Exosome and application thereof

Abstract

The invention relates to an exosome and application thereof, and belongs to the technical field of tumor immunotherapy. According to the scheme, the repolarization effect of exosomes secreted after oral squamous cell carcinoma cells are stimulated by phenformin on M2 macrophages is researched, miRNA-17 and / or miRNA-20 capable of acting on STAT3 mRNA in the M2 macrophages are / is found, and it is found through further research that miRNA-17 and / or miRNA-20 can act on 3 '-UTR areas of STAT3 mRNA in the M2 macrophages, so that repolarization of the M2 macrophages is promoted. According to the application, deep research is carried out from the perspective of the action pathway of miRNA, and a brand new technical route which is feasible for tumor immunotherapy is provided through experimental verification of different levels, so that the application has a wide clinical application prospect and a huge commercial value.

Description

Technical Field

[0001] The present application relates to exosomes and applications thereof, belonging to the technical field of tumor immunotherapy. Background Art

[0002] Although the primary function of immune cells (including macrophages) is to fight cancer cells, they often exhibit distinct dichotomous behaviors within the tumor microenvironment. For example, M1-like macrophages have pro-inflammatory and anti-tumor effects, while M2-like macrophages have anti-inflammatory and pro-tumor effects. However, macrophages exhibit continuous plasticity in response to microenvironmental signals between the M1 and M2 subtypes. Studies have shown that tumor-associated macrophages (TAMs), which are abundant in the solid tumor microenvironment, are usually M2-polarized, and M2-polarized macrophages are associated with poor prognosis in various cancers.

[0003] Macrophage polarization is dynamic and can occur at any time during inflammation, depending on how long it takes for inflammation to resolve. Macrophage polarization is controlled by a complex interplay of the tissue microenvironment, macrophage-intrinsic epigenetic regulation, and external factors.

[0004] The crosstalk between tumor cells and tumor-associated macrophages is an extremely complex process. The secretion and delivery of exosomes from tumor cells to polarize tumor-associated macrophages is an effective and sophisticated method for maintaining an immunosuppressive microenvironment. Furthermore, macrophages polarized by tumor exosomes can subsequently release exosomes that further maintain the TME and promote tumor cell growth. Macrophages are not only reshaped to promote tumor immune evasion within the TME but are also transformed into tumor-propagating tools through the release of tumor-promoting exosomes.

[0005] Tumor cells trigger macrophage polarization through exosomes. Based on different molecular characteristics and compositions, exosomes can stimulate TAMs to switch from an M1-like phenotype to an M2-like phenotype, and vice versa, by delivering miRNAs. Exosomal miRNAs from tumor cells can target multiple signaling pathways and play an important role in macrophage polarization, among which the JAK / STAT pathway plays a key role.

[0006] The signal transducer and activator of transcription (STAT) family includes seven members: STAT1, STAT2, STAT3, STAT4, STAT5a, STAT5b, and STAT6. STAT proteins play important roles in cell proliferation, apoptosis, and immune regulation. Abnormal STAT expression has been associated with a variety of cancers, including breast, ovarian, lung, colorectal, prostate, and leukemia. STAT3, among others, promotes tumor growth and immune evasion, fostering an immunosuppressive TME and playing a crucial role in tumor development and progression. STAT activity is primarily activated by the JAK / STAT pathway, and SOCS proteins can directly bind to JAKs and inactivate their kinase activity.

[0007] Several studies have shown that exosomal miRNAs regulate macrophage polarization by targeting the JAK / STAT pathway. Ying et al. demonstrated that macrophages can take up tumor-derived exosomes and upregulate STAT3 through exosomal miR-222-3p, thereby mediating macrophage M2 polarization and promoting tumor development. Exosomal miRNAs derived from EOC cells in ovarian cancer: miR-21-3p, miR-125b-5p, and miR-181D-5p may promote macrophage polarization toward a tumor-promoting phenotype by regulating the SOCS4 / 5 / STAT3 pathway. Colorectal cancer (CRC) exosomes enriched in miR-203 can promote the polarization of monocytes into M2 macrophages and stimulate CRC cell metastasis. Exosomes from SCC9 and CAL27 cells were co-cultured with macrophages, leading to increased expression of miR-29a-3p in macrophages. MiR-29a-3p targeted SOCS1 to inhibit its expression, resulting in increased expression of p-STAT6 and ultimately leading to M2 polarization of macrophages.

[0008] Therefore, the repolarization of M2 macrophages, as the reverse process of M2 macrophage polarization, is an important research hotspot in tumor prevention and treatment. Summary of the Invention

[0009] To address the above-mentioned problems, the present invention provides exosomes and their applications. The present invention begins with a study of the repolarization effect of exosomes obtained by stimulating oral squamous cell carcinoma cells with phenformin on M2 macrophages. The present invention identifies miRNA-17 and / or miRNA-20 that can act on STAT3 mRNA in M2 macrophages and finds that they can promote the repolarization of M2 macrophages. The findings are verified through experiments at different levels, ultimately providing a novel and feasible technical route for tumor immunotherapy. It is foreseeable that the present application scheme has broad clinical application prospects and huge commercial value.

[0010] The present application provides a pharmaceutical composition that promotes repolarization of M2 macrophages, wherein the pharmaceutical composition comprises miRNA-17 and / or miRNA-20 that can act on STAT3 mRNA in M2 macrophages.

[0011] The specific sequence information for miRNA-17 and / or miRNA-20 can be found at NCBI or directly determined by sequence analysis. For example, the source of information for human miRNA-17 is the following link: https: / / www.ncbi.nlm.nih.gov / gene / 406952.

[0012] It should be noted that those skilled in the art can also chemically modify miRNA-17 and / or miRNA-20, or add other functional sequences, or remove non-critical amino acid sites, or replace non-critical amino acid sites, or insert amino acid fragments therein, or adopt other means, as long as they can act on the 3'-UTR region of STAT3 mRNA in M2 macrophages and promote the repolarization of M2 macrophages.

[0013] Optionally, the miRNA-17 and / or miRNA-20 acts on the 3'-UTR region of STAT3 mRNA in M2 macrophages; Optionally, the miRNA-17 and / or miRNA-20 can inhibit the expression of STAT3 protein.

[0014] Optionally, the miRNA-17 and / or miRNA-20 is located in immunomodulatory exosomes.

[0015] Optionally, the immunomodulatory exosomes are obtained by secretion after stimulating cells with biguanide drugs.

[0016] Those skilled in the art can extract and enrich miRNA-17 and / or miRNA-20 based on the exosomes obtained by cell secretion, or directly use the exosomes to prepare pharmaceutical compositions; they can also synthesize the sequences of miRNA-17 and / or miRNA-20 by artificial synthesis methods and then prepare pharmaceutical compositions.

[0017] Optionally, the biguanide drug is one or more of phenformin, metformin, and buformin. Those skilled in the art may also select other biguanide drugs for stimulation.

[0018] In addition, with respect to the selection of cells, those skilled in the art can determine the cells that can be used as needed or through simple experiments, for example, commercial cells commonly used in the prior art for producing exosomes, or cell lines collected, digested, and cultured by themselves, as long as the same technical effect of obtaining the desired exosomes can be achieved. For example, mesenchymal stem cells with good exosome secretion ability that are currently widely used in the prior art can also be used. Tumor cell lines obtained by digesting and culturing tumors removed during surgery can also be used.

[0019] As for the source of cells, animal cells are preferred, mammalian cells are more preferred, and human cells are even more preferred. Regarding the selection of cells, those skilled in the art can determine their exosome secretion capacity and the ability of the processed exosomes to produce miRNA-17 and / or miRNA-20 through common sense judgment and simple experiments. Those skilled in the art can also genetically modify the cells to enhance their exosome secretion capacity or enhance the secretory expression of miRNA-17 and / or miRNA-20. Those skilled in the art can also optimize culture conditions for cells of different origins.

[0020] The present application provides an immunoregulatory exosome that promotes M2 macrophage repolarization, wherein the exosome carries miRNA-17 and / or miRNA-20 that can act on STAT3 mRNA in M2 macrophages.

[0021] Optionally, the miRNA-17 and / or miRNA-20 acts on the 3'-UTR region of STAT3 mRNA in M2 macrophages; Optionally, the miRNA-17 and / or miRNA-20 can inhibit the expression of STAT3 protein.

[0022] Optionally, the exosomes are obtained by secretion after stimulating cells with biguanide drugs.

[0023] The present application provides the use of the above-mentioned immunoregulatory exosomes that promote M2 macrophage repolarization or miRNA-17 and / or miRNA-20 that can act on STAT3 mRNA in M2 macrophages in the preparation of anti-tumor drugs.

[0024] Optionally, the anti-tumor drug can promote the repolarization of M2 macrophages.

[0025] The present application provides a method for preparing a pharmaceutical composition for promoting M2 macrophage repolarization, the preparation method comprising the steps of stimulating cells with biguanide drugs and then collecting secreted exosomes.

[0026] Optionally, the exosomes carry miRNA-17 and / or miRNA-20 that can act on STAT3 mRNA in M2 macrophages.

[0027] Based on the disclosure of the present application, those skilled in the art can also develop other drugs such as nucleotide sequences for inhibiting the expression of STAT3 protein, targeting M2 macrophages and inhibiting their STAT3 protein expression, which can also achieve repolarization of M2 macrophages and be applied to anti-tumor drugs.

[0028] The beneficial effects of this application include but are not limited to: 1. According to the exosomes and their applications of the present application, the present application scheme can avoid the risk of lactic acidosis caused by direct administration of phenformin. Instead, it utilizes miRNA-17 and / or miRNA-20, or exosomes containing miRNA-17 and / or miRNA-20, to act on M2 macrophages, promoting their repolarization and thus achieving an anti-tumor effect. This scheme has the advantages of strong targeting and high safety.

[0029] 2. Based on the exosomes and their applications disclosed herein, this application reports for the first time the effects of miRNA-17 and / or miRNA-20 on the repolarization of M2 macrophages and their pathways of action. This is of great significance for the advancement of M2 macrophage repolarization and demonstrates their great potential in the development of anti-tumor drugs.

[0030] 3. Based on the exosomes and their applications disclosed herein, this application also provides a simple, convenient, and easy-to-operate process for preparing exosomes containing miRNA-17 and / or miRNA-20. Furthermore, exosome-based drugs are a current research hotspot and are in line with current trends in pharmaceutical research. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The drawings described herein are used to provide a further understanding of the present application and constitute a part of the present application. The illustrative embodiments of the present application and their descriptions are used to explain the present application and do not constitute an improper limitation on the present application. In the drawings: Figure 1 This is a graph showing the proliferation results of CAL27, SCC-9, SCC-4, and SCC-28 detected by the CCK8 experiment involved in Example 1 of the present application; Figure 2 Figure 1 shows the results of the EdU staining experiment involved in Example 1 of the present application showing that phenformin inhibits OSCC proliferation (a: EdU staining to detect CAL27 cell proliferation, b: EdU positive data statistics, c: EdU staining to detect SCC-9 cell proliferation, d: EdU positive data statistics); Figure 3Figure 1 shows the anti-tumor effect of phenformin in vivo in a nude mouse subcutaneous tumor formation experiment in Example 1 of this application (a: tumor tissue image, b: tumor tissue weight statistics); Figure 4 This is a diagram showing the results of a subcutaneous tumor formation experiment in nude mice in Example 2 of the present application; Figure 5 This is a diagram showing the enrichment analysis results of target gene pathways predicted by miRNAs involved in Example 3 of this application; Figure 6 The exosomes produced by oral squamous cell carcinoma cells stimulated by phenformin as described in Example 3 of the present application can mediate M2 macrophage repolarization (a: PBMCs M2 polarization-related gene expression results, b: THP1 M2 polarization-related gene expression results); Figure 7 This is a diagram showing abnormal results of the JAT-STAT signaling pathway in the KEEG pathway analysis of miRNAs predicted target genes involved in Example 4 of the present application; Figure 8 These are the verification results of exosomal miR-17 / 20 targeting STAT3 involved in Example 4 of the present application (a: qPCR detection of exosomal miRNAs expression, b, c and d: Western Blot detection of miR17 / 20 targeting STAT3, e and f: luciferase experiment verification that miR17 / 20 targets 3'-UTR of STAT3 mRNA). DETAILED DESCRIPTION

[0032] The present application is described in detail below with reference to examples, but the present application is not limited to these examples. Unless otherwise specified, the raw materials and reagents in the examples of the present application are purchased through commercial channels.

