Grass carp gamma interferon fusion protein as well as mutant, coding gene and application thereof

By codon optimization of grass carp interferon gamma and fusion with grass carp ferritin heavy chain subunits, the silkworm cell expression system was used to solve the problem of short expression of grass carp interferon gamma and the short half-life of grass carp, achieving efficient antiviral activity and long-acting drug application.

CN120484093APending Publication Date: 2025-08-15THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI

Patent Information

Application Number
CN202510562048.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-30
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

The prior art is difficult to effectively improve the expression amount and activity of interferon gamma in grass carp, and its half-life in the host is short, affecting the immune and disease prevention effect of grass carp.

Method used

By codon optimization of the coding gene of grass carp gamma interferon, its signal peptide and transmembrane domain are removed, the heavy chain subunit of grass carp ferritin is fused, and it is expressed in the eukaryotic expression system of silkworm cells, the self-assembly characteristics of ferritin are used to display interferon, and unit point mutation is performed to improve antiviral activity.

Benefits of technology

It significantly improves the expression and stability of interferon gamma in grass carp, prolongs its half-life in the host, enhances antiviral activity, and provides more effective drug applications for preventing and treating viral diseases of grass carp.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120484093A_ABST
    Figure CN120484093A_ABST
Patent Text Reader

Abstract

The invention discloses a grass carp gamma interferon fusion protein as well as a mutant, a coding gene and application thereof. In order to improve the expression quantity or expression efficiency of the grass carp gamma interferon, codon optimization and mutation are carried out on the coding gene of the grass carp gamma interferon to obtain the grass carp gamma interferon mutant. The fusion protein is further obtained by connecting the grass carp gamma interferon mutant with the C end of the grass carp ferritin heavy chain subunit of which the last 17 amino acids are removed through a connecting peptide. In order to further improve the antiviral activity of the fusion protein, the obtained fusion protein is subjected to single-point mutation, and the titer of the fusion protein is remarkably improved. The fusion protein is expressed by a silkworm cell eukaryotic expression system, and the fusion protein shows a conformation suitable for the interferon to play functions based on the ferritin self-assembly characteristic, so that the titer of the interferon in a host is effectively improved, and the in-vivo and in-vitro half-life period of the interferon is prolonged. The invention has application prospects in preparation of drugs or reagents for preventing or treating viral diseases of grass carp and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to grass carp gamma interferon and its application, in particular to a fusion protein of grass carp gamma interferon and a grass carp ferritin heavy chain subunit and its application in preparing a drug for improving grass carp immunity or resisting grass carp viruses, belonging to the field of grass carp gamma interferon fusion protein and its application. Background Art

[0002] After a virus infects the body, pattern recognition receptors (PRRs) within host cells recognize viral dsDNA or RNA, triggering the expression and secretion of interferon. Interferon then binds to interferon receptors on the same or adjacent cells, initiating the JAK-STAT signaling pathway, which in turn induces the cell to produce a series of ISGs, inhibiting viral replication.

[0003] As a cytokine in the first line of defense of the innate immune response, interferon plays an important role in inhibiting viral replication, regulating the innate immune response, and activating the adaptive immune system. Interferons are mainly divided into type I, type II, and type III. Each type of interferon has different interferon receptors and pathway cascades, and its performance in inhibiting the replication of different viruses is also different. Type I interferons mainly include IFN-α, IFN-β, IFN-ε, IFN-κ, and IFN-ω. They are secreted by various immune cells and activate downstream signaling pathway cascades by binding to cell surface receptors IFNAR1 and IFNAR2 to exert immune effects. Type III interferons have similar functions to type I interferons and largely the same signaling pathway cascades, differing in binding to different receptors. Type III interferons include IFN-λ (IFN-λ1, IFN-λ2, IFN-λ3, and IFN-λ4), whose cell surface receptors are IFNLR1 and IL10R2. IFNLR1 is a specific receptor, and the binding affinity of different IFN-λs to IFNLR1 varies greatly. IL10R2 serves as a co-receptor. IFN-γ, the only type II interferon, plays a significant role in antiviral and immune response. IFN-γ is secreted by activated T cells and natural killer cells. Its receptor is IFNGR, which consists of a ligand-binding chain, IFNGR1, and an accessory chain, IFNGR2. IFNGR1 binds to its ligand with high specificity, but IFN-γ can only induce its associated signaling and activity in the presence of IFNGR2.

