for the metabolite pathway enzymes that consume NADH or NADPH.
[0112] The present inventors have also found that combining the other five modifications in I) to VII) above is particularly advantageous and synergistic for the host cell to produce metabolites from 3-phosphoglycerate, and in another embodiment, the genetic modification of the host cell includes:
[0113] a) expression of the first heterologous NADPH-generating enzyme to convert glyceraldehyde 3-phosphate to 1,3-bisphosphoglycerate or a downstream precursor in a metabolite pathway;
[0114] b) expression of the heterologous metabolite pathway enzyme with reduced or eliminated NADH-consuming side activity compared to the corresponding metabolite pathway enzyme native to the host cell;
[0115] c) Convert NADH into NAD + Expression of heterologous enzymes;
[0116] d) expression of heterologous enzymes and / or overexpression of native enzymes that convert byproducts of enzymes in a metabolite pathway into substrates for NADH- or NADPH-consuming metabolite pathway enzymes; and
[0117] e) Expression of a second heterologous NADPH generating enzyme and / or overexpression of a native NADPH generating enzyme, neither of which is involved in the metabolite pathway.
[0118] In another embodiment, the first heterologous NADPH generating enzyme, the heterologous enzyme has reduced or eliminated NADH-consuming side activity, the heterologous enzyme converts a byproduct into a pathway substrate, and / or the second heterologous NADPH generating enzyme partially or completely replaces an enzyme native to the host cell. Such native enzymes may or may not be part of a metabolite pathway.
[0119] In some embodiments, the NADPH pool of the genetically engineered bacteria is increased by recombinant expression of an NADPH-dependent polypeptide having glyceraldehyde-3-phosphate dehydrogenase activity, with or without additional ATP generation.
[0120] In another embodiment, the first heterologous NADPH-generating enzyme that converts glyceraldehyde 3-phosphate to 1,3-bisphosphoglycerate or a downstream precursor in the metabolite pathway can be bisphosphoglycerate synthase or glyceraldehyde-3-phosphate dehydrogenase (GAPDH), both of which convert glyceraldehyde 3-phosphate to 1,3-bisphosphoglycerate; in the presence of NADP + SEQ ID NOs: 23 to 46 disclose some exemplary glyceraldehyde-3-phosphate dehydrogenases, and in some embodiments, the GAPDH enzyme comprises a polypeptide having at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, for example, 100% identity to the GAPDH contained in any one of SEQ ID NOs: 23 to 46. In particular, the GAPDHs of SEQ ID NOs: 38 to 46 are useful. In particular, GAPDH is GapC or a NADP-dependent variant thereof, which comprises a polypeptide having at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, for example 100% identity with the GAPDH comprised in SEQ ID NO: 43.
[0121] In some embodiments, the NADH pool of the genetically engineered bacteria is reduced by recombinant expression of a heterologous NADH oxidase, and thus, in further embodiments, the heterologous enzyme that converts NADH to NAD+ is a NADH oxidase (Nox). SEQ ID NOs: 49 to 56 disclose some exemplary NADH oxidases, and in further embodiments, Nox comprises a polypeptide having at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, for example, 100% identity to Nox comprised in any one of SEQ ID NOs: 49 to 56.
[0122] In other embodiments, the metabolite pathway enzyme with a reduced or eliminated NADH-consuming side activity is 3-phosphoglycerate dehydrogenase (PGDH), also known as D-3-phosphoglycerate dehydrogenase, and the side activity is the conversion of α-ketoglutarate (α-KGA) to α-hydroxyglutarate (α-HGA). D-3-phosphoglycerate dehydrogenase (PGDH) converts D-3-phosphoglycerate (PGA) to phosphohydroxypyruvate (PHP) in the first step of L-serine biosynthesis. The reaction is reversible, and some PGDHs can use α-ketoglutarate (αKG) instead of PHP to reversely generate α-hydroxyglutarate.
[0123] Preferably, the PGDH is heterologous, and more preferably, the heterologous PGDH is overexpressed compared to a native PGDH having the side activity of converting α-ketoglutarate (α-KGA) into α-hydroxyglutarate. The overexpression of the heterologous PGDH compared to the native PGDH can be 10% to 10.000%, such as 50% to 5000%, such as 100% to 1000%. PGDH or D-3-phosphoglycerate dehydrogenase (SerA) has been classified into three types based on the presence of different protein domains 1, namely type 1, type 2 and type 3. Some D-3-phosphoglycerate dehydrogenases do not have KGA reducing activity. However, such D-3-phosphoglycerate dehydrogenases do not necessarily belong to one type or category of enzymes. For example, SerA from Rattus norvegicus, Mycobacterium tuberculosis, Corynebacterium glutamicum and Bacillus subtilis do not appear to have HGA accumulation. 4 , while human SerA has a tendency to accumulate HGA, although it belongs to the same class 14. Three enzymes have been found that are able to utilize αKG as a substrate: PDGHs from Escherichia coli, Pseudomonas stutzeri and Saccharomyces cerevisiae, all of which are type II PGDHs. Hypothesized PGDHs that are unable to use αKG as a substrate are type I and type III PGDHs. The inventors have found that for each of the three types of PGDHs, several regions facing the active site contain conserved motifs in both type I and type II PGDHs. One such motif is the G / A motif in type I and type II PGDHs, respectively. R AGV and G C FCI motif. An obvious and highly conserved difference between these two motifs is the type of residue at the second position. In type I PGDH, this is an arginine residue, while in type II enzymes, it is most often a cysteine residue. For the structures of Mycobacterium tuberculosis and Escherichia coli PGDH that bind to PHP and αKG, respectively, it has been found that both arginine and cysteine residues face the active site, indicating that these residues are involved in controlling substrate specificity and, therefore, in controlling the ability to use αKG as a substrate. In addition, it has been found that using site-directed mutagenesis to replace the arginyl side chain in Mycobacterium tuberculosis PGDH with other selected amino acid side chains such as alanine and leucine, removing the cationic group of Arg 72 in Mycobacterium tuberculosis PGDH changes the specificity from not accepting αKG as a substrate to accepting αKG as a substrate. However, replacing the arginyl side chain with another cationic moiety (lysyl side chain) does not result in altered enzyme specificity. These results clearly show that it is the presence of a cationic side chain at the second position of the conserved motif that prevents the enzyme from using αKG. Therefore, in a preferred embodiment, the heterologous PGDH comprises a conserved region towards the active site comprising the motif G / A X AGV, where the underlined residues X is a cationic residue, preferably at the host cell intracellular pH, in a position corresponding to position 129 of PGDH from Mycobacterium tuberculosis (SEQ ID NO: 10). Useful PDGHs are particularly those where the underlined X Those selected from arginine, leucine or histidine, more particularly arginine. Additionally or alternatively, useful heterologous PGDHs are those comprising a conserved region towards the active site which does not comprise the motif GCFCI, wherein the underlined cysteine is located at position 129 corresponding to PGDH from Mycobacterium tuberculosis (SEQ ID NO: 10).
[0124] In another embodiment, the heterologous PGDH is a mutant PGDH, optionally native to the host cell, modified to reduce or eliminate the NADH-consuming side activity compared to the unmodified PGDH, for example by replacing the cysteine at position 129 corresponding to the PGDH from Mycobacterium tuberculosis (SEQ ID NO: 10) with a cationic residue such as Arg, Leu or His, in particular Arg, optionally in the motif G C in FCI.
[0125] In some embodiments, the heterologous PGDH can be a Type I or Type III PGDH, optionally a microbial Type I or Type III PGDH, and it can be a SerA enzyme.
[0126] SEQ ID NOs: 1-22 disclose some exemplary D-3-phosphoglycerate dehydrogenases, and particularly useful PGDH enzymes are those comprising a polypeptide having at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, for example 100% identity to the PGDH contained in any one of SEQ ID NOs: 1-22. More particularly, the PGDH does not produce HGA or is insensitive to L-serine feedback and comprises a polypeptide having at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identity to the PGDH contained in any one of SEQ ID NOs: 6 to 22. In other embodiments, the PGDH does not produce HGA and comprises a polypeptide having at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identity to the PGDH contained in any one of SEQ ID NOs: 6 to 15. In other embodiments, the PGDH is a non-HGA-producing C. Glutamic acid PGDH or a derivative thereof, comprising a polypeptide having at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identity with the PGDH contained in SEQ ID NO: 14 or 19 to 21, in particular SEQ ID NO: 14.
[0127] In another embodiment, the heterologous PGDH described above is included, particularly SerA (SEQ ID NO: 14 or 19 to 21) from Corynebacterium glutamicum and heterologous GAPDH described above, particularly GapC (SEQ ID NO: 43). As mentioned above, the present invention is particularly based on the following discovery: the production of L-serine can be enhanced by, for example, increasing the expression of SerA and reducing the production of hydroxyglutaric acid (HGA).
[0128] Reduced production of HGA can be achieved by modifications that increase the cytosolic NADPH pool and / or decrease the cytosolic NADH pool, compared to an otherwise identical bacterium not carrying the modifications.
[0129] Reduced production of HGA can also be achieved by modifications that result in expression of a polypeptide having D-3-phosphoglycerate dehydrogenase activity with reduced or no HGA production.
[0130] Thus, the present invention provides genetically engineered bacteria, particularly bacteria having the ability to produce L-serine, wherein the bacteria have been modified to have increased expression of a polypeptide having D-3-phosphoglycerate dehydrogenase activity (SerA) and reduced HGA production compared to an otherwise identical bacterium not carrying the modification.
[0131] In embodiments of the enzyme that converts a byproduct of an enzyme in a metabolic pathway into a substrate for the metabolic pathway enzyme, the metabolic pathway enzyme is preferably glutamate dehydrogenase (GDH), the byproduct is preferably α-ketoglutarate, and the substrate is preferably glutamate. In a more specific embodiment, the GDH comprises a polypeptide that is at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identical to the GDH comprised in any one of SEQ ID NOs: 57 to 66.
[0132] In embodiments where the host cell expresses a second heterologous NADPH-generating enzyme and / or overexpresses a native NADPH-generating enzyme, neither of which is included in a metabolite pathway, the second heterologous or native NADPH-generating enzyme is preferably a glucose-6-phosphate dehydrogenase and / or a 6-phosphogluconolactonase, respectively. In a more specific embodiment, the glucose-6-phosphate dehydrogenase comprises a polypeptide having at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identity to the glucose-6-phosphate dehydrogenase contained in SEQ ID NO: 47. Such glucose-6-phosphate dehydrogenase is also referred to as "zwf". In a more specific embodiment, the 6-phosphogluconolactonase comprises a polypeptide having at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identity to the 6-phosphogluconolactonase contained in SEQ ID NO: 48. This 6-phosphogluconolactonase is also referred to as "pgl".
[0133] In another embodiment, the host cell expresses one or more heterologous or native metabolite pathway enzymes selected from:
[0134] a) phosphoserine aminotransferase (PSAT) that converts 3-phosphohydroxypyruvate to phosphoserine; and
[0135] b) Phosphoserine phosphatase (PSPH) that converts phosphoserine to L-serine.
[0136] The PSAT can be a SerC enzyme, and in some embodiments comprises a polypeptide having at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identity to the SerC comprised in SEQ ID NO:117.
[0137] The PSPH may be SerB, and in some embodiments comprises a polypeptide having at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identity to the SerB comprised in SEQ ID NO: 118.
[0138] As described herein, the heterologous enzyme expressed by the host cell can be: (i) an enzyme from a species different from the host cell; (ii) a mutant enzyme from a species different from the host cell; and / or (iii) a mutant enzyme native to the host cell. In a further embodiment, the host cell further comprises at least one transporter molecule that promotes the transport of a metabolite or any of its precursors. In a further embodiment, one or more natural or endogenous genes of the host cell are weakened, destroyed and / or deleted, such as the natural gene encoding NADH-dependent GAPDH or the PHDH that produces α-HGA. In other embodiments, the host cell also comprises at least two copies of one or more polynucleotides encoding one or more metabolite pathway enzymes. In a further embodiment, the host cell is further genetically modified to provide an increased amount of substrate for one or more metabolite pathway enzymes. In other embodiments, the host cell is further genetically modified to show increased tolerance to one or more precursors, substrates, intermediates or product molecules from a metabolite pathway.
[0139] In the further embodiment of the host cell of any one of the preceding claims, wherein the host cell is a prokaryotic cell, optionally a bacterium. The prokaryotic cell is Pseudomonas, optionally γ-Proteobacteria, optionally Enterobacteriaceae, optionally Escherichia, optionally Escherichia coli species. In some embodiments, the genetically engineered bacterium belongs to Escherichia. In some embodiments, the genetically engineered bacterium belongs to Escherichia. In some embodiments, the genetically engineered bacterium is Escherichia coli. Additionally or alternatively, the prokaryotic cell is Actinomycetes, optionally Actinomycetes, optionally Corynebacterium, optionally Corynebacterium, optionally Corynebacterium glutamicum species. In some embodiments, the genetically engineered bacterium is Corynebacterium glutamicum.
[0140] In an embodiment, the genetically engineered bacteria have been modified for reduced hydroxyglutarate production by increasing the cytoplasmic NADPH pool and / or decreasing the cytoplasmic NADH pool compared to an otherwise identical bacterium not carrying the modification. In another embodiment, the genetically engineered bacteria have been modified for reduced hydroxyglutarate production by expressing a polypeptide having D-3-phosphoglycerate dehydrogenase activity and having reduced hydroxyglutarate producing activity or having no hydroxyglutarate producing activity.
[0141] The present disclosure describes cell cultures in a separate aspect, comprising host cells and growth medium as described herein, and methods for producing metabolites from 3-phosphoglycerate by culturing cell cultures under conditions that allow host cells to produce metabolites; and optionally recovering and / or isolating metabolites. Suitable growth media for prokaryotic cells are well known in the art. Cell cultures can be cultured in a nutrient medium suitable for producing metabolites and / or their precursors and / or proliferating cell counts using methods known in the art. For example, the culture can be cultured in a laboratory or industrial fermentor in a suitable medium and under conditions that allow host cells to grow and / or reproduce, optionally recover and / or separate, by shake flask culture or small-scale or large-scale fermentation (including continuous, batch, fed-batch or solid-state fermentation).
[0142] Cultivation can be carried out in a suitable nutrient medium comprising a carbon source and a nitrogen source and an inorganic salt using procedures known in the art. Suitable medium can be obtained from commercial suppliers or can be prepared according to disclosed formulas (for example, from the catalogue of the American Type Culture Collection). The selection of suitable medium can be based on the selection of host cells and / or based on the regulation requirements to host cells. Such medium is available in the art. If desired, medium can contain other components that are more conducive to host cells than other potential contamination microorganisms. Therefore, in one embodiment, suitable nutrient medium comprises a carbon source (for example glucose, maltose, molasses, starch, cellulose, xylan, pectin, lignocellulosic biomass hydrolysate, etc.), a nitrogen source (for example ammonium sulfate, ammonium nitrate, ammonium chloride, etc.), an organic nitrogen source (for example yeast extract, malt extract, peptone, etc.) and an inorganic nutrient source (for example phosphate, magnesium, potassium, zinc, iron, etc.). The cultivation of host cells can be carried out in the time of approximately 0.5 to approximately 30 days. The culture process can be a batch process, a continuous process or a fed-batch process, suitably carried out at a temperature in the range of 0-100°C or 10-80°C, for example, about 20°C to about 50°C and / or at a pH, for example, about 2 to about 10. Preferred fermentation conditions for prokaryotic host cells are a temperature in the range of about 25°C to about 55°C and a pH of about 3 to about 9. Suitable conditions are generally selected based on the choice of host cell. Therefore, in one embodiment, the method of the present disclosure further comprises one or more elements selected from the following:
[0143] a) cultivating a cell culture in a nutrient medium;
[0144] b) cultivating cell cultures under aerobic or anaerobic conditions;
[0145] c) cultivating the cell culture under agitation;
[0146] d) cultivating the cell culture at a temperature of 25 to 50° C.;
[0147] e) cultivating the cell culture at a pH of 3-9; and
[0148] f) incubating the cell culture for a period ranging from 10 hours to 30 days.
[0149] The cell cultures of the present disclosure can be recovered and / or isolated using methods known in the art. For example, metabolites can be recovered from the nutrient medium by conventional methods, including but not limited to centrifugation, filtration, spray drying, or lyophilization. In a specific embodiment, the method includes a recovery and / or isolation step, which includes separating the liquid phase of the cells or cell culture from the solid phase of the cells or cell culture to obtain a supernatant containing the metabolites and / or subjecting the supernatant to one or more steps selected from the following:
[0150] a) disrupting cells of a cell culture to release intracellular metabolites into the supernatant;
[0151] b) separating the supernatant from the solid phase of the cell culture, for example by filtration or gravity separation;
[0152] c) contacting the supernatant with one or more adsorption resins to obtain at least a portion of the produced metabolites;
[0153] d) contacting the supernatant with one or more ion exchange or reverse phase chromatography columns to obtain at least a portion of the metabolites;
[0154] e) extracting metabolites; and / or
[0155] f) precipitating the metabolite by crystallization or evaporation of the solvent of the liquid phase; and optionally isolating the metabolite by filtration or gravity separation;
[0156] The metabolites are thereby recovered and / or isolated.
[0157] In one embodiment, the method further comprises supplying the cell culture with one or more precursors or substrates in the metabolite pathway.
[0158] In another embodiment, the method includes one or more in vitro steps in the process of producing the metabolite. In particular, where the metabolite is not the desired end product, further steps of chemically or biologically / enzymatically modifying the metabolite may be added to the methods described herein.
[0159] The method may further comprise recovering the metabolite and mixing it with one or more carriers, agents, additives, adjuvants and / or excipients to produce a biopesticide composition.
[0160] Method of the present invention
[0161] In a particular embodiment, the present invention also provides a method for producing L-serine or an L-serine derivative using a genetically engineered bacterium according to the present invention. In particular, the present invention provides a method for producing L-serine or an L-serine derivative, comprising culturing a genetically engineered bacterium as described in detail herein in a culture medium. According to certain embodiments, the present invention provides a method for producing L-serine. In particular, the present invention provides a method for producing L-serine, comprising culturing a genetically engineered bacterium as described in detail herein in a culture medium. The method may further comprise isolating the L-serine from the culture medium. According to certain embodiments, the present invention provides a method for producing an L-serine derivative. In particular, the present invention provides a method for producing an L-serine derivative, comprising culturing a genetically engineered bacterium as described in detail herein in a culture medium. The L-serine derivative may be selected from L-cysteine, L-methionine, L-glycine, O-acetylserine, L-tryptophan, thiamine, ethanolamine, and ethylene glycol. The method may further comprise isolating the L-serine derivative from the culture medium. According to certain embodiments, the present invention provides a method for producing L-cysteine. In particular, the present invention provides methods for producing L-cysteine, comprising culturing a genetically engineered bacterium as described in detail herein in a culture medium. The method may further comprise isolating the L-cysteine from the culture medium. According to certain embodiments, the present invention provides methods for producing L-methionine. In particular, the present invention provides methods for producing L-methionine; the method comprises culturing a genetically engineered bacterium as described in detail herein in a culture medium. The method may further comprise isolating the L-methionine from the culture medium. According to certain embodiments, the present invention provides methods for producing L-glycine. In particular, the present invention provides methods for producing L-glycine; the method comprises culturing a genetically engineered bacterium as described in detail herein in a culture medium. The method may further comprise isolating the L-glycine from the culture medium. According to certain embodiments, the present invention provides methods for producing O-acetylserine. In particular, the present invention provides methods for producing O-acetylserine, the method comprises culturing a genetically engineered bacterium as described in detail herein in a culture medium. The method may further comprise isolating the O-acetylserine from the culture medium. According to certain embodiments, the present invention provides methods for producing L-tryptophan. In particular, the present invention provides a method for producing L-tryptophan; the method comprises culturing a genetically engineered bacterium as described in detail herein in a culture medium. The method may further comprise isolating the L-tryptophan from the culture medium.
[0162] According to certain embodiments, the present invention provides a method for producing L-thiamine. In particular, the present invention provides a method for producing L-thiamine, comprising culturing a genetically engineered bacterium as described in detail herein in a culture medium. The method may further comprise isolating the thiamine from the culture medium. According to certain embodiments, the present invention provides a method for producing ethanolamine. In particular, the present invention provides a method for producing ethanolamine; the method comprises culturing a genetically engineered bacterium as described in detail herein in a culture medium. The method may further comprise isolating the ethanolamine from the culture medium. According to certain embodiments, the present invention provides a method for producing ethylene glycol. In particular, the present invention provides a method for preparing ethylene glycol; the method comprises culturing a genetically engineered bacterium as described in detail herein in a culture medium. The method may further comprise isolating the ethylene glycol from the culture medium. The culture medium used can be any conventional culture medium suitable for culturing the bacterial cells in question and can be composed according to principles established in the art. The culture medium will generally contain all nutrients necessary for the growth and survival of the respective bacteria, such as carbon and nitrogen sources and other inorganic salts. Suitable substratum, for example minimal substratum or composite substratum, can be obtained from commercial suppliers, or can be prepared according to disclosed receipt, for example American Type Culture Collection (ATCC) bacterial strain catalogue. The non-restrictive standard substratum well known to the technical staff comprises LuriaBertani (LB) broth, Sabouraud dextrose (SD) broth, MS broth, yeast peptone glucose, BMMY, GMMY or yeast malt extract (YM) broth, which all can be commercially available. The limiting examples of suitable substratum for cultivating bacterial cells such as Escherichia coli cells include minimal medium and rich substratum such as Luria broth (LB), M9 substratum, M17 substratum, SA substratum, MOPS substratum, Terrific broth, YT etc. The carbon source can be any suitable carbon substrate known in the art, particularly any carbon substrate for cultivating bacteria and / or fermentation. The limiting examples of suitable fermentable carbon substrates are C5 sugars (such as arabinose or xylose), C6 sugars (such as glucose), acetate, glycerol, vegetable oil, sucrose, yeast extract, peptone, casamino acids or its mixture. The carbon source of particular interest is C6 sugar, for example glucose. As nitrogen sources, various ammonium salts such as ammonia and ammonium sulfate, other nitrogen compounds such as amines, natural nitrogen sources such as peptone, soy hydrolyzate and digested fermentative microorganisms can be used. As minerals, potassium monophosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, calcium chloride etc. can be used. Cultivation can preferably be carried out under aerobic conditions, for example by shaking culture, and by stirring culture with ventilation, at a temperature of about 20 to about 40 ℃, for example, about 30 to 38 ℃, preferably about 37 ℃. The pH of the culture is generally about 5 to about 9, for example, about 6.5 to 7.5. The pH of the culture can be adjusted with ammonia, calcium carbonate, various acids, various alkalis and buffers.Typically, 1 to 5 days of cultivation results in accumulation of L-serine in the culture medium. After cultivation, solids, such as cells, can be removed from the culture medium by centrifugation or membrane filtration. L-serine or L-serine derivatives can be collected by conventional methods for isolating and purifying compounds from media. Known purification methods include, but are not limited to, centrifugation or filtration, precipitation, ion exchange, chromatography, such as ion exchange chromatography or gel filtration chromatography, and crystallization. Therefore, the present invention provides L-serine or L-serine derivatives obtainable by the methods described in detail herein.
[0163] On the other hand, a kind of fermentation composition is provided, it comprises the metabolites of cell culture as described herein and the metabolites from 3-phosphoglycerate, wherein at least 20 weight % of carbon is biobased.In certain embodiments, composition comprises at least 50% biobased carbon, such as at least 55%, such as at least 60%, such as at least 65%, such as at least 70%, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 99%, such as at least 100%.In other embodiments, composition comprises at least 20% biobased carbon, such as at least 30% biobased carbon, such as at least 40% biobased carbon, such as at least 50% biobased carbon, such as at least 60% biobased carbon, such as at least 70% biobased carbon, such as at least 75% biobased carbon, such as at least 80% biobased carbon, such as at least 85% biobased carbon, such as at least 90% biobased carbon, such as at least 95% biobased carbon, for example, 100% biobased carbon. In other embodiments, the composition comprises 20% to 100% bio-based carbon, such as 30% to 100% bio-based carbon, such as 40% to 100% bio-based carbon, such as 50% to 100% bio-based carbon, such as 60% to 100% bio-based carbon, such as 70% to 100% bio-based carbon, such as 75% to 100% bio-based carbon, such as 80% to 100% bio-based carbon, such as 85% to 100% bio-based carbon, such as 90% to 100% bio-based carbon, such as 95% to 100% bio-based carbon, such as 100% bio-based carbon. In other embodiments, the composition comprises no more than 50% fossil-based carbon, such as no more than 45%, such as no more than 40%, such as no more than 35%, such as no more than 30%, such as no more than 25%, such as no more than 20%, such as no more than 15%, such as no more than 10%, such as no more than 5%, such as no more than 1% fossil-based carbon. In other embodiments, the composition comprises 90% bio-based carbon, 91% bio-based carbon, 92% bio-based carbon, 93% bio-based carbon, 94% bio-based carbon, 95% bio-based carbon, 96% bio-based carbon, 97% bio-based carbon, 98% bio-based carbon, 99% bio-based carbon, or 100% bio-based carbon, for example, 94% bio-based carbon. The fermentation composition may also comprise one or more other compounds or metabolites from the cell culture. Such compounds and / or metabolites from the cell culture include precursors of metabolites and compounds selected from trace metals, vitamins, salts, yeast nitrogen base, carbon sources, YNB, and / or amino acids from the fermentation. In particular, the composition comprises a metabolite concentration of at least 1 mg / kg of composition, such as at least 5 mg / kg, such as at least 10 mg / kg, such as at least 20 mg / kg, such as at least 50 mg / kg, such as at least 100 mg / kg, such as at least 500 mg / kg, such as at least 1.000 mg / kg, such as at least 5.000 mg / kg, such as at least 10.000 mg / kg, such as at least 50.000 mg / kg.In other embodiments, the composition is substantially free of α-HGA.The composition may further comprise one or more carriers, agents, additives and / or excipients.
[0164] Having generally described this invention, further understanding can be obtained by reference to certain specific examples which are provided herein for purposes of illustration only and are not intended to be limiting unless otherwise specified.
[0165] Example
[0166] Materials and methods
[0167] DE3 Integration
[0168] To use the pET vector as an expression system, a DE3 cassette containing T7 polymerase was integrated into the genome using the DE3 lysogenization kit (Millipore, Damstadt Germany).
[0169] Shake flask culture medium and culture
[0170] Serine production was examined in M9 minimal medium. Glucose M9 minimal medium consists of 2 to 5 g / L glucose, 2 mM glycine, 0.1 mM CaCl2, 2.0 mM MgSO4, 1× trace element solution, and 1× M9 salts. 1000× trace element stock solution consists of 27 g / L FeCl3*6H2O, 2 g / L ZnCl2*4H2O, 2 g / L CoCl2*6H2O, 2 g / L NaMoO4*2H2O, 1 g / L CaCl2*H2O, 1.3 g / L CuCl2*6H2O, 0.5 g / L H3BO3, and concentrated HCl dissolved in ddH2O and sterile filtered. 10×M9 salt stock solution consisted of 68 g / L anhydrous Na 2 HPO 4 , 30 g / L KH 2 PO 4 , 5 g / L NaCl, and 10 g / L NH 4 Cl dissolved in ddH 2 O and autoclaved.
[0171] The medium was filter sterilized and 50 mL was added to a 250 mL sterile baffled shake flask. An overnight culture was used as inoculum starting at an OD of 0.1 and incubation was performed at 37°C and 250 rpm until and unless otherwise stated.
[0172] Batch and fed-batch fermentation
[0173] Batch and fed-batch fermentations were performed in M9-glycine and TPM2 medium, respectively, as previously described. 15Except for the difference in antibiotics, the medium composition and growth induction conditions were the same. For fed-batch fermentation, a constant or linear feed rate was followed, but the glucose level in the fermentor was increased stepwise, which was monitored by glucose strips.
[0174] Analytical methods
[0175] Use a previously published HPLC method 16 Quantification of glucose, HGA, and other organic acids
[0176] Serine concentration was determined using a The HPLC was performed on a Dionex Ultimate 3000 HPLC (high performance liquid chromatography) equipped with a T chiral (250 x 2.1 mm x 5 μm) column (Sigma-Aldrich, St. Louis, MO, USA) and a diode array detector (DAD-UV). The mobile phase consisted of 60% acetonitrile (v / v) and 0.02% (v / v) formic acid in milliQ water. The mobile phase was delivered at a rate of 1.0 mL / min, and the injection volume was maintained at 3 μL for standards and all samples. Detection of L-serine was monitored at 205 nm.
[0177] Example 1 - Effect of replacing NADH-dependent glyceraldehyde-3-phosphate dehydrogenase with NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase.
[0178] Many NADPH-dependent glyceraldehyde-3-phosphate dehydrogenases have been reported in the literature, such as that from Clostridium acetobutylicum (gapC) 10 or Bacillus subtilis (gapB) 17 We replaced the native gapA with gapC from Clostridium acetobutylicum and monitored hydroxyglutarate production in shake flask and fed-batch fermentations. Construction of plasmid vectors pCDF-serAmut-serC and pACYC-serB establish
[0179] L-serine is produced in E. coli by three enzymes encoded by serA, serB and serC. All genes were isolated from E. coli MG1655 using primers with their respective gene names (Table 2). 100 μL PCR mixtures contained 250 nM of each forward and reverse primer, 250 μM of dNTP, 2 U of Phusion polymerase, 1 × HF buffer, and 1 μL of overnight culture. The following two-step PCR protocol was used for PCR amplification: an initial denaturation step at 98°C for 40 seconds, followed by 5 cycles of denaturation at 98°C for 10 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 90 seconds, followed by 20 cycles in which the annealing temperature was increased from 55°C to 65°C. After column purification, the gene products and plasmids were digested using Rapid Digest (Thermoscientific, Waltham, MA, USA). Approximately 500 ng of PCR product or 1 μg of plasmid was digested with 1 μl of each restriction endonuclease in 1× rapid digestion buffer. The reactions were incubated for 3 h and then column purified again. The serA PCR product was double digested with Ncol and Notl, while the serC PCR product was digested with Ndel and Pacl. pCDF-Duet was first digested with Ncol and Notl and used for cut-and-paste cloning of serA, generating the plasmid pCDF-Duet-serA. This plasmid was later used for cut-and-paste cloning of serC, generating pCDF-duet-serA-SERC. The serB PCR product was cloned into the Ncol and Pad sites of the pACYC-Duet vector to generate pACYC-SERB. A typical ligation reaction consisted of 50 ng of plasmid DNA and 100 ng of insert in 1× T4 ligase buffer and 0.3 μl / 10 μl of T4 DNA ligase (Thermoscientific, Waltham, MA, USA).
[0180] Three residues H344, N346, and N364 were mutated to alanine by site-directed mutagenesis. 18 To remove feedback inhibition of serA (Table 3). The master mix was used as described above, with the only modification being that the master mix was divided into two equal aliquots and the forward and reverse primers were then added to each aliquot. A total of 100 ng of pCDF-Duet-serA-serC plasmid was used as template. A two-step PCR program was used: initial denaturation at 98°C for 40 sec, denaturation at 98°C for 10 sec, annealing at 60°C for 30 sec, and extension at 72°C for 4 min and 30 sec. The cycle was repeated 5 times and the two aliquots were then mixed and redistributed for another 15 cycles. To enable the exchange of the vector backbone, the Ncol site within serC was removed by the same method using the primers listed in Table 3.
[0181] Table 2: Primers used for amplification and cloning of serine production pathways
[0182]
[0183]
[0184] Table 3: Primers used for site-directed mutagenesis of the serine production pathway
[0185] SEQ ID Primer name sequence SEQ ID NO:77 serA N364A_F CGAGCAGGGCGTCGCTATCGCCGCGCAATA SEQ ID NO:78 serA N364A_R TATTGCGCGGCGATAGCGACGCCCTGCTCG SEQ ID NO:79 serA H344AN346A_F CTGAT CACATCGCTGAAGCT CGTCCGGGCGTGC SEQ ID NO:80 serA H344AN346A_R GCACGCCCGGACGAGCTTCAGCGATGTGCATCAG SEQ ID NO:81 serC_NcoIc_F CAAGGTATTATTCTGTCATGGCGGTGGTCGCG SEQ ID NO:82 serC_NcoIc_R CGCGACCACCGCCATGACAGAATAATACCTTG
[0186] gapC replaces gapA
[0187] GapA is replaced with the gopC gene from acetobutylicum Clostridium acetobutylicum strain using a selection system based on cat-sacB. Cat-sacB is inserted using pKD46 carrying exo, β and γ genes for recombination. Positive selection of the cassette insertion is performed by selecting clones of chloramphenicol resistance. The loss of the cassette is selected by replicating the plating clones on LB-chloramphenicol and LB-sucrose plates containing 15% sucrose (without NaCI). The cat-sacB cassette (Table S3) is amplified using primers gapC_camsacB_F and R. Except for template and extension time, the reaction mixture and PCR program are the same as described in Example 1. The extension time is 2 minutes and 30 seconds, and the template is 1 μl overnight culture from Escherichia coli, carrying the cat-sacB cassette on its genome. The competent cells are then transformed with 200 ng of the gapC-cat-sacB cassette and inoculated on LB-chloramphenicol-ampicillin plates after two hours of regeneration and incubated overnight at 30°C. Pick single bacterium colony, and make it have electrocompetence (embodiment 1) after induction 1 hour, and transform with gapC gene, described gapC gene uses above-mentioned PCR program and primer gapC_aF and aR from acetobutylicum genomic amplification, as described in Table 4.After reclaiming two hours, cell is plated on LB-sucrose plate, and hatches at 42 ℃ to solidify pKD46 plasmid.24 clones of each experiment are replicated and inoculated on LB-chloramphenicol and LB flat board.The cassette loss of the clone that does not grow on LB-chloramphenicol flat board is checked by colony PCR, and is subsequently sequenced by Sanger sequencing.
[0188] Table 4: Primers for replacing gapA with gapC
[0189]
[0190]
[0191] Subsequently, the strain was transformed with pCDF-Duetl-serAmut-serC and pACYC-serB. The resulting glycerol stock was grown overnight in 2×YT medium containing 0.1% glucose supplemented with spectinomycin and chloramphenicol. The overnight culture was incubated in a fed-batch fermentation. The medium composition and culture conditions were as described previously.
[0192] result
[0193] Bacterial strain HM_274 does not carry gapA::gapC and replaces. In the flask with baffles, in 23h batch fermentation, accumulated 0.91g / L HGA. In 48h fed-batch fermentation, identical bacterial strain accumulated 935g / L HGA. Bacterial strain HM_476 does carry gapA::gapC and replaces. In the flask with baffles, in 23h batch fermentation, accumulated 0.86g / L HGA. In 48h fed-batch fermentation, identical bacterial strain accumulated 2.36g / L HGA. The data of 23 hours time points of batch fermentation and 48 hours fed-batch fermentation are shown in Table 5. The data clearly demonstrate the reduction of HGA output in the bacterial strain that gapA is replaced by gapC.
[0194] Table 5: Lower HGA accumulation in strain HM_476, where gapA was replaced by gapC, compared to HM 274.
[0195]
[0196] Example 2 - Effect of Reducing the NADH Pool by Oxidizing NADH Using NADH Oxidase (Nox) Materials and Methods (Nox)
[0197] Construction of plasmids pSEVA27-serAmut-CB and pSEVA27-serAmut-CB-Nox
[0198] All plasmid manipulations were performed using uracil-specific excision reagent (USER) cloning. PCR was performed using Phusion U Hot Start Polymerase Master Mix (Thermo Fisher Scientific, Waltham, MA, USA). Oligonucleotides were ordered from Integrated DNA technologies (IDT, Coralville, IA, USA) and are listed in Table 6. Genes serB and serC were amplified from the Escherichia coli MG1655 genome and cloned into the pSEVA27-sl backbone. serAmut was amplified from pCDFDuet-1-Seramut-Serc and cloned into the pSEVA27-sl backbone along with serB and serC. This plasmid was used to clone nox amplified from the Lactobacillus brevis genome. The use of each primer in generating different USER fragments is also mentioned. The PCR program was as follows: initial denaturation at 98°C for 40 seconds, denaturation at 98°C for 10 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 3 minutes and 30 seconds, repeated 25 times. User fragments 1 to 4 were used to assemble pSEVA27-serACB-Nox, while fragments 5 and 6 were used to assemble pSEVA27-serACB-Nox.
[0199] A 10 μL user reaction contained 1 μL user enzyme and 1 μL LOX cleavage smart buffer (New England Biolabs) and 200 ng of each user fragment. The reaction was incubated at 37°C for 30 minutes, followed by incubation at 15°C for 30 minutes. The reaction mixture was transformed into chemically competent NEB5α cells, and the transformants were grown in SOC medium at 37°C, then plated on LB-kan plates and incubated overnight at 37°C.
[0200] On the next day, single colonies were picked and incubated in 2xYT-kan medium and incubated at 37°C for 16 h for plasmid preparation and Sanger sequencing. Figure 1 The confirmed plasmids were transformed into E. coli strains to produce L-serine. The shake flask protocol described above was used for serine production.
[0201] Table 6: Primers used for the construction of pSEVA27-serAmut-CB and pSEVA27-serAmut-CB-Nox
[0202]
[0203]
[0204] result
[0205] In batch fermentations performed in baffled flasks, strains co-expressing Nox and serACB from pSEVA27-serACB-Nox accumulated 0.06–0.07 g / L HGA after 24 h of incubation. Figure 2 The strain expressing SerACB accumulated only 0.4 g / L HGA. This data demonstrates that NADH depletion caused by expression of NADH oxidase leads to reduced HGA production.
[0206] Example 3 - Effect of overexpression of NADH-dependent glutamate dehydrogenase
[0207] Escherichia coli and Corynebacterium glutamicum use NADPH-dependent glutamate dehydrogenase to reduce KGA to glutamate, recycling NADPH to NADP. + To switch from NADPH to NADH consumption and thus recycle NADH to NAD+, an NADH-dependent glutamate dehydrogenase can be expressed. Many NADH-dependent glutamate dehydrogenases are known in the literature, and we have tested the NADH-dependent glutamate dehydrogenase RocG from Bacillus subtilis.
[0208] Materials and methods
[0209] The rocG was cloned into the pACYC-serB plasmid using the user clone described above. Primers are given in Table 7a. The PCR program and user reaction, and transformation were performed as described above, with the only difference being that after the regeneration step, the cells were plated on LB-chloramphenicol plates and 2xYT-chloramphenicol medium was used for cell growth. The production medium in shake flasks was maintained as described above.
[0210] Table 7a: Primers used to clone rocG in pACYC-serB to construct pACYC-serB-rocG
[0211]
[0212] result
[0213] ALE-8 and ALE-8-expressing RocG were monitored for HGA and L-serine concentrations during 20 h shake flask fermentations.
[0214] Table 7b. HGA and serine concentrations were measured in the supernatants of 20 h fed-batch fermentations.
[0215] Strain modification +rocG -rocG Serine, 20h (g / L) 0.37 0.74 HGA, 20h (g / L) 0.06 0.24 Serine / HGA, 20h 6.16 3.08
[0216] The strain expressing RocG showed a 6-fold lower HGA concentration compared to the strain without RocG expression. Although the serine concentration was also lower, the serine / HGA ratio was almost 2-fold better in the +rocG strain.
[0217] Similarly, in another experiment, ALE-8 accumulated 0.27 g / L HGA 5 hours after fermentation began, while ALE-8 expressing RocG accumulated 0.06 g / L HGA. After 48 hours, ALE-8 accumulated 0.1 g / L HGA, while ALE-8 expressing RocG accumulated 0.06 g / L HGA. After 48 hours, ALE-8 produced 0.75 g / L L-serine, while ALE-8 expressing RocG produced 0.3 g / L L-serine.
[0218] This experiment showed that the additional expression of rocG contributed to the reduction of HGA accumulation, and its expression also reduced the production of L-serine. However, if the ratio of L-serine to HGA of the two strains was compared, rocG expression was better.
[0219] Example 4 - Effect of GAPC on L-serine production.
[0220] In this example, we demonstrated that the introduction of gapC increased L-serine production in strains expressing serA with KGA reduction activity (E. coli) or in strains expressing serA without KGA reduction activity. To demonstrate the first scenario, an L-serine operon from E. coli containing feedback-insensitive serA was transformed into an E. coli strain expressing either gapA or gopC from the genome. To demonstrate the latter scenario, serA from E. coli was replaced with feedback-insensitive serA from Corynebacterium glutamicum, which lacks KGA reduction activity in both the pCDF and pSEVA27 vectors.
[0221] Plasmid construction:
[0222] The structure of pCDF-Duet1-serAmut-serC, pACYC-serB and pSEVA27-serAmut-serC has been explained in previous embodiment.In order to replace serAmut (intestinal bacteria) with serA from Corynebacterium glutamicum in these vectors, the user primers provided in Table 8 were used.PCR program, user reaction and transformation are carried out as described in the above-mentioned embodiment.By using above-mentioned site-directed mutagenesis scheme, Y463 or N483 is replaced with alanine (A) to eliminate feedback inhibition, and produce vector pCDF-Duet1-serAglut-Y463A-serC and pCDF-Duet1-serAglut-N483A-serC, as well as vector pSEVA27-serAglut-Y463A-serC and pSEVA-serAglut-N483a-serC.Primers are listed in Table 8.
[0223] Table 8: Primers used to introduce C. glutamicum serA into vectors pCDF-Duet1-serAmut-serC, pACYC-serB and pSEVA27-serAmut-serC
[0224]
[0225]
[0226] result
[0227] The production of L-serine by strains from Escherichia coli expressing the feedback inhibition-insensitive serA with either gapA or gapC on their genome was compared in a fed-batch fermentation over the course of 48 hours. The L-serine concentrations measured during the fermentation are shown in Table 1. Figure 4 A. The strain expressing gapA produced 25 g / L, while the strain expressing gapC produced 35 g / L. In addition, during a 68-hour fed-batch fermentation, strains with either gapA or gapC on their genomes were compared to express the feedback inhibition-insensitive form of serA in Corynebacterium glutamicum. The L-serine concentrations measured during the fermentation are shown in Figure 4 In B, the strain expressing gapA produced 50 g / L, while the strain expressing gapC produced 100 g / L.
[0228] First, the data show that a 40% increase in L-serine production in fermentation can be achieved from strains in which gapA is replaced by gapC and that express an L-serine pathway that includes E. coli serA, which has promiscuous activity toward KGA. Second, for strains expressing a serine pathway that includes C. glutamicum serA, which has no promiscuous activity toward KGA, the gapA::gapC modification increased L-serine production by 200%.
[0229] Example 5 - Effect of GAPC on strains expressing serum without HGA activity.
[0230] In this embodiment, we prove that the NADPH storehouse of enhancing expression for example gapC not only strengthens the generation (embodiment 4) of L-serine, it has also reduced the redox imbalance caused by the expression of Corynebacterium glutamicum serA, and described Corynebacterium glutamicum serA can not oxidize NADH and is reduced to HGA with KGA simultaneously.Other NADPH supply (in this embodiment from gapC) may supply KGA and recycle to the required NADPH of glutamic acid.In order to prove this point, we have expressed the L-serine pathway from the carrier pCDF and pACYC that contain the serA that does not have HGA activity in gapA (serHM_708) and gapC (serHM_608) bacterial strain, described serA is for example from Corynebacterium glutamicum.In batch fermentation experiment, compared two kinds of bacterial strains serHM_708 and serHM_608.
[0231] like Figure 5 As shown, the gapC strain (serHM_608) was grown to a final OD of 7, while the gapA strain (serHM_708) was grown to a final OD of 3.
[0232] Example 6 - Effect of rat serA in strains expressing gapC.
[0233] The serA gene from rat is type I serA and was found to have negligible activity in producing hydroxyglutarate. The gene was ordered as a gene fragment from TwistBiosicence (USA). The serA is disclosed herein as SEQ ID NO: 8. To clone rat serA, the pSEVAserACB vector with constitutive promoter strength was selected. These vectors are well known in the art. The vector backbone primers oSER_1424 and oSER_1426 bind to the sequences upstream and downstream of the replaced serA. Primers oSER_1423 and oSER_1425 were used to amplify the gene fragment with complementary user overhangs.
[0234] PCR program: 98°C initial denaturation for 40 seconds, 98°C denaturation for 10 seconds, 60°C annealing for 30 seconds, 72°C extension for 3 minutes and 30 seconds (30 seconds / kb) repeated 25 times. The primer sequences are given in the table below.
[0235] Table 9: Primers used for introduction of rat serA (SEQ ID NO: 8 and its truncated version (encoded by SEQ ID NO: 144)) in the pSEVA plasmid with conserved expression of the serine pathway.
[0236]
[0237]
[0238] A 10 μL user reaction contained 1 μL user enzyme and 1 μL 10× cleavage smart buffer (New England Biolabs) and 200 ng of each user fragment. The reaction was incubated at 37°C for 30 minutes, followed by a 30-minute incubation at 15°C. The reaction mixture was transformed into chemically competent NEB5α cells, and the transformants were grown in SOC medium at 37°C, then plated on LB-kan plates and incubated overnight at 37°C.
[0239] On the next day, single colonies were picked and incubated in 2xYT-kan medium and incubated at 37°C for 16 h for plasmid preparation and Sanger sequencing. Figure 7 The confirmed plasmid was transformed into an E. coli strain to produce L-serine. A truncated form of rat serA was obtained using primers oSER_1424 and oSER_1533. The plasmid obtained above was used as a template. The PCR, user reaction, and transformation protocols were the same as above. The shake flask culture medium and protocol are described below.
[0240] The growth and L-serine titer in the production strain transformed with different serA variants were tested in a 24-hour shake flask experiment. For this reason, a MOPS-based culture medium (pH 7.6) was prepared by adding 10 g / L ammonium sulfate (CAS No.7783-20-2), 2 g / L potassium dihydrogen phosphate (CAS No.7778-77), 2 g / L yeast extract, 40 g / L MOPS (CAS No.1132-61-2) and 0.6 g / L glycine to the required total culture volume. 15% NH3 solution was used to adjust the culture medium to pH 7.6 and autoclave. Subsequently, 20 mL of sterile MOPS-based culture medium was added to a 250 mL sterile shake flask and supplemented with 600 μl of glucose monohydrate (CAS No. 14431-43-7), 80 μl of trace elements and 200 μl of magnesium sulfate heptahydrate (CAS No. 56-40-6). The OD of the overnight culture was then measured.600 To use it as an inoculum. From the strain with the lowest optical density, 1 mL was inoculated into the shake flask, while the remaining strains were inoculated with correspondingly smaller volumes, resulting in the same starting biomass in all shake flasks. They were incubated at 37 ° C and 250 rpm for 24 hours. The optical density was monitored after 1.5, 3, 4.5, 6, 7.5 and 24 hours of growth. At the same time point, 300 pL of culture was sampled into a 96-deep well plate, down-crossed at 3,500 x g and 4 ° C for 5 minutes, and the resulting supernatant was filtered through a 22 μm membrane into an HPLC plate for quantification of L-serine.
[0241] Table 10: Brief description of strain numbers and variables in each construct.
[0242] strain illustrate SER_1739 gapC-serA_rat SER_1827 gapC-trunc_serA_rat SER_351 gapC-serA_Cglutamicum
[0243] result
[0244] like Figure 8 As shown, the strain expressing serA from rat produced surprisingly low titers because it was found not to be inhibited by L-serine. However, after removing the regulatory domain by using primers oSER_1423 and oSER_1535, the truncated variant of the serA rat gene (SEQ ID NO:144 / SER_1827) produced more L-serine, reaching 2.6 g / L after 24 hours. Compared with untruncated (SER_1739) and control (SER_351) strains, the amount of L-serine produced by the truncated serA rat variant (SER_1827) was unexpectedly higher, with untruncated and control strains producing 0.4 and 1.4 g / L of L-serine respectively after 24 hours. This shows that a significant amount of L-serine can be produced using strains from the truncated serA of type I classification.
[0245] Example 7 - Effect of replacing NADH-dependent glyceraldehyde-3-phosphate dehydrogenase with variants of NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase
[0246] Many different variants of NADPH glyceraldehyde 3-phosphate dehydrogenase are known. Some of them are shown in SEQ ID NO: 23 to 46. In order to prove that NADPH dependency glyceraldehyde 3-phosphate dehydrogenase can also be used for producing L-serine, synthetic gene fragments of SEQ ID NO: 25 and 36 were ordered from twistbioscience (U.S.), which have additional 500bp overhangs complementary to the gapA upstream and downstream regions. GapA was replaced with the cat-sacB selection system mentioned in Example 1. The following table provides primers for amplifying the gene fragment that replaces the cat-sacB box at the gapA site.
[0247] Table 11: Primers used to amplify gap variants with cat-sacB cassette integrated instead at the gapA site
[0248]
[0249] The strain was transformed with the pSER_43 plasmid. This plasmid contains a strong constitutive promoter expressing the serine operon and the feedback-insensitive serA (SEQ ID NO: 14) from Corynebacterium glutamicum. Transformants were selected on kanamycin plates. The inoculation and shake flask protocol for L-serine production was as described in Example 6.
[0250] result
[0251] like Figure 9 As shown, NADPH glyceraldehyde 3-phosphate dehydrogenases from Corynebacterium glutamicum and Klebsiella lactis, with average titers of 3.62 and 3.65 g / L, respectively, produced comparable L-serine to gapC from Corynebacterium acetobutylicum, which produced an average of 3.3 g / L of L-serine after 24 hours. Therefore, these variants can also be used to enhance NADPH pools.
[0252] Example 8 - Effect of Reducing the NADH Pool Using Various Variants of NADH Oxidase on the Production of L-Serine by NADH Oxidation
[0253] In Example 2, the effect of NADH oxidase from Lactobacillus brevis (SEQ ID NO: 49) on the reduction of hydroxyglutarate was demonstrated. In this example, various Nox variants (SEQ ID NO: 50, 52, and 55) were cloned downstream of the serACB operon of serA from Corynebacterium glutamicum (which does not produce HGA). In this example, the goal was to analyze whether expression of other variants of NADH oxidase would enhance L-serine production.
[0254] Gene fragments were ordered from Twist Bioscience (SEQ ID NO: 50, 52, 55). The cloning strategy was the same as described in Example 2. The primers used to amplify the different Nox variants are shown in the table below. Figure 10 Inoculation and shake flask experiments were performed as in Examples 6 and 7. The only difference was that the cultures were induced by adding 40 pM (final concentration) IPTG, and the OD 600 Values are between 0.55 and 0.65.
[0255] Table 12: Primers used for cloning Nox genes downstream of the serACB operator under the T7 promoter.
[0256]
[0257] Table 13: Brief description of strain numbers and variables in each construct Results:
[0258] strain illustrate SER_1888 gapC-serA_C.glutamicum-nox_L.parakefiri SER_1911 gapC-serA_C.glutamicum
[0259] result:
[0260] like Figure 11 As shown, expression of Nox from L. parakefiri (SER_1888) resulted in an L-serine titer of 1.9 g / L after 24 hours, which was higher than the amount produced by the control strain (SER_1911), which reached 1.6 g / L after 24 hours. This indicates that expression of NADH oxidase from L. parakefiri contributes to enhanced L-serine production.
[0261] Example 9 - Effect of increasing the NADPH pool by overexpression of genes from the pentose phosphate pathway
[0262] The pentose phosphate pathway is one of the main sources that NADPH storehouse is provided to bacterium.In this embodiment, tested by overexpressing the zwf of coding glucose 6 phosphate dehydrogenase or the pgl of the 6-phosphogluconolactonase in the coding pentose phosphate pathway and whether increasing the NADPH storehouse can strengthen the NADPH storehouse in the cell.In this embodiment, studied the effect of these enzymes under the situation of the glyceraldehyde phosphate dehydrogenase (gapC) based on NADPH.Use the primer mentioned in the following table from MG1655 genomic amplification Zwf and pgl.
[0263] PCR program: initial denaturation at 98°C for 40 sec, denaturation at 98°C for 10 sec, annealing at 60°C for 30 sec, extension at 72°C for 1 min, and the cycle was repeated 25 times.
[0264] Like NADH oxidase, zwf and pgl genes were cloned below serB in the serACB operon. Each gene was cloned into an operon containing either feedback-insensitive serA from Escherichia coli (to examine the reduction of hydroxyglutarate production) or serA from Corynebacterium glutamicum (to examine whether production results in an increase in L-serine production). The constructs are shown in Figure 12.
[0265] Table 14: Primers used for cloning the pgl and zwf genes downstream of the serACB operon under the T7 promoter.
[0266]
[0267] The cloning strategy and shake flask study protocol were the same as in Example 8.
[0268] Table 15: Brief description of strain numbers and variables in each construct
[0269] strain illustrate SER_1880 gapC-serA_C.glutamicum-pgl SER_1881 gapC-serA_E.coli-pgl SER_1882 gapC-serA_C.glutamicum-zwf SER_1884 gapC-serA_E.coli-zwf SER_1890 gapA-serA_C.glutamicum-pgl SER_1891 gapA-serA_E.coli-pgl SER_1892 gapA-serA_C.glutamicum-zwf SER_1893 gapA-serA_E.coli-zwf SER_1901 gapA-serA_C.glutamicum SER_1902 gapA-serA_E.coli SER_1911 gapC-serA_C.glutamicum SER_1912 gapC-serA_E.coli
[0270] result
[0271] When combined with serA from Corynebacterium glutamicum, overexpression of the gpl and zwf genes affected the production of L-serine. Figure 13a As can be seen in the figure, overexpression of zwf in the gapC background (SER_1882) resulted in 1.95 g / L of L-serine production, which was higher than the 1.6 g / L of L-serine produced by the control strain (SER_1911). In addition, when pgl (SER_1890) and zwf (SER_1892) were overexpressed with serA from Corynebacterium glutamicum in the gapA background, pgl resulted in enhanced L-serine production, resulting in a titer of 3.1 g / L. Figure 13b As observed in Figure 2, this amount of L-serine was higher than that produced by the control strain (SER_1901), which achieved 2.9 g / L of L-serine production after 24 hours.
[0272] Likewise, overexpression of pgl and zwf had an effect on the production of L-serine and hydroxyglutarate when combined with serA from E. coli. Figure 13c As shown, strains with a gapC background expressing pgl (SER_1881) and zwf (SER_1883) increased L-serine production with titers of 3.4 and 3.5 g / L, respectively, while the control strain (SER_1912) produced 3.2 g / L of L-serine after 24 hours. In addition, when pgl and zwf were overexpressed, HGA production decreased from 0.96 g / L in the control strain to 0.83 and 0.79 g / L, respectively. Similarly, overexpression of pgl (SER_1891) and zwf (SER_1893) in combination with serA from Escherichia coli in the gapA strain resulted in reduced HGA production. Figure 13d As shown, when pgl and zwf were overexpressed, HGA decreased from 0.98 g / L in the control strain (SER_1902) to 0.41 and 0.82 g / L, respectively. In addition, overexpression of pgl in this gapA background resulted in increased L-serine production, reaching 3.45 g / L after 24 hours. This strain produced more L-serine than the control strain, which produced 3.1 g / L at the same time point.
[0273] Thus, overexpression of pgl and zwf enhanced L-serine production and reduced HGA production, an effect that was more pronounced in the gapA strain.
[0274] Example 10 - PGDH motif with reduced HGA activity.
[0275] Some PGDHs can reverse the process and use α-ketoglutarate (aKG) instead of PHP to produce α-hydroxyglutarate. Three enzymes have been found that can utilize αKG as a substrate: PDGH from Escherichia coli (REF), Pseudomonas stutzeri (REF), and Saccharomyces cerevisiae (REF). All three enzymes are type II PGDHs, and it is hypothesized that type I and type III PGDHs may not be able to use αKG as a substrate, and the ability to use αKG as a substrate is a trait specific to type II PGDHs.
[0276] To examine the conserved residues in type I and type II PGDHs, representatives of each class were selected. For type I, PGDH from Mycobacterium tuberculosis was selected, while for type II, PGDH from Escherichia coli was selected. These enzymes were chosen because they have been extensively studied and crystal structures exist for both in complex with relevant substrates. Residue conservation was examined using the ConSurf-DB server. Relevant crystal structures were used as input; type I (Mycobacterium tuberculosis, PDB ID: 3DDN) and type II (Escherichia coli, PDB ID: 1YBA). The ConSurf workflow is as described previously. Briefly, amino acid sequences similar to each sequence in the provided PDB IDs were collected and multiple aligned using HMMER and MAFFT, respectively. The evolutionary conservation of each amino acid position in the alignment was calculated using the Rate4Site algorithm implemented in the ConSurf web server. This algorithm explicitly takes into account the phylogenetic relationship between the aligned proteins and the stochastic nature of the evolutionary process. Rate4Site assigns a conservation level to each residue using empirical Bayesian inference. The continuous conservation score is divided into a nine-level discrete scale for visualization (not shown), from the most variable position (level 1) colored turquoise, through the intermediately conserved position (level 5) colored white, to the most conserved position (level 9) colored maroon. The conservation score is projected onto the protein / nucleotide sequence and onto the crystal structure corresponding to the PDB ID used as input.
[0277] result
[0278] Examination of the conserved amino acid sequences of type I and type II PGDHs revealed that several regions facing the active site are conserved in both type I and type II PGDHs. One such motif is the G / ARAGV and GCFCI motifs in type I and type II PGDHs, respectively. A striking and highly conserved difference between the two motifs is the type of residue at the second position. In type I PGDHs, this is an arginine residue, while in type II enzymes, it is most often a cysteine residue. Examination of representative type I (Mycobacterium tuberculosis) and type II (Escherichia coli) PGDH structures bound to PHP and αKG, respectively, revealed that both the arginine and cysteine residues face the active site, suggesting that these residues may be involved in controlling substrate specificity and, therefore, the ability to use αKG as a substrate. This was further investigated using site-directed mutagenesis to replace the arginyl side chains in M. tuberculosis PGDH with other selected amino acid side chains, such as alanine and leucine. Removal of the cationic group at Arg 72 in Mycobacterium tuberculosis PGDH converted the enzyme from one that did not accept αKG as a substrate to one that did. However, replacing the arginyl side chain with a lysyl side chain failed to achieve this. These results clearly indicate that it is the presence of the cationic side chain at the second position of the conserved motif that prevents the enzyme from using αKG.
[0279] Example 11 - Effect of Replacing NADH-Dependent Glyceraldehyde-3-Phosphate Dehydrogenase with NADPH-Dependent Glyceraldehyde-3-Phosphate Dehydrogenase on the Intracellular NAD(P)H Pool
[0280] In this embodiment, it has been demonstrated that in the bacterial strain expressing serA (Corynebacterium glutamicum / SECt IDNO:14) without KGA reducing activity, the introduction of gapC (SEQ ID NO:43) or gdpl (SEQ ID NO:36) has increased overall NADP (H) library. In order to prove this point, the Escherichia coli strain expressing gapA, gapC or gdpl from genome was transformed with pSER_43 plasmid. This plasmid contains a strong constitutive promoter, which expresses the serine operon together with the serA from Corynebacterium glutamicum (SEQ ID NO:14). On kanamycin plates, transformant was selected. Inoculation and shaking flask were carried out as described in Example 6. After hatching for 24 hours, for every bacterial strain, 1mL biomass was sampled and quenched with 1mL40% ethanol-0.8% sodium chloride solution, and subsequently sample was immersed in dry ice-ethanol bath for 20 seconds. Then, sample was hatched on ice for 15 minutes, and at 4°C with 11,000xg centrifugal 5 minutes. Resuspend the cell pellet in 1 mL of MQ water. + Quantification of intracellular NADP(H) pools was achieved using the NADPPH quantification kit (Sigma-Aldrich) according to the manufacturer's instructions.
[0281] result
[0282] like Figure 14 As shown, when serA, which lacks KGA reduction activity, is expressed, the replacement of NADH-dependent glyceraldehyde-3-phosphate dehydrogenase (gapA) with NADPH-dependent glyceraldehyde-3-phosphate dehydrogenases (gapC and gdpl) results in an increase in the overall intracellular cofactor pool. gdpl and gapC have comparable effects on the NADP(H) pool. Results are expressed as 4×10 6 NADP in cells + and the intracellular concentration of NADPH (pmole).
[0283] Overall, this example also shows that the combined (over)expression of NADPH-producing GAPDHs, in particular GapC, and non-HGA-producing PGDHs, in particular serA from C. glutamicum, balances the NAPDH and NADPH pools in the cell and allows for better production of L-serine.
[0284] List of references cited in the specification
[0285] 1. Grant, GAD-3-phosphoglycerate dehydrogenase. Front. Mol. Biosci. 5, 1-18 (2018).
[0286] 2.Wei Xu1,2,12,Hui Yang1,2,12,Ying Liu3,12,Ying Yang1,Ping Wang1,Se-Hee Kim8,S.,Ito8,10,ChenYang6,Pu Wang1,2,Meng-Tao Xiao1,2,Li-xia Liu5,Wen-qing Jiang1,2,J.,Liu6,Jin-ye Zhang2,Bin Wang4,Stephen Frye9,Yi Zhang8,10,11,Yan-hui Xu1,Q.&Lei2,5,Kun-Liang Guan1,2,5,7,*,Shi-min Zhao1,2,*,and YueXiong1,2,8,11.Control of Embryonic Stem Cell State Richard.Cancer Cell 29,997-1003(2012).
[0287] 3.Kalliri,E.,Mulrooney,S.B.&Hausinger,R.P.Identification ofEscherichia coli YgaF as an L-2-hydroxyglutarate oxidase.J.Bacteriol.190,3793-3798(2008).
[0288] 4.Zhang,W.et al.Coupling between D-3-phosphoglycerate dehydrogenaseand D-2-hydroxyglutarate dehydrogenase drives bacterial L-serine synthesis.Proc.Natl.Acad.Sci.U.S.A.114,E7574-E7582(2017).
[0289] 5.Zhao,G.&Winkler,M.E.Anovel alpha-ketoglutarate reductase activityof the serA-encoded 3-phosphoglycerate dehydrogenase of Escherichia coli K-12and its possible implications for human 2-hydroxyglutaricaciduria.J.Bacteriol.178,232-9(1996).
[0290] 6.Zhang,X.,Xu,G.,Shi,J.,Koffas,M.A.G.&Xu,Z.Microbial Production of L-Serine from Renewable Feedstocks.Trends Biotechnol.36,700-712(2018).
[0291] 7.Rennig,M.et al.Industrializing a Bacterial Strain for l-SerineProduction through Translation Initiation Optimization.ACS Synth.Biol.8,2347-2358(2019).
[0292] 8.Geueke,B.,Riebel,B.&Hummel,W.NADH oxidase from Lactobacillusbrevis:A new catalyst for the regeneration of NAD.Enzyme Microb.Technol.32,205-211(2003).
[0293] 9.Marx,A.,Eikmanns,B.J.,Sahm,H.,De Graaf,A.A.&Eggeling,L.Response ofthe Central Metabolism inCorynebacterium glutamicumto the use ofan NADH-Dependent Glutamate Dehydrogenase.Metab.Eng.1,35-48(1999).
[0294] 10.Martínez,I.,Zhu,J.,Lin,H.,Bennett,G.N.&San,K.Y.ReplacingEscherichia coli NAD-dependent glyceraldehyde 3-phosphate dehydrogenase(GAPDH)with a NADP-dependent enzyme from Clostridium acetobutylicumfacilitates NADPH dependent pathways.Metab.Eng.10,352-359(2008).
[0295] 11.King,Z.A.&Feist,A.M.Optimal cofactor swapping can increase thetheoretical yield for chemical production in Escherichia coli andSaccharomyces cerevisiae.Metab.Eng.24,117-128(2014).
[0296] 12.Niu,H.et al.Metabolic engineering for improving l-tryptophanproduction in Escherichia coli.J.Ind.Microbiol.Biotechnol.46,55-65(2019).
[0297] 13.Hashim,Y.,Ismail,N.,Jamal,P.,Othman,R.&Salleh,H.Production ofCysteine:Approaches,Challenges and Potential Solution.Int.J.Biotechnol.Wellness Ind.3,95-101(2014).
[0298] 14.Zhao,G.&Winkler,M.E.A novelα-ketoglutarate reductase activity ofthe sera-encoded 3-phosphoglycerate dehydrogenase of Escherichia coli K-12and its possible implications for human 2-hydroxyglutaricaciduria.J.Bacteriol.178,232-239(1996).
[0299] 15.Mundhada,H.et al.Increased production ofL-serine in Escherichiacoli through Adaptive Laboratory Evolution.Metab.Eng.39,141-150(2017).
[0300] 16.Mundhada,H.,Schneider,K.,Christensen,H.B.&Nielsen,A.T.Engineeringof high yield production of L-serine in Escherichiacoli.Biotechnol.Bioeng.113,807-816(2016).
[0301] 17. Wang, Y., San, K. Y. & Bennett, G. N. Improvement of NADPH bioavailability in Escherichia coli by replacing NAD+-dependent glyceraldehyde-3-phosphate dehydrogenase GapA with NADP+-dependent GapB from Bacillus subtilis and addition of NAD kinase. J. Ind. Microbiol. Biotechnol. 40, 1449-1460 (2013).
[0302] 18. Al-rabiee, R., Zhang, Y. & Grant, G. A. The Mechanism of Velocity Modulated Allosteric Regulation in D-3-Phosphoglycerate Dehydrogenase. 271, 23235-23238 (1996).
[0303] 19. Ben Chorin A., Masrati G., Kessel A., Narunsky A., Sprinzak J., Lahav S., Ashkenazy H. and Ben-Tal N. (2020). ConSurf-DB: An accessible repository for the evolutionary conservation patterns of the majority of PDB proteins. Protein Science 29:258-267.
[0304] 20. Goldenberg O., Erez E., Nimrod G. and Ben-Tal N. (2009). The ConSurf-DB: Pre-calculated evolutionary conservation profiles of protein structures. Nucleic Acids Research (Database issue), 37:D323-D327;PMID: 18971256.
[0305] Sequence Listing
[0306] This application contains the sequence listings included in Tables A and B below, submitted electronically in ST26 format, which are incorporated herein by reference in their entirety.
[0307]
[0308]
[0309]
[0310]
[0311]
[0312]
[0313] Table 1. Proteins used in the present invention.
[0314]
[0315]
[0316]
[0317]
[0318]
[0319]
[0320]
[0321]
[0322]
[0323]
[0324]
[0325]
[0326]
[0327]
[0328]
[0329]
[0330]
[0331]
[0332]
[0333]
[0334]
[0335]
[0336]
[0337]
[0338]
[0339]
[0340]
[0341]
[0342]
[0343]
[0344] Items of the Disclosure The disclosure further provides the following embodiments and items:
[0345] Item 1. A genetically engineered bacterium that has been modified to have increased expression of a polypeptide having D-3-phosphoglycerate dehydrogenase activity (serA) and reduced production of hydroxyglutarate (HGA) compared to an otherwise identical bacterium not carrying the modification.
[0346] Item 2. The bacterium according to Item 1, wherein hydroxyglutarate production is reduced by increasing the cytoplasmic NADPH pool and / or decreasing the cytoplasmic NADH pool compared to an otherwise identical bacterium not carrying the modification.
[0347] Item 3. The bacterium according to any one of items 1-2, expressing a polypeptide having D-3-phosphoglycerate dehydrogenase activity and selected from SEQ ID NOs: 1 to 22, and a polypeptide comprising an amino acid sequence having at least about 70%, such as at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with any one of SEQ ID NOs: 1 to 22.
[0348] Item 4. The bacterium according to any one of Items 1 to 3, wherein the reduced HGA production is achieved by expressing a polypeptide having D-3-phosphoglycerate dehydrogenase activity and reduced or no HGA production activity.
[0349] Item 5. The bacterium according to any one of items 1-4, which expresses a polypeptide having D-3-phosphoglycerate dehydrogenase activity and is selected from SEQ ID NOs: 6 to 15, and a polypeptide comprising an amino acid sequence having at least about 70%, such as at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with any one of SEQ ID NOs: 6 to 15.
[0350] Item 6. The bacterium according to any one of items 1 to 5, which expresses a polypeptide having 3-phosphoglycerate dehydrogenase activity, and the polypeptide is derived from a polypeptide as defined in item 4, and is made feedback-insensitive by truncation of the C-terminal domain (e.g., SEQ ID NO: 16 and 18) or by site-directed mutagenesis of key sites (e.g., SEQ ID NQ: 20-22).
[0351] Item 7. The bacterium according to Items 1 to 6, wherein the bacterium has increased production of L-serine and / or an L-serine-derived compound.
[0352] Item 8. The bacterium according to any one of Items 4 and 7, wherein the reduced growth and redox imbalance caused by using D-3-phosphoglycerate dehydrogenase activity with reduced or no HGA production activity are resolved by increasing the cytoplasmic NADPH pool and / or reducing the cytoplasmic NADH pool.
[0353] Item 9. The bacterium according to any one of Items 1 to 8, wherein the NADPH production is increased by heterologous expression of an NADPH-dependent polypeptide having glyceraldehyde-3-phosphate dehydrogenase activity with or without additional ATP production.
[0354] Item 10. The bacterium according to any one of items 1-4, which expresses an NADPH-dependent polypeptide having glyceraldehyde-3-phosphate dehydrogenase activity, with or without additional ATP production, and which is selected from SEQ ID NOs: 23 to 46, and a polypeptide comprising an amino acid sequence having at least about 70%, such as at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 23 to 46.
[0355] Item 11. The bacterium according to Item 2, which is modified to enhance the expression of the enzyme glucose-6-phosphate dehydrogenase (eg, SEQ ID NO: 47) and / or 6-phosphogluconate dehydrogenase (eg, SEQ ID NO: 48).
[0356] Item 12. The bacterium according to Items 1-3, which expresses a heterologous polypeptide having NADH oxidase (Nox) activity to reduce the intracellular NADH pool.
[0357] Item 13. The bacterium according to Item 12, wherein the heterologous polypeptide having NADH oxidase (Nox) activity is selected from SEQ ID NO: 49 to 56, and a polypeptide comprising an amino acid sequence having at least about 70%, such as at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of any one of SEQ ID NO: 49 to 56.
[0358] Item 14. The bacterium according to any one of Items 1-2, which depletes the NADH pool by expressing a heterologous NADH-dependent polypeptide having glutamate dehydrogenase activity.
[0359] Item 15. The bacterium according to Item 14, wherein the heterologous NADH-dependent polypeptide having glutamate dehydrogenase activity is selected from SEQ ID NOs: 57 to 66, and a polypeptide comprising an amino acid sequence having at least about 70%, such as at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of any one of SEQ ID NOs: 57 to 66.
[0360] Item 16. The bacterium according to any one of items 1 to 15, which is modified to have reduced expression and / or activity of an endogenous NADH-dependent polypeptide having glyceraldehyde-3-phosphate dehydrogenase activity compared to an otherwise identical bacterium not carrying the modification.
[0361] Item 17. The bacterium according to Item 16, wherein the endogenous gene encoding the endogenous NADH-dependent polypeptide having glyceraldehyde-3-phosphate dehydrogenase activity is inactivated.
[0362] Item 18. The bacterium according to any one of Items 1 to 17, wherein the polypeptide having D-3-phosphoglycerate dehydrogenase activity is a polypeptide having reduced activity against alpha-ketoglutarate, wherein the reduced activity is measured relative to the activity of SEQ ID NO: 16.
[0363] Item 19. The bacterium according to Item 18, wherein the polypeptide having D-3-phosphoglycerate dehydrogenase activity is selected from SEQ ID NOs: 16 to 22, and a polypeptide comprising an amino acid sequence having at least about 70%, such as at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the amino acid sequence of any one of SEQ ID NOs: 16 to 22.
[0364] Item 20. The bacterium according to any one of Items 1 to 19, wherein the bacterium belongs to the family Enterobacteriaceae.
[0365] Item 21. The bacterium according to Item 20, wherein the bacterium belongs to the genus Escherichia.
[0366] Item 22. The bacterium according to Item 21, wherein the bacterium is Escherichia coli.
[0367] Item 23. The bacterium according to any one of Items 1 to 19, wherein the bacterium belongs to the genus Corynebacterium.
[0368] Item 24. The bacterium according to Item 23, wherein the bacterium is Corynebacterium glutamicum.
[0369] Item 25. A method for producing L-serine or an L-serine derivative, comprising culturing the bacterium according to any one of Items 1 to 24 in a culture medium.
[0370] Item 26. The method according to Item 25, wherein the L-serine derivative is selected from L-cysteine, L-methionine, L-glycine, O-acetylserine, L-tryptophan, thiamine, ethanolamine and ethylene glycol.
[0371] Item 27. The method according to Item 25 or 26, wherein the method further comprises isolating L-serine or an L-serine derivative from the culture medium.
Claims
1. A genetically engineered host cell that produces a metabolite from 3-phosphoglycerate via a metabolic pathway, comprising one or more genetic modifications that prevent, reduce, or mitigate the negative impact of the intracellular accumulation of NADH and / or hydroxyglutarate (HGA) produced by one or more pathway enzymes on the production of the metabolite.
2. The host cell according to claim 1, wherein the metabolite is L-serine or a derivative thereof.
3. The host cell according to claim 1 or 2, comprising one or more, optionally two or more, optionally three or more, optionally four or more, optionally five or more, optionally seven genetic modifications selected from the following: a) expression of a first heterologous NADPH-generating enzyme that converts glyceraldehyde 3-phosphate to 1,3-diphosphoglycerate or a downstream precursor in the metabolite pathway; b) Convert NADH into NAD + Expression of heterologous enzymes; c) expression of a heterologous enzyme in the metabolite pathway with reduced or eliminated NADH-consuming side activities compared to the corresponding pathway enzyme native to the host cell; d) expression of a heterologous enzyme that converts a byproduct of an enzyme in the metabolite pathway into a substrate for an enzyme in the metabolite pathway that consumes NADH or NADPH; e) overexpression of native enzymes that convert byproducts of enzymes in the metabolite pathway into substrates for NADH- or NADPH-consuming metabolite pathway enzymes; f) expression of a second heterologous NADPH generating enzyme that is not included in the metabolite pathway; and / or g) Overexpression of a native NADPH generating enzyme that is not involved in the metabolite pathway.
4. The host cell of claim 3, wherein the genetic modification comprises expression of a first heterologous NADPH-generating enzyme that produces a precursor to the metabolite pathway.
5. The host cell of claim 4, wherein the genetic modification comprises: a) expression of the first heterologous NADPH-generating enzyme to convert glyceraldehyde 3-phosphate to 1,3-bisphosphoglycerate or a downstream precursor in the metabolite pathway; and b) expression of the heterologous metabolite pathway enzyme with reduced or eliminated NADH-consuming side activities compared to the corresponding metabolite pathway enzyme native to the host cell.
6. The host cell of claim 5, wherein the genetic modification comprises: a) expression of the first heterologous NADPH-generating enzyme to convert glyceraldehyde 3-phosphate to 1,3-bisphosphoglycerate or a downstream precursor in the metabolite pathway; b) expression of the heterologous metabolite pathway enzyme with reduced or eliminated NADH-consuming side activity compared to the corresponding metabolite pathway enzyme native to the host cell; and c) Convert NADH into NAD + Expression of heterologous enzymes.
7. The host cell of claim 6, wherein the genetic modification comprises: a) expression of the first heterologous NADPH-generating enzyme to convert glyceraldehyde 3-phosphate to 1,3-bisphosphoglycerate or a downstream precursor in the metabolite pathway; b) expression of the heterologous metabolite pathway enzyme with reduced or eliminated NADH-consuming side activity compared to the corresponding metabolite pathway enzyme native to the host cell; c) Convert NADH into NAD + expression of heterologous enzymes; and d) Expression of heterologous enzymes and / or overexpression of native enzymes to convert byproducts of enzymes in the metabolite pathway into substrates for the metabolite pathway enzymes that consume NADH or NADPH.
8. The host cell of claim 7, wherein the genetic modification comprises: a) expression of the first heterologous NADPH-generating enzyme to convert glyceraldehyde 3-phosphate to 1,3-bisphosphoglycerate or a downstream precursor in a metabolite pathway; b) expression of the heterologous metabolite pathway enzyme with reduced or eliminated NADH-consuming side activity compared to the corresponding metabolite pathway enzyme native to the host cell; c) Convert NADH into NAD + Expression of heterologous enzymes; d) expression of heterologous enzymes and / or overexpression of native enzymes that convert byproducts of enzymes in a metabolite pathway into substrates for NADH- or NADPH-consuming metabolite pathway enzymes; and e) Expression of a second heterologous NADPH generating enzyme and / or overexpression of a native NADPH generating enzyme, neither of which is involved in the metabolite pathway.
9. The host cell according to any one of claims 3 to 8, wherein: a) partially or completely replacing the host cell's native NADH-generating enzyme with the first heterologous NADPH-generating enzyme that converts glyceraldehyde 3-phosphate into 1,3-diphosphoglycerate or a downstream precursor in a metabolite pathway; b) partially or completely replacing the host cell native enzyme with a heterologous metabolite pathway enzyme having reduced or eliminated NADH-consuming side activity; c) partially or completely replacing a native enzyme that converts a byproduct of an enzyme in a metabolite pathway into a substrate for an enzyme in a metabolite pathway that consumes NADH or NADPH with a heterologous enzyme that converts a byproduct of an enzyme in a metabolite pathway into a substrate for an enzyme in a metabolite pathway that consumes NADH or NADPH; and / or d) A second heterologous enzyme that produces NADPH partially or completely replaces a native NADPH-producing enzyme that is not included in the metabolite pathway.
10. The host cell according to claim 9, wherein: a) The first heterologous NADPH-generating enzyme that converts glyceraldehyde 3-phosphate to 1,3-bisphosphoglycerate or a downstream precursor in a metabolite pathway is bisphosphoglycerate synthase or glyceraldehyde-3-phosphate dehydrogenase (GAPDH), both of which convert glyceraldehyde 3-phosphate to 1,3-bisphosphoglycerate; + Total conversion to NADPH; b) Convert NADH into NAD + The heterologous enzyme is NADH oxidase (Nox); c) the metabolite pathway enzyme with a reduced or eliminated NADH-consuming side activity is 3-phosphoglycerate dehydrogenase (PGDH), and the side activity is the conversion of α-ketoglutarate (α-KGA) to α-hydroxyglutarate (α-HGA); d) the enzyme that converts a byproduct of an enzyme in a metabolite pathway into a substrate of the metabolite pathway is glutamate dehydrogenase (GDH), the byproduct is α-ketoglutarate, and the substrate is glutamate; and / or e) The second heterologous or native NADPH generating enzyme not included in the metabolite pathway is glucose-6-phosphate dehydrogenase and / or 6-phosphogluconolactonase.
11. The host cell of claim 10, wherein the heterologous enzyme is (i) an enzyme from a species different from the host cell, (ii) a mutant enzyme from a species different from the host cell, and / or (iii) a mutant enzyme native to the host cell.
12. The host cell according to claims 10 to 11, comprising heterologous PGDH.
13. The host cell of claim 12, wherein the heterologous PGDH is overexpressed compared to a native PGDH having a side activity of converting α-ketoglutarate (α-KGA) to α-hydroxyglutarate. The host cell according to claim 13 , wherein the heterologous PGDH is overexpressed by 10 to 10.000% compared to native PGDH.
15. The host cell according to claim 12 to 14, wherein the heterologous PGDH comprises a conserved region towards the active site comprising the motif G / A X AGV, the underlined X It is a cationic residue located at position 129 corresponding to PGDH from Mycobacterium tuberculosis (SEQ ID NO: 10).
16. The host cell of claim 12, wherein the underlined X Selected from arginine, leucine or histidine.
17. The host cell of claim 12, wherein the underlined X It's arginine.
18. The host cell according to claims 12 to 15, wherein the heterologous PGDH comprises a conserved region facing the active site and does not comprise the motif G C FCI, wherein the underlined cysteine is at position 129 of PGDH corresponding to PGDH from Mycobacterium tuberculosis (SEQ. ID NO: 10).
19. The host cell of claims 12 to 18, wherein the heterologous PGDH is a mutant PGDH, optionally native to the host cell, modified to reduce or eliminate the NADH-consuming side activity compared to the unmodified PGDH.
20. The host cell of claims 12 to 19, wherein the heterologous PGDH is a type I or type III PGDH, optionally a microbial type I or type III PGDH.
21. The host cell of claims 12 to 20, wherein the heterologous PGDH enzyme is a serA enzyme.
22. The host cell according to any one of claims 10 to 21, wherein: a) the GAPDH enzyme comprises a polypeptide having at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identity to the GAP comprised in any one of SEQ ID NOs: 23 to 46, optionally SEQ ID NOs: 38 to 46; b) said Nox comprises a polypeptide having at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identity to the Nox comprised in any one of SEQ ID NOs: 49 to 56; c) the PGDH comprises a polypeptide having at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identity to the PGDH comprised in any one of SEQ ID NOs: 1 to 22; d) the GDH comprises a polypeptide having at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identity to the GDH comprised in any one of SEQ ID NOs: 57 to 66; e) the glucose-6-phosphate dehydrogenase comprises a polypeptide that is at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identical to the glucose-6-phosphate dehydrogenase comprised in SEQ ID NO: 47; and / or f) the 6-phosphogluconolactonase comprises a polypeptide having at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identity to the 6-phosphogluconolactonase comprised in SEQ ID NO:
48.
23. A host cell according to claim 22, comprising a PGDH comprising a polypeptide having at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identity with the PGDH comprised in any one of SEQ ID NOs: 6 to 22.
24. A host cell according to claim 23, wherein the PGDH comprises a polypeptide that is at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identical to the PGDH comprised in any one of SEQ ID NOs: 6 to 15.
25. A host cell according to claim 23, wherein the PGDH comprises a polypeptide that is at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identical to the PGDH contained in SEQ ID NO: 14 or 19 to 21.
26. The host cell of claims 22 to 25, wherein the host cell further comprises GAPDH comprising a polypeptide that is at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identical to the GAPDH comprised in any one of SEQ ID NOs: 38 to 46.
27. The host cell of claim 26, wherein the GAPDH comprises a polypeptide that is at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identical to the GAPDH comprised in SEQ ID NO:
43. The host cell according to claims 22 to 27, comprising: PGDH, PGDH comprising a polypeptide having at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identity to the PGDH comprised in any one of SEQ ID NOs: 14 or 19 to 21; 1 / 2 and GAPDH, GAPDH comprises a polypeptide having at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identity to the GAPDH comprised in SEQ ID NO:
43.
28. The host cell of any one of the preceding claims, further expressing one or more metabolite pathway enzymes selected from the group consisting of: a) phosphoserine aminotransferase (PSAT) that converts 3-phosphohydroxypyruvate to phosphoserine; and b) Phosphoserine phosphatase (PSPH) that converts phosphoserine to L-serine.
29. The host cell of claim 28, wherein: a) the PSAT is serC and comprises a polypeptide having at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identity to the serC comprised in SEQ ID NO: 117; and b) the PSPH is serB and comprises a polypeptide having at least 20%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identity to the serB comprised in SEQ ID NO:
118.
30. The host cell of any preceding claim, further comprising at least one transporter molecule that facilitates transport of a metabolite or any precursor thereof.
31. The host cell of any preceding claim, wherein one or more native or endogenous genes of the cell are attenuated, disrupted and / or deleted.
32. The host cell of claim 31 , wherein the native gene encodes NADH-dependent GAPDH or α-HGA-producing PHDH.
33. The host cell of any preceding claim, further comprising at least two copies of one or more polynucleotides encoding one or more metabolite pathway enzymes.
34. The host cell of any preceding claim, further genetically modified to provide increased amounts of substrate for one or more metabolite pathway enzymes.
35. The host cell of any one of the preceding claims, further genetically modified to exhibit increased tolerance to one or more substrate, intermediate, or product molecules from the metabolite pathway.
36. A host cell according to any one of the preceding claims, wherein the host cell is a prokaryotic cell, optionally a bacterium.
37. The host cell of claim 36, wherein the prokaryotic cell is of the genus Pseudomonas, optionally of the class Gammaproteobacteria, optionally of the family Enterobacteriaceae, optionally of the genus Escherichia, optionally of the species Escherichia coli.
38. The host cell of claim 36, wherein the prokaryotic cell is of the phylum Actinomycetes, optionally of the class Actinomycetes, optionally of the family Corynebacterium, optionally of the genus Corynebacterium, optionally of the species Corynebacterium glutamicum.
39. The host cell of claim 36, which has been further modified to have increased expression of a polypeptide having D-3-phosphoglycerate dehydrogenase activity and decreased production of alpha-hydroxyglutarate (α-HGA) compared to an otherwise identical bacterium not carrying the modification.
40. The host cell of claim 39, wherein the alpha-hydroxyglutarate production is decreased by increasing the cytoplasmic NADPH pool and / or decreasing the cytoplasmic NADH pool compared to an otherwise identical bacterium not carrying the modification.
41. The host cell of any one of claims 39 to 40, expressing a polypeptide having D-3-phosphoglycerate dehydrogenase activity and selected from the group consisting of SEQ ID NOs: 1 to 22, and a polypeptide comprising an amino acid sequence having at least about 70%, such as at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of SEQ ID NOs: 1 to 22.
42. The host cell of claim 41 , expressing a polypeptide having D-3-phosphoglycerate dehydrogenase activity and selected from the group consisting of SEQ ID NOs: 6 to 15, and a polypeptide comprising an amino acid sequence having at least about 70%, such as at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of SEQ ID NOs: 6 to 15.
43. The bacterium according to claims 39 to 42, wherein the reduced growth and redox imbalance caused when using D-3-phosphoglycerate dehydrogenase activity with reduced or no HGA production activity is resolved by increasing the cytoplasmic NADPH pool and / or reducing the cytoplasmic NADH pool.
44. The host cell of any one of claims 39 to 43, expressing an NADPH-dependent polypeptide having glyceraldehyde-3-phosphate dehydrogenase activity, with or without additional ATP production, selected from the group consisting of SEQ ID NOs: 38 to 46, and polypeptides comprising an amino acid sequence having at least about 70%, such as at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 38 to 46.
45. The host cell of claims 39 to 44, expressing a heterologous polypeptide having NADH oxidase (Nox) activity to reduce intracellular NADH pools.
46. The host cell of claim 45, wherein the heterologous polypeptide having NADH oxidase (Nox) activity is selected from the group consisting of SEQ ID NOs: 49 to 56, and polypeptides comprising an amino acid sequence having at least about 70%, such as at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence of any one of SEQ ID NOs: 49 to 56.
47. The host cell of any one of claims 39 to 46, which has been modified to have reduced expression and / or activity of an endogenous NADH-dependent polypeptide having glyceraldehyde-3-phosphate dehydrogenase activity compared to an otherwise identical bacterium not carrying the modification.
48. The bacterium of claim 47, wherein an endogenous gene encoding the endogenous NADH-dependent polypeptide having glyceraldehyde-3-phosphate dehydrogenase activity is inactivated.
49. The bacterium of claim 48, wherein the polypeptide having D-3-phosphoglycerate dehydrogenase activity is selected from the group consisting of SEQ ID NOs: 16 to 22, and polypeptides comprising an amino acid sequence having at least about 70%, such as at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence of any one of SEQ ID NOs: 16 to 22.
50. The bacterium according to any one of claims 39 to 49, wherein the bacterium belongs to the genus Escherichia or Corynebacterium.
51. A cell culture comprising the host cell of any preceding claim and a growth medium.
52. A method for producing a metabolite from 3-phosphoglycerate, comprising: a) cultivating the cell culture of claim 51 under conditions that allow the host cells to produce metabolites; and b) optionally recovering and / or isolating the metabolites.
53. The method of claim 52, wherein the metabolite is L-serine or a derivative thereof.
54. The method of claim 52, wherein the recovery and / or separation step comprises separating the liquid phase of the cells or cell culture from the solid phase of the cells or cell culture to obtain a supernatant containing the metabolites, and subjecting the supernatant to one or more steps selected from the group consisting of: a) disrupting cells of the cell culture to release intracellular metabolites into the supernatant; b) separating the supernatant from the solid phase of the cell culture, for example by filtration or gravity separation; c) contacting the supernatant with one or more adsorption resins in order to obtain at least a portion of the produced metabolites; d) contacting the supernatant with one or more ion exchange or reverse phase chromatography columns to obtain at least a portion of the metabolites; and e) crystallizing or extracting the metabolite from the supernatant; and f) evaporating the solvent of the supernatant to concentrate or precipitate the metabolites; The metabolites are thereby recovered and / or isolated.
55. The method according to claims 52 to 54, further comprising one or more elements selected from the group consisting of: a) cultivating the cell culture in a nutrient medium; b) cultivating the cell culture under aerobic or anaerobic conditions; c) cultivating the cell culture under agitation; d) cultivating the cell culture at a temperature of 25 to 50° C.; e) culturing the cell culture at a pH of 3-9; and f) culturing the cell culture for 10 hours to 30 days.
56. The method of any one of claims 52 to 55, wherein one or more steps of producing the metabolite are performed in vitro.
57. The method of any one of claims 52 to 56, comprising feeding the cell culture with one or more metabolite precursors.
58. A fermentation composition comprising metabolites of the cell culture of claim 51 and metabolites from 3-phosphoglycerate, wherein at least 20% by weight of the carbon is biobased.
59. The fermented composition of claim 58, further comprising one or more compounds selected from the group consisting of trace metals, vitamins, salts, yeast nitrogen base, carbon source, YNB and / or amino acids of the fermentation; wherein the concentration of the metabolites is at least 1 mg / kg of the composition.
60. The fermented composition of any one of claims 58 to 59, being substantially free of α-HGA.
61. The fermentation composition of any one of claims 58 to 60, further comprising one or more carriers, agents, additives and / or excipients.
Citation Information
Patent Citations
Process for the purification of benzaldehyde
CA1132612A
Crossbar slide selector switch with a current conducting means
CA777877A
Construction method and application of corynebacterium glutamicum SYPS-062 resistant to feedback inhibition on L-serine
CN103436504A
Method for the production of l-serine using genetically engineered microorganisms deficient in serine degradation pathways
WO2016120326A1