[0033] In previous research (Phenformin suppresses angiogenesis through the regulation of exosomal microRNA-1246 and microRNA-205 levels derived from oral squamous cell carcinoma cells, Front. Oncol., 08 September 2022, Sec. Head and Neck Cancer, Volume 12 - 2022 | https: / / doi.org / 10.3389 / fonc.2022.943477), the inventors investigated the role of phenformin, a phenformin with broad anti-tumor effects, in oral squamous cell carcinoma. They found that exosomes derived from phenformin-treated OSCC (Phen-Exo) inhibited the proliferation, migration, and angiogenesis of human umbilical vein endothelial cells (HUVEC) in vitro. The inhibitory effect of Phen-Exo on angiogenesis was validated in vivo using Matrigel angiogenesis assays and chick embryo chorioallantoic membrane assays.

[0034] In previous mechanistic studies, it was found that after OSCC was treated with phenformin, miR-1246 and miR-205 were sorted into exosomes. After the exosomes fused with vascular endothelial cells, miR-1246 / 205 inhibited their angiogenesis by acting on VEGFA.

[0035] Based on the previous research, the inventors continued to conduct in-depth research on OSCC exosomes treated with phenformin. It should be noted that the preparation method of exosomes has been disclosed in the previous research paper. The specific method of using phenformin to stimulate oral squamous cell carcinoma cells to secrete exosomes will not be repeated in this application. Those skilled in the art can refer to the previous paper for preparation. The specific research content of this application on M2 macrophage repolarization is described below through specific examples.

[0036] Example 1 Phenformin inhibits OSCC proliferation and tumor growth in vivo Different concentrations of phenformin were used to treat various OSCC cells. After 48 hours, the cells were collected for CCK8 assay. It was found that phenformin had a significant inhibitory effect on the proliferation of OSCC (CAL27 and SCC-9), and this trend was significantly dose-dependent. The results are as follows: Figure 1 As shown in the results, the CCK8 assay showed that phenformin inhibited OSCC proliferation. Furthermore, EdU staining was performed, and EdU staining visually confirmed this conclusion. The results are shown in the figure below. Figure 2The above results all indicate that phenformin has the ability to inhibit OSCC proliferation; Finally, in order to study the effect of phenformin on OSCC tumorigenesis in vivo, a nude mouse subcutaneous tumorigenesis experiment was conducted, and the results are shown as follows: Figure 3 As shown in the results, the nude mouse subcutaneous tumor formation experiment also verified the anti-tumor effect of phenformin in vivo, and it was found that the inhibitory effect was dose-dependent.

[0037] Example 2 In vivo antitumor effect of exosomes secreted after phenformin treatment of OSCC Although the above experiments have confirmed the anti-tumor effect of phenformin, direct administration of phenformin may cause lactic acidosis and is therefore prohibited from clinical use.

[0038] In previous research, the inventors discovered that exosomes secreted by phenformin after OSCC treatment can inhibit angiogenesis, which is crucial for tumor development and progression. However, because tumor development and progression involve multiple factors, whether exosomes secreted by phenformin after OSCC treatment can inhibit tumors and thus avoid the side effects of direct phenformin administration still requires verification and experimental confirmation. For example, in addition to blood vessels, various immune cells play an important role in the tumor microenvironment, so the inventors continued to study from an immune perspective.

[0039] To further verify the role of exosomes secreted by phenformin after OSCC treatment, the inventors conducted a nude mouse subcutaneous tumor formation experiment to further analyze the effect of exosomes secreted by phenformin after OSCC treatment on tumor growth. A total of 42 4-week-old female BALB / C nude mice were used in the experiment. 8×10 4 Cal27 cells were suspended in 200 μl phosphate buffered saline (PBS) and injected subcutaneously into the left flank of each nude mouse to establish a xenogeneic oral squamous cell carcinoma (OSSC) transplantation model. The long and short diameters of the tumor were measured using an electronic vernier caliper every three days to monitor tumor growth, and the tumor volume was calculated as 0.5×long diameter×short diameter². When the tumor volume reached 20 mm³, the nude mice were randomly divided into an exosome treatment group (Phen-Exo) (30 μg of exosomes were suspended in 50 μl PBS) and a PBS control group (PBS-Exo). A microsyringe with a 30-gauge needle was used to perform multiple intratumoral injections near the base of the tumor, once every three days, for a total of four injections. Three days after the last injection, the tumor tissue was collected, the tumor was separated, and photographed. The results are shown in Figure 2. Figure 4 shown.