[0004] Ferritin, as a delivery vehicle with a particle size of 12 nm, easily escapes phagocytosis by the reticuloendothelial system (RES) in vivo, has a long circulation time, and a long half-life. Its remarkable thermal stability and pH stability enable it to maintain its cavity structure over a wide range of variations. Ferritin is derived from organisms, has good biocompatibility, is less likely to cause rejection, has low toxicity, and is safer. Furthermore, ferritin's structure decomposes into subunits under extremely acidic or alkaline conditions, and when the pH value returns to the physiological range, it reorganizes and restores its cage-like structure. This self-assembly ability and its stable properties make it an ideal material for the preparation of long-acting interferon.

[0005] Grass carp, with its high nutritional value and simple, widely available diet, is an excellent aquaculture fish. Interferon treatment can effectively activate the immune system, prevent disease, and increase yields. Efficiently optimizing interferon expression and activity, and extending its half-life, is crucial for ensuring grass carp reproduction and increasing economic returns. Summary of the Invention

[0006] One of the purposes of the present invention is to provide a grass carp gamma interferon.

[0007] The second object of the present invention is to provide a fusion protein containing grass carp gamma interferon.

[0008] The third purpose of the present invention is to mutate the fusion protein to obtain a mutant with improved antiviral activity.

[0009] The fourth object of the present invention is to provide the coding gene of the fusion protein and the mutant of the fusion protein.

[0010] The fifth purpose of the present invention is to apply the coding gene to the preparation of drugs for improving grass carp immunity or resisting grass carp viruses.

[0011] In order to achieve the above objectives, the main technical solutions adopted by the present invention include:

[0012] On the one hand, the present invention provides a gene encoding grass carp interferon-γ, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0013] In order to increase the expression level of grass carp interferon-γ, the nucleotide sequence encoding grass carp interferon-γ was optimized and modified according to the codon preference of silkworm. Various relevant parameters affecting gene transcription efficiency, translation efficiency and protein folding, such as GC content, CpG dinucleotide content, codon preference, and repeat sequence, were optimized and designed, while keeping the final translated protein sequence unchanged. The final optimized nucleotide sequence is shown in SEQ ID NO.3.

[0014] The present invention also provides a grass carp gamma interferon, the amino acid sequence of which is shown in SEQ ID NO.4, and the nucleotide sequence of which is shown in SEQ ID NO.5.

[0015] In order to further optimize and improve the expression efficiency, the signal peptide and transmembrane domain were predicted. The amino acid sequence after removing this region is shown in SEQ ID NO.4, and its nucleotide sequence is shown in SEQ ID NO.5. The Kozak sequence GCCACC was inserted in front of the gene encoding grass carp gamma interferon. To facilitate genetic engineering operations, the enzyme cleavage site BamHI was added upstream of the gene, and the EcoRI restriction enzyme cleavage site was added downstream of the gene. At the same time, to ensure the enzyme cleavage efficiency, protective bases were added next to the enzyme cleavage sites for final synthesis.

[0016] Another aspect of the present invention is to provide a fusion protein comprising grass carp gamma interferon.

[0017] In a preferred embodiment of the present invention, the fusion protein is obtained by connecting grass carp gamma interferon to the C-terminus of a monomeric ferritin subunit via a connecting peptide.

[0018] In a preferred embodiment of the present invention, the amino acid sequence of the grass carp interferon-γ is shown in SEQ ID NO.1 or SEQ ID NO.4.

[0019] In a preferred embodiment of the present invention, the ferritin subunit includes any one of a vertebrate ferritin subunit, a plant ferritin subunit, and a bacterial ferritin subunit; preferably, the ferritin is a grass carp ferritin heavy chain subunit, and its amino acid sequence is shown in SEQ ID NO.6 or SEQ ID NO.9.

[0020] In a preferred embodiment of the present invention, the connecting peptide sequence is shown as SEQ ID NO.10.

[0021] In a preferred embodiment of the present invention, the amino acid sequence of the fusion protein is shown as SEQ ID NO.11.

[0022] The fusion protein disclosed in the present invention is a fusion expression of grass carp gamma interferon and ferritin. According to the self-assembly property of ferritin, the interferon is displayed on the surface of ferritin, thereby improving the stability and expression efficiency of grass carp gamma interferon.

[0023] The present invention utilizes OptimumGene TMThe technology optimizes and modifies the nucleotide sequence of the grass carp ferritin heavy chain subunit based on the codon preferences of Escherichia coli and Bombyx mori, optimizes and designs various relevant parameters that affect gene transcription efficiency, translation efficiency and protein folding, such as GC content, CpG dinucleotide content, codon preference, mRNA secondary structure, mRNA free energy stability, RNA instability gene sequence, and repeat sequence, while keeping the final translated protein sequence unchanged. The obtained nucleotide sequence is the nucleotide sequence shown in SEQ ID NO.8.

[0024] To prevent grass carp interferon-γ from being encapsulated by ferritin, the grass carp ferritin heavy chain subunit was modified based on structural analysis, and 17 amino acids at its tail were removed to obtain the final optimized amino acid sequence of grass carp ferritin shown in SEQ ID NO.9; and a connecting peptide GGGSGGGGSGGGS was added to the C-terminus of the final optimized amino acid sequence.

[0025] Another aspect of the present invention is to provide a mutant obtained by mutating the fusion protein to obtain a mutant with improved antiviral activity.

[0026] In a preferred embodiment of the present invention, the amino acid sequence shown in SEQ ID NO. 11 is mutated into a single-site mutant by any one of A188L, L222P, R233S, V254I or K260R.

[0027] The single-site mutant "A188L" of the present invention indicates that the 188th amino acid of the amino acid sequence shown in SEQ ID NO.11 is mutated from alanine (A) to leucine (L); the expressions of the remaining single-site mutations of the present invention are similar.

[0028] Another aspect of the present invention is to provide a gene encoding the fusion protein or a mutant of the fusion protein.

[0029] For reference, the present invention provides a method for preparing the grass carp interferon-γ mutant, the fusion protein or the fusion protein mutant, comprising:

[0030] (1) structural analysis and optimized synthesis of the coding gene of the fusion protein or mutant;

[0031] (2) cloning the coding gene of the grass carp interferon-γ, the fusion protein or the mutant into a eukaryotic expression vector to construct a recombinant transfer vector;

[0032] (3) co-transfecting the constructed recombinant transfer vector and baculovirus DNA into insect cells to obtain recombinant baculovirus;

[0033] (4) The recombinant baculovirus infects host cells, and is propagated in insect cells or insect hosts, and the protein is purified.

[0034] The baculovirus transfer vector is preferably selected from any one of Bac to Bac, AcRP23-lacZ, pAc373, pBR1393, pBR, Bacmid, pAc360, pBR1391, pP10, pPBac, pVTBac or pUAC-5;

[0035] The baculovirus is preferably any one of the Bombyx mori baculovirus parent strains AcMNPV, BmBac, BmNPV, SeMNPV, ApNPV, OpMNPV, SlMNPV or SpltNPV;

[0036] The insect host is preferably selected from any one of the group consisting of Bombyx mori, Bombyx mandarina, Philosamia cynthia ricim, Dictyoploca japanica, Philosamia cynthiapryeri, Antheraea pernyi and Antheraea yamamai;

[0037] The infection refers to the recombinant baculovirus infecting 1-5 instar insect larvae or pupae by ingestion or penetration through the epidermis; preferably, the recombinant silkworm baculovirus is used to infect silkworm cells or puncture-inoculate 1-5 instar silkworm larvae or pupae, and body fluids or tissue homogenates of the silkworm larvae or pupae containing various grass carp gamma interferon genes are collected 3-6 days after infection; wherein, the pupae are most preferably early tender pupae of 1-2 days old.

[0038] Most preferably, the baculovirus transfer vector is pBR; the baculovirus is Bombyx mori baculovirus; and the insect host is Bombyx mori.

[0039] Another aspect of the present invention is to apply the coding gene to the preparation of medicines or reagents for preventing or treating grass carp viral diseases.

[0040] The present invention codon-optimizes and mutates the gene encoding grass carp interferon-γ to produce a mutant grass carp interferon-γ with improved expression efficiency. The present invention further connects the mutant grass carp interferon-γ to the C-terminus of the grass carp ferritin heavy chain subunit, omitting the last 17 amino acids, via a linker peptide (GGGSGGGGSGGGS) to produce a fusion protein. To further enhance the antiviral activity of the fusion protein, a single-site mutation is performed on the resulting fusion protein, significantly increasing the potency of the resulting mutant. The present invention utilizes a eukaryotic expression system in silkworm cells to express the fusion protein. The grass carp interferon-γ fusion protein provided by the present invention has enhanced stability and broadened administration routes. Based on the self-assembly properties of ferritin, the fusion protein exhibits a conformation suitable for interferon function, effectively increasing interferon expression and potency in the host and prolonging its half-life in vitro and in vivo. Derived from an animal source, the fusion protein exhibits minimal rejection, weak antigenicity, and a long half-life. It can be used to prepare a variety of drugs for preventing or treating viral infections and immune adjuvants, enhancing grass carp immunogenicity and playing a significant role in preventing and treating grass carp diseases.

[0041] Definitions of terms used in this invention

[0042] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0043] The term "interferon" is a cytokine that serves as the first line of defense in the innate immune response and plays an important role in inhibiting viral replication, regulating the innate immune response, and activating the adaptive immune system. Interferons are divided into type I, type II, and type III according to the sequence of their encoding genes, chromosomal location, and receptor specificity.

[0044] The term "fusion protein" refers to a protein composed of at least two domains that are encoded by separate genes, linked together, and transcribed and translated as a single unit. A fusion protein in the present invention is composed of two proteins or protein subunits fused end-to-end, connected by a linker.

[0045] The terms "mutation" and "mutant" refer to changes in the base sequence of a gene, including but not limited to single base substitutions, DNA insertions and duplications, and a mutant is an object that has undergone a mutation.

[0046] The term "recombinant transfer vector" refers to a plasmid constructed by cloning a coding gene into a transfer vector, which is an important component of the baculovirus expression system used to transfer foreign genes into the viral genome. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 This is a schematic diagram of the predicted high-level structure of grass carp γ interferon, and the mutation sites were designed based on this structure.

[0048] Figure 2 This is a double enzyme digestion identification diagram of the recombinant transfer vector pBR-GcIFNγ.

[0049] Figure 3 The growth diagram of healthy silkworms and silkworms infected with recombinant viruses; Figure 3 -(a) is a diagram showing the growth of healthy silkworms; Figure 3 -(b) is a diagram showing the growth of silkworms infected with the recombinant virus.

[0050] Figure 4 This is the PCR identification diagram of the recombinant virus reBmBac-GcIFNγ.

[0051] Figure 5 Schematic diagram of the statistical control of fluorescent wells in the Vero / VSV*GFP system.

[0052] Figure 6 This is a double enzyme digestion identification diagram of the recombinant transfer vector pBR-Ferritin-GcIFNγ.

[0053] Figure 7 This is the PCR identification diagram of the recombinant virus reBmBac-Ferritin-GcIFNγ. DETAILED DESCRIPTION

[0054] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, it should be understood that the embodiments are merely exemplary and do not limit the scope of the present invention in any way. It should be understood by those skilled in the art that the details and forms of the technical solutions of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but such modifications or replacements fall within the scope of protection of the present invention.

[0055] 1 Experimental Materials

[0056] 1.1 Materials and Reagents

[0057] The PCR high-fidelity amplification kits Phanta Max Super-Fidelity DNA Polymerase and ClonExpress Ultra One Step Cloning Kit were purchased from Novezan, various plasmid extraction and gel recovery kits were purchased from Tiangen Biochemical Technology Co., Ltd., various restriction endonucleases were purchased from Thermo Fisher Scientific, fetal bovine serum and DMEM medium used in cell culture were purchased from Gibco, and TC-100 medium required for insect cell culture was purchased from Maclean.

[0058] 1.2 Instruments and Equipment

[0059] The experimental process of the present invention involves the construction of a multi-dimensional analysis platform, and the main instrument configuration covers disciplines such as molecular biology, cell biology and microbiology. The molecular cloning experiment uses the PTC-200 PCR instrument from MJ Research in the United States, combined with the Bio-RAD electrophoresis instrument to complete nucleic acid separation and detection, and the nucleic acid gel and protein gel imaging uses the domestic GeLX1620 gel imaging analysis system for band analysis. The HealForce incubator is used for cell culture, Nikon's ECLIPSE Ti-S fluorescent inverted microscope is responsible for cell imaging, and the Promega photon detector is used for quantitative analysis. The entire experimental operation relies on the ThermoFisher ultra-clean workstation to ensure sterile conditions. Other experimental links involve equipment such as Hitachi low-temperature centrifuge, Yisheng Company's constant temperature water bath and Scientific Industries' G560E vortex oscillator to construct a standardized experimental process.

[0060] 1.3 Vectors, Viral Strains, Cells, and Experimental Animals

[0061] The transfer vector pBR, E. coli strain TOP10, BmN cells, Vero cells, and VSV-GFP virus were all provided by the Institute of Biotechnology, Chinese Academy of Agricultural Sciences. The experimental silkworm variety JY1 was provided by the Sericulture Research Institute of Jiangsu University of Science and Technology. The parental virus BmBac DNA was constructed according to the method disclosed in the literature (Patent Publication No.: CN 102286534 A).

[0062] 2 Experimental methods

[0063] The fusion PCR method used for site-directed mutagenesis in the experimental method was carried out according to the method described by Kuang Feiting et al. (A new method for vector construction: recombinant fusion PCR method, Genomics and Applied Biology, 2012, Vol. 31, No. 6, pp. 634-639).

[0064] The interferon titer was calculated using the Vero / VSV*GFP system and the Reed-Muench method. The specific operations were performed according to the methods described by Liu Xingjian et al. (Expression and biological activity detection of feline ω-like interferon in silkworms, Progress in Biotechnology, 2015, 5(6): 441-445) and Summers MD et al. (A manual of methods for baculovirus vectors and insect cell culture procedures [R]. Texas Agricultural Experiment Station, 1987).

[0065] The criteria for judging cytopathic effects were based on the results of Li Dan et al. (Expression of ovine interferon-α in silkworms and determination of its anti-peste des petits ruminants virus activity, Biotechnology Bulletin, 2022, 38(1):187-193). Figure 3 The incidence rates shown.

[0066] The best improved solution in each test case serves as the comparison standard for the improved solution of the next test case.

[0067] Experimental Example 1 Sequence Optimization of Grass Carp Interferon-γ and Its Expression and Detection in Silkworm Bