Application of non-receptor tyrosine kinase ABL1 as target spot in treatment or inhibition of Ebola virus
By inhibiting or knocking out the non-receptor tyrosine kinase ABL1 gene, using the ABL1 inhibitor or CRISPR/Cas9 system to regulate the phosphorylation site of Ebola virus NP protein, the problem of lack of effective targets in the prior art is solved, and effective inhibition and treatment of Ebola virus proliferation is achieved.
Patent Information
- Application Number
- CN202510775055.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-11
- Publication Date
- 2025-08-15
AI Technical Summary
No studies in the prior art have reported the interaction of the non-receptor tyrosine kinase ABL1 with the Ebola virus NP protein, resulting in the lack of effective targets for Ebola virus treatment.
By inhibiting or knocking out the expression of the non-receptor tyrosine kinase ABL1 gene, ABL1 inhibitors such as Asnib or CRISPR/Cas9 system are used to regulate the phosphorylation site of the Ebola virus NP protein and inhibit viral proliferation.
Effectively inhibiting Ebola virus proliferation, providing new targets for the treatment and prevention of Ebola virus disease, and expanding the application potential of ABL1-targeted drugs.
Smart Images
Figure CN120478644A_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the field of biomedicine technology, and in particular to the use of a non-receptor tyrosine kinase ABL1 as a target in the treatment or inhibition of Ebola virus. Background Art
[0002] Ebola virus (EBOV), a member of the Filoviridae family, is a highly contagious, single-stranded, negative-sense RNA virus. Infection with Ebola virus disease (EVD) causes the fatal disease, a serious threat to public health. Symptoms of EVD include fever, disseminated intravascular coagulation, bleeding disorders, and multiple organ failure, which can be fatal in severe cases. EBOV is transmitted through direct contact with infected body fluids and can infect multiple cell types, including macrophages, monocytes, dendritic cells, endothelial cells, and epithelial cells.
[0003] Viral particles have the typical thread-like appearance of filoviruses, measuring approximately 80 nanometers wide and averaging approximately 1 micron in length. The assembly of the viral nucleocapsid, a 50-nanometer-diameter double-helical structure, is crucial for viral replication and proliferation. It consists of the viral RNA encapsidated by the NP, VP35, VP24, VP30, and L proteins. The inner layer of the nucleocapsid is a helical NP-RNA complex, while the outer layer is a combination of VP35 and VP24. During assembly, viral RNA forms a ribonucleoprotein (RNP) complex with NP, L, VP30, and VP35 to form the nucleocapsid, which then accumulates within inclusion bodies (IBs). NP is the primary structural protein of the nucleocapsid and a fundamental component of its formation. Cells expressing NP alone can form inclusion-like structures, which serve as crucial sites for viral replication and proliferation.
[0004] During the virus proliferation process, certain proteins in the host cells can be recruited by interacting with viral structural proteins to assist in viral assembly and replication.
[0005] ABL1 is a non-receptor tyrosine kinase widely expressed in various tissues and cells throughout the human body. It is distributed in subcellular structures such as the nucleus, mitochondria, endoplasmic reticulum, lysosomes, endosomes, and the cytoskeleton. Under normal physiological conditions, it maintains a low activity state through autoinhibition. However, when stimulated by relevant signals, its activity is activated, causing phosphorylation and modification of substrate proteins, altering their activity, stability, or binding capacity.
[0006] Currently, no studies have reported the interaction between the non-receptor tyrosine kinase ABL1 and the Ebola virus NP protein, and no studies have been conducted to investigate the application of the non-receptor tyrosine kinase ABL1 as a target for Ebola virus treatment and related products. Summary of the Invention
[0007] The purpose of this application is to overcome the shortcomings of the above-mentioned prior art and provide a non-receptor tyrosine kinase ABL1 as a target for the treatment or inhibition of Ebola virus. The non-receptor tyrosine kinase ABL1 can interact with the Ebola virus NP protein and act as a target to inhibit viral intracellular proliferation.
[0008] To achieve the above objectives, the technical solutions adopted in this application are: The present application provides the use of a substance that inhibits the expression of the non-receptor tyrosine kinase ABL1 gene in the preparation of a product for treating, preventing or assisting in the treatment of Ebola virus disease.
[0009] Inhibiting the expression of the non-receptor tyrosine kinase ABL1 gene can treat or assist in the treatment of Ebola virus disease, inhibit Ebola virus infection, inhibit Ebola virus proliferation and prevent Ebola virus disease.