[0040] according to Figure 4The results showed that Phen-Exo significantly inhibited tumor growth in the nude mouse subcutaneous tumor formation experiment. The exosomes secreted after OSCC significantly inhibited the subcutaneous tumor formation of humanized hPBMC-NCG mice, which indicates that the exosomes secreted after OSCC treatment with phenformin can exert anti-tumor effects through tumor-associated immune cells.

[0041] Example 3: Exosomes secreted by OSCC after phenformin treatment repolarize M2 macrophages Exosomes, as important signaling factors mediating intercellular communication, carry signaling molecules such as proteins, mRNAs, and miRNAs from parent cells and deliver them to target cells to exert their biological functions. Studies have shown that mature miRNAs account for as much as 41.7% of the RNA contained in exosomes. They regulate protein synthesis by binding to the 3′ untranslated regions of target genes and are widely involved in regulating biological processes such as cell proliferation, migration, apoptosis, and differentiation. Therefore, miRNAs are considered key functional components of exosomes.

[0042] Experiments have shown that exosomes secreted by phenformin after OSCC treatment can exert anti-tumor effects by regulating tumor-associated immune cells. To further investigate the specific mechanisms, we used exosomal miRNA sequencing technology to analyze the types and expression levels of key exosomal miRNAs secreted by phenformin after OSCC treatment. We also explored the underlying molecular mechanisms through bioinformatics analysis and in vitro and in vivo experiments.

[0043] To investigate the expression profile of miRNAs in exosomes derived from oral squamous cell carcinoma (OSCC) cells treated with phenformin, exosomal miRNA sequencing (microRNA-seq) analysis was performed with three biological replicates per group. MiRNAs with a log2 (fold change) > 1 and a P < 0.05 were considered differentially expressed miRNAs (DEMs). Volcano plots and heat maps were constructed based on the differentially expressed miRNAs. The top 10 differentially expressed miRNAs with the highest up- and down-regulation in exosomes from the phenformin-treated group (Phen-Exo) were further analyzed for their predicted gene targets using the miRDB and TargetScan databases. Subsequently, pathway enrichment analysis (KEGG) was performed on these predicted targets to identify the top 10 most enriched pathways.

[0044] Through pathway enrichment analysis of target genes predicted by miRNAs, it was found that phagocytosis-related gene abnormalities suggested that the exosomes secreted after phenformin treatment of OSCC may act on cells with phagocytic function, such as Figure 5 As shown, macrophages with phagocytic function will be the focus of subsequent research.

[0045] Since most macrophages in the tumor microenvironment are M2, PBMCs were isolated from peripheral blood using human lymphocyte separation medium. After 24 hours of stimulation with IL-4 (20 ng / ml) + IL-10 (20 ng / ml) to induce macrophage M2 polarization, phenformin was added to stimulate oral squamous cell carcinoma cell exosomes. qPCR was used to detect the expression of M2 macrophage markers CD163, Arg1, IL-10, TGF-β, VEGFA and M1 macrophage markers IL-6, TNF-α, and IL-1β. The results are shown in the figure. Figure 6 shown.

[0046] The results showed that phenformin stimulated oral squamous cell carcinoma exosomes to mediate M2 macrophage repolarization ( Figure 6 a), and the same results were obtained in THP-1 cell line ( Figure 6 b).

[0047] Example 4: Exosomal miR-17 / 20 secreted after phenformin treatment of OSCC targets the JAT-STAT signaling pathway In order to investigate the mechanism by which exosomes secreted after phenformin treatment of OSCC repolarize M2 macrophages, the results of previous exosomal miRNAs sequencing were analyzed, and KEGG pathway analysis of target genes predicted by miRNAs revealed abnormalities in the JAT-STAT signaling pathway, such as Figure 7 As shown in the figure, miRBase TargetScan predicted that miR-17 / 20 enriched in exosomes secreted after phenformin treatment of OSCC targeted STAT3, a key protein in the JAT-STAT signaling pathway.

[0048] First, we verified the expression of exosomal miR-17 / 20. We reverse-transcribed the measured concentration of total cellular RNA using the All-in-one™ miRNA Detection Kit's reverse transcription instructions. A 10 µL reaction system was used. RNA was reverse-transcribed into cDNA using the following reverse transcription parameters: 37°C for 60 minutes, then 85°C for 5 minutes.

[0049] according to Figure 8 The results showed that the expression of miR-17 / 20 in Phen-exos (exosomes secreted by OSCC after phenformin treatment) was significantly increased compared with OSCC cells. Therefore, subsequent studies focused on the role of miR-17 / 20 in Phen-exos in repolarized M2 macrophages.

[0050] According to the prediction results of the signal pathway, it was found that miR-17 / 20 enriched in exosomes secreted after phenformin treatment of OSCC targeted STAT3, a key protein in the JAT-STAT signaling pathway. Therefore, the targeting of miR-17 / 20 to STAT3 was verified next.

[0051] Four groups were designed for the miR-17-5p functional validation experiment, namely, mimics miR-17-5p group (gain of function), inhibitor 17-5p (loss of function), mimics NC (negative control), and inhibitor NC (negative control).

[0052] mimics NC: UUGUACUACACAAAAGUACUG (Seq ID NO.1); Inhibitor NC: CAGUACUUUUGUGUAGUACAA (Seq ID NO.2); The sequence of mimics miR-17-5p is: CAAAGUGCUUACAGUGCAGGUAG (Seq ID NO. 3); The sequence of inhibitor 17-5p is UGACCUGCACUGUAAGCACUUUGA (Seq ID NO. 4); Four groups were designed for the miR-20-5p functional validation experiment, namely, mimics miR-20-5p group (gain of function), inhibitor-20-5p (loss of function), mimics NC (negative control), and inhibitor NC (negative control). mimics NC: UUGUACUACACAAAAGUACUG (Seq ID NO.1); Inhibitor NC: CAGUACUUUUGUGUAGUACAA (Seq ID NO.2); mimics miR-20-5p sequence: UAAAGUGCUCAUAGUGCAGGUAG (Seq ID NO.5); Inhibitor-20-5p sequence: CUACAAGUGCCUUCACUGCA (Seq ID NO. 6); It should be noted that in the attached sequence listing, due to the WIPO software format, all u in the RNA sequence are replaced by t.

[0053] PBMCs were isolated from peripheral blood using human lymphocyte separation medium. Macrophages were stimulated for 24 hours with IL-4 (20 ng / ml) and IL-10 (20 ng / ml) to induce M2 polarization. Transfection was performed when cells reached 60%-70% confluency. Transfection reagents were prepared by mixing 120 μl of DMEM with 12 μl of NC / inhibitor / mimic (labeled tube 1), and premixing 120 μl of DMEM with 7 μl of Lipofectamine 3000 transfection reagent (labeled tube 2). DMEM was added to the 6-well plate. Tube 1 was mixed for 10 minutes, then added to the designated wells along with the mixture in tube 2. 24 hours after transfection, the medium was changed, and cells were cultured as planned. Protein was then collected and analyzed for changes in downstream target genes.

[0054] The experimental results showed that protein immunoblotting results showed that miR-17 / 20 mimics could inhibit STAT3 protein expression, and the inhibitory effect was reversed by adding miR-17 / 20 inhibitor ( Figure 8 b, 8c), exosomes secreted after OSCC treatment with phenformin also inhibited the expression of STAT3 protein in macrophages ( Figure 8 d).

[0055] Luciferase assays further verified that miR-17 / 20 directly inhibits STAT3 mRNA transcription by targeting the 3'-UTR region. Luciferase reporter plasmids were constructed using outsourced synthesis. MiR-17 / 20 mimics, miR-17 / 20 mimic NC constructs, and reporter plasmids carrying mutant (MuT) or wild-type (WT) binding sites were co-transfected into 293T cells using Lipofectamine 3000 transfection reagent. The MuT group (mutated binding site) demonstrated ineffective binding, while the wild-type WT group, containing the wild-type binding site, demonstrated normal binding. Cells were lysed 24 hours after transfection and compared for luciferase activity between the MuT and WT groups. 48 hours after transfection, cells were gently washed three times with PBS, and an appropriate amount of 1× Lysis Buffer was added. The cells were shaken for 10–15 minutes to fully lyse. Prepare Rluc and Fluc working solutions according to the instructions in the Dual-Luciferase Assay Kit. Add 20 μl of the lysed supernatant to each well of a light-proof 96-well plate. Then, add 100 μL of the mixed Fluc working solution to the sample. Incubate at room temperature in the dark for 3–5 minutes. Measure the luciferase reaction intensity using a luciferase analyzer. Then, add 100 μL of the mixed Rluc working solution and incubate at room temperature in the dark for 3–5 minutes. Measure the luciferase reaction intensity using a luciferase analyzer, record, and analyze the data.

[0056] Figure 8 The results showed that the luciferase activity of the mimics 17-5p group was significantly lower than that of the inhibitor miR-17-5p group in the normal combination group. Figure 8 fThe results showed that the luciferase activity of the mimics-20-5p group in the normal binding group was significantly lower than that of the inhibitor miR-20-5p group. It can be seen that the miR-17 / 20 mimics synthetic fragment directly binds to the 3'-UTR region of STAT3 mRNA, affecting the stability of luciferase mRNA and the efficiency of enzyme protein translation, thereby affecting the transcription of STAT3 mRNA. The experimental results showed that the luciferase activity in the miR-17 / 20 mimics group was reduced, which suggests that miR-17 / 20 can directly act on the 3'-UTR region of STAT3 mRNA to inhibit the transcription of STAT3 mRNA ( Figure 8 e,8f).

[0057] The foregoing is merely an embodiment of the present application, and the scope of protection of the present application is not limited by these specific embodiments, but is determined by the claims of the present application. For those skilled in the art, the present application may have various modifications and variations. Any modifications, equivalent substitutions, improvements, etc. made within the technical ideas and principles of the present application should be included in the scope of protection of the present application.

Claims

1. A pharmaceutical composition for promoting M2 macrophage repolarization, characterized in that: The pharmaceutical composition comprises miRNA-17 and / or miRNA-20 that can act on STAT3 mRNA in M2 macrophages.

2. The pharmaceutical composition for promoting M2 macrophage repolarization according to claim 1, wherein The miRNA-17 and / or miRNA-20 acts on the 3'-UTR region of STAT3 mRNA in M2 macrophages; Optionally, the miRNA-17 and / or miRNA-20 can inhibit the expression of STAT3 protein.

3. The pharmaceutical composition for promoting M2 macrophage repolarization according to claim 1, characterized in that: The miRNA-17 and / or miRNA-20 are located in immunomodulatory exosomes; Optionally, the immunomodulatory exosomes are obtained by secretion after stimulating cells with biguanide drugs.

4. An immunomodulatory exosome that promotes M2 macrophage repolarization, characterized in that: The exosomes carry miRNA-17 and / or miRNA-20 that can act on STAT3 mRNA in M2 macrophages.

5. The immunomodulatory exosomes that promote M2 macrophage repolarization according to claim 4, characterized in that The miRNA-17 and / or miRNA-20 acts on the 3'-UTR region of STAT3 mRNA in M2 macrophages; Optionally, the miRNA-17 and / or miRNA-20 can inhibit the expression of STAT3 protein.

6. The immunomodulatory exosomes that promote M2 macrophage repolarization according to claim 4, characterized in that The exosomes are obtained by secretion after cells are stimulated by biguanide drugs.

7. Use of the immunomodulatory exosomes that promote M2 macrophage repolarization according to any one of claims 4 to 6, or miRNA-17 and / or miRNA-20 that can act on STAT3 mRNA in M2 macrophages, in the preparation of an anti-tumor drug.

8. The use according to claim 7, characterized in that The anti-tumor drug can promote the repolarization of M2 macrophages.

9. A method for preparing a pharmaceutical composition for promoting M2 macrophage repolarization, characterized in that: The preparation method comprises the steps of stimulating cells with biguanides and collecting secreted exosomes.

10. The method for preparing the pharmaceutical composition for promoting M2 macrophage repolarization according to claim 9, wherein: The exosomes carry miRNA-17 and / or miRNA-20 that can act on STAT3 mRNA in M2 macrophages.

Images