[0010] As a preferred embodiment of the application described in the present application, the substance that inhibits the expression of the non-receptor tyrosine kinase ABL1 gene includes at least one of aspartame, nilotinib and imatinib.
[0011] Highly effective inhibitors of the non-receptor tyrosine kinase ABL1, such as asciminib, nilotinib, and imatinib, can inhibit the proliferation of Ebola virus, thereby preventing or treating Ebola virus disease.
[0012] As a preferred embodiment of the application described in this application, the product for treating, preventing or assisting in the treatment of Ebola virus disease is a pharmaceutical preparation.
[0013] The mass concentration of the substance that inhibits the expression of the non-receptor tyrosine kinase ABL1 gene in the pharmaceutical preparation is 1 to 10 μM, preferably 10 μM.
[0014] The substance that inhibits the expression of the non-receptor tyrosine kinase ABL1 gene is asanib.
[0015] Using the above mass concentration of aspartame can better inhibit the proliferation of Ebola virus.
[0016] The present application also provides the use of a substance for knocking out the non-receptor tyrosine kinase ABL1 gene in the preparation of a product for treating, preventing or assisting in the treatment of Ebola virus disease.
[0017] Knockout of the non-receptor tyrosine kinase ABL1 gene in this application can treat or assist in the treatment of Ebola virus disease, inhibit Ebola virus infection, inhibit Ebola virus proliferation and prevent Ebola virus disease.
[0018] As a preferred embodiment of the application described in the present application, the material for knocking out the non-receptor tyrosine kinase ABL1 gene is a CRISPR / Cas9 gene editing system for knocking out the ABL1 gene.
[0019] Knocking out the non-receptor tyrosine kinase ABL1 gene can also significantly inhibit the proliferation of Ebola virus, indicating that ABL1 can be used as a candidate target for the development of anti-EBOV drugs and has important application value in the treatment of Ebola virus disease.
[0020] In summary, substances that inhibit the expression of the non-receptor tyrosine kinase ABL1 gene (ABL1 inhibitors, such as aspergillus) or knockout of the ABL1 gene can effectively inhibit viral proliferation. These results indicate that the non-receptor tyrosine kinase ABL1 gene participates in viral assembly / replication by regulating the Ebola virus NP protein, and ABL1 inhibitors can be used to inhibit viral proliferation. This application confirms that the non-receptor tyrosine kinase ABL1 gene can be used as a target for the treatment of Ebola virus disease, expands the new use of non-receptor tyrosine kinase ABL1 gene-targeted drugs, and demonstrates the potential of non-receptor tyrosine kinase ABL1 gene-targeted drugs for the prevention and treatment of Ebola virus infection.
[0021] As a preferred embodiment of the application described in the present application, the sgRNA target sequence in the CRISPR / Cas9 gene editing system for knocking out the non-receptor tyrosine kinase ABL1 gene is as follows: AAGTACTTGGGGACCAAAGAAGG (SEQ ID NO: 1).
[0022] As a preferred embodiment of the application described in the present application, the non-receptor tyrosine kinase ABL1 gene phosphorylates and modifies the Ebola virus NP protein.
[0023] The inventors of the present application discovered that the non-receptor tyrosine kinase ABL1 acts on the NP protein of the Ebola virus, interacts with it and phosphorylates the tyrosine phosphorylation site of the Ebola virus NP protein, thereby indicating that the non-receptor tyrosine kinase ABL1 can serve as an Ebola virus target and thereby inhibit the proliferation of the Ebola virus.
[0024] This application confirms that the non-receptor tyrosine kinase ABL1 can be used as a target for the treatment of Ebola virus disease, expands the new use of non-receptor tyrosine kinase ABL1 targeted drugs, and demonstrates the potential of non-receptor tyrosine kinase ABL1 targeted drugs for the prevention and treatment of Ebola virus infection.
[0025] As a preferred embodiment of the application described in the present application, the phosphorylation modification sites of the Ebola virus NP protein include at least one of tyrosine 98, tyrosine 187, tyrosine 293, tyrosine 357, tyrosine 611 and tyrosine 721.
[0026] The present application discovered that the non-receptor tyrosine kinase ABL1 interacts with the Ebola virus NP protein, and that the Ebola virus NP protein can be phosphorylated and modified by the non-receptor tyrosine kinase ABL1. Six phosphorylated tyrosine sites were identified, including tyrosine 98 (Y98), tyrosine 187 (Y187), tyrosine 293 (Y293), tyrosine 357 (Y357), tyrosine 611 (Y611) and tyrosine 721 (Y721), among which Y98 is the main phosphorylation site. ABL1 can cause the Ebola virus NP protein to undergo phosphorylation modification, thereby changing the activity, stability or binding ability of the substrate protein; the non-receptor tyrosine kinase ABL1 can interact with the Ebola virus NP protein and serve as a target, thereby inhibiting the intracellular proliferation of the virus.
[0027] Compared with the prior art, this application has the following beneficial effects: The present application provides the use of the non-receptor tyrosine kinase ABL1 as a target in the treatment or inhibition of Ebola virus. The present application discovered that the non-receptor tyrosine kinase ABL1 interacts with the NP protein of the Ebola virus, and further studies found that the non-receptor tyrosine kinase ABL1 phosphorylates and modifies the tyrosine phosphorylation sites of the Ebola virus NP protein (including tyrosine 98 (Y98), tyrosine 187 (Y187), tyrosine 293 (Y293), tyrosine 357 (Y357), tyrosine 611 (Y611) and tyrosine 721 (Y721), with Y98 being the main phosphorylation site); and the non-receptor tyrosine kinase ABL1 gene participates in viral assembly / replication by regulating the Ebola virus NP protein, and ABL1 inhibitors can be used to inhibit viral proliferation. This application confirms that the non-receptor tyrosine kinase ABL1 gene can be used as a target for the treatment of Ebola virus disease, expands the new use of non-receptor tyrosine kinase ABL1 gene targeted drugs, and demonstrates the potential of non-receptor tyrosine kinase ABL1 gene targeted drugs for the prevention and treatment of Ebola virus infection. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 This is a diagram showing the interaction between the non-receptor tyrosine kinase ABL1 and the Ebola virus NP protein; Figure 2 The results of phosphorylation modification of Ebola virus NP protein by non-receptor tyrosine kinase ABL1 (identification of 6 phosphorylated tyrosine sites (Y98, Y187, Y293, Y357, Y611 and Y721)) are shown; Figure 3 This is the result of the ABL1 inhibitor Asciminib or ABL1 gene knockout effectively inhibiting viral proliferation. DETAILED DESCRIPTION
[0029] In order to better illustrate the purpose, technical solutions and advantages of this application, this application will be further described below with reference to the accompanying drawings and specific embodiments.
[0030] In the following examples, the experimental methods used are conventional methods unless otherwise specified, and the materials, reagents, etc. used are all commercially available unless otherwise specified, and the components and raw materials used in each parallel experiment are all the same.
[0031] In the following examples: Flag-NP was synthesized at General Biotechnology Co., Ltd.; Myc-ABL1 was synthesized by General Biotechnology Co., Ltd.; Anti-Flag antibody was purchased from Sigma (Cat#A8592); Anti-Myc antibody was purchased from Santa Cruz (Santa Cruz, Cat#606SC-40); Plasmids such as pCAGGS-NP, pCAGGS-VP35, pCAGGS-VP30, pCAGGS-L, pCAGGS-T7, pCAGGS-Tim1 and p4cis-vRNA-Luc are disclosed in the literature Hoenen T, et al. Modeling The Lifecycle Of Ebola Virus Under Biosafety Level 2 Conditions With Virus-like Particles Containing Tetracistronic Minigenomes (J. Vis. Exp., 2014).
[0032] Example 1. Phosphorylation modification of Ebola virus NP protein by non-receptor tyrosine kinase ABL1 gene Flag-NP (1 μg) and Myc-ABL1 (1 μg) were co-transfected into HEK293 cells. After 48 h, the cells were collected and stained with anti-Flag antibody ( Figure 1 A) or anti-Myc antibody ( Figure 1 B) Immunoprecipitation was performed, followed by immunoblotting analysis using the indicated antibodies.
[0033] Immunoprecipitation includes: 48 hours after transfection, cells were washed twice with PBS and harvested by centrifugation at 1000g / min for 5 minutes at 4°C. Cells were lysed on ice for 10 minutes in 400μl of cell lysis buffer (150mM NaCl, 50mM Tris-HCl, pH 8.0, containing 1 tablet of EDTA protease inhibitor / 50ml and 1% NP40) and centrifuged at 12000rpm for 8 minutes at 4°C. The supernatant was transferred to a 1.5ml EP tube and 15μl of anti-Flag antibody conjugated to agarose beads was added. The cells were incubated with rotation at 4°C for 2 hours. The beads were washed three times with PBST buffer and then added with an appropriate amount of 1× SDS loading buffer. The beads were boiled in water for 8 minutes and centrifuged at 16000g / min for 5 minutes at 4°C. The pellet was then removed and the remaining supernatant was subjected to SDS-PAGE electrophoresis and immunoblotting.
[0034] Only Flag-NP (1 μg) was transfected into the cells, and immunoprecipitation was performed using anti-Flag antibody and immunoblotting was performed to confirm that endogenous ABL1 was detected in the Flag-NP precipitate. Figure 1 Middle C).
[0035] The results show that, if Figure 1 As shown, ABL1 interacts with Ebola virus NP protein.
[0036] Flag-NP (1 μg) was transfected into HEK293 cells with Myc-ABL1 (1 μg) or Myc-Vector (1 μg) plasmids. After 24 hours of transfection, one of the samples was treated with the ABL1 inhibitor Asciminib (10 μM, 18 h). After harvesting the cells, immunoprecipitation was performed using anti-Flag antibody, and NP phosphorylation was detected using tyrosine-specific antibody anti-p-Tyr. It was found that the ABL1 inhibitor asciminib significantly inhibited the phosphorylation of NP, confirming that NP was phosphorylated and modified by Myc-ABL1. Figure 2 Six tyrosine sites of NP protein phosphorylated by ABL1 were identified by mass spectrometry, namely Y98, Y187, Y293, Y357, Y611 and Y721. The six phosphorylation sites of Flg-NP were mutated to phenylalanine (F) to construct mutant plasmids (using the QuickMutation TM The gene site-directed mutagenesis kit (D0206) was used to perform point mutation according to the operating instructions. These plasmids were then co-transfected with Myc-ABL1 into HEK293 cells and their phosphorylation was detected. The results showed that the phosphorylation level of Y98F decreased most significantly, indicating that this tyrosine is the main phosphorylation site ( Figure 2 Middle B).
[0037] like Figure 2 As shown in the results, NP was found to be phosphorylated and modified by ABL1, and six phosphorylated tyrosine sites (Y98, Y187, Y293, Y357, Y611, and Y721) were identified, among which Y98 was the major phosphorylation site.
[0038] Example 2: Use of a substance that inhibits the expression of the non-receptor tyrosine kinase ABL1 gene in the preparation of a product for treating Ebola virus disease HEK293 cells were transfected with EBOV minimal genome system-related plasmids: pCAGGS-NP (125 ng), pCAGGSVP35 (125 ng), pCAGGS-VP30 (75 ng), pCAGGS-L (1000 ng), p4cis-vRNA-Rluc (250 ng) and pCAGGS-T7 (250 ng). After 24 hours, the culture medium (DMEM containing 10% FBS) was replaced with DMEM containing 5% FBS, and different concentrations (1 μM, 10 μM) of the ABL1 inhibitor Asciminib were added for treatment. After another 24 hours of culture, the luciferase level experiment was performed.
[0039] Luciferase level experiment: Remove the cells from the incubator, discard the culture medium, and operate according to the instructions of the luciferase assay kit (the dual luciferase assay kit was purchased from (E640A) Promega): After washing the cells with PBS, add 500μl PLB lysis buffer and lyse on a shaker for 15 minutes. After centrifugation, take 20μl of cell lysis supernatant and add it to 100μl Luciferase Assay ReagentⅡ. After mixing, place it in a TD-20 / 20 fluorescence photometer to measure the luminescence value RLU1, and then add 100μl Stop&Glo Reagent to measure the fluorescence luminescence value RLU2. The relative luciferase activity value of RLU2 / RLU1 evaluates the virus level, thereby confirming the expression level of EBOV trVLP in the cells ( Figure 3 Middle A).
[0040] Example 3. Application of a substance that knocks out the non-receptor tyrosine kinase ABL1 gene in the preparation of a product for treating Ebola virus disease HEK293 cells were transfected with the Myc-ABL1 plasmid, and 24 hours later, they were transfected with the EBOV minimal genome system-related plasmid. 24 hours later, they were treated with Asciminib for 18 hours, and the expression of EBOV trVLP was detected by measuring the luciferase level using a dual luciferin reporter system ( Figure 3B); in A549WT and ABL1 gene knockout (the target sequence of sgRNA (AAGTACTTGGGGACCAAAGAAGG, such as SEQ ID NO: 1) was connected and inserted into the pSpCas9(BB)-2A-puro vector (Addgene, plasmid ID: 48139), and the The resulting plasmid was transfected into A549 cells using a transfection reagent. The cells were then selected with puromycin and two monoclonal cell lines, ABL1, were obtained by serial dilution. - / - #1 and ABL1 - / - #2. After expansion, some cells were lysed to extract the genome, and then the fragments were amplified by PCR and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The cells were transfected with EBOV minimal genome system related plasmids to detect the expression of EBOV trVLPs ( Figure 3 C); EBOV minimal genome system p1 generation related plasmids were transfected into A549WT and ABL1 knockout cells. After 24 hours, the p0 supernatant was used to infect the cells. The culture medium (DMEM containing 10% FBS) was replaced with DMEM containing 5% FBS. The cells were cultured for 48 hours and the proliferation of EBOV trVLPs was detected ( Figure 3 Middle D).
[0041] like Figure 3 As shown, it was found that the ABL1 inhibitor Asciminib or knockout of the ABL1 gene can effectively inhibit viral proliferation.
[0042] The present application discovered that the non-receptor tyrosine kinase ABL1 acts on the NP protein of the Ebola virus, interacts with it and phosphorylates the tyrosine phosphorylation sites of the Ebola virus NP protein (including tyrosine 98 (Y98), tyrosine 187 (Y187), tyrosine 293 (Y293), tyrosine 357 (Y357), tyrosine 611 (Y611) and tyrosine 721 (Y721), of which Y98 is the main phosphorylation site); and the non-receptor tyrosine kinase ABL1 gene participates in viral assembly / replication by regulating the Ebola virus NP protein, and ABL1 inhibitors can be used to inhibit viral proliferation. The present application confirms that the non-receptor tyrosine kinase ABL1 gene can be used as a target for the treatment of Ebola virus disease, expands the new use of non-receptor tyrosine kinase ABL1 gene-targeted drugs, and demonstrates the potential of non-receptor tyrosine kinase ABL1 gene-targeted drugs for the prevention and treatment of Ebola virus infection.
[0043] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application and are not intended to limit the scope of protection of the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present application.
Claims
1. Use of substances that inhibit the expression of the non-receptor tyrosine kinase ABL1 gene in the preparation of products for the treatment, prevention or auxiliary treatment of Ebola virus disease.
2. The use according to claim 1, characterized in that The substance that inhibits the expression of the non-receptor tyrosine kinase ABL1 gene includes at least one of aspartame, nilotinib and imatinib.
3. The use according to claim 1, characterized in that The product for treating, preventing or assisting in the treatment of Ebola virus disease is a pharmaceutical preparation.
4. The use according to claim 3, characterized in that The mass concentration of the substance that inhibits the expression of the non-receptor tyrosine kinase ABL1 gene in the pharmaceutical preparation is 1 to 10 μM.
5. The use according to claim 4, characterized in that The substance that inhibits the expression of the non-receptor tyrosine kinase ABL1 gene is asanib.
6. Use of substances that knock out the non-receptor tyrosine kinase ABL1 gene in the preparation of products for the treatment, prevention or auxiliary treatment of Ebola virus disease.
7. The use according to claim 6, characterized in that The material for knocking out the non-receptor tyrosine kinase ABL1 gene is a CRISPR / Cas9 gene editing system for knocking out the ABL1 gene.
8. The use according to claim 7, characterized in that The sgRNA target sequence in the CRISPR / Cas9 gene editing system for knocking out the non-receptor tyrosine kinase ABL1 gene is as follows: AAGTACTTGGGGACCAAAGAAGG.
9. The use according to claim 1 or 6, characterized in that The non-receptor tyrosine kinase ABL1 gene phosphorylates and modifies the Ebola virus NP protein.
10. The use according to claim 9, characterized in that The phosphorylation modification sites of the Ebola virus NP protein include at least one of tyrosine 98, tyrosine 187, tyrosine 293, tyrosine 357, tyrosine 611 and tyrosine 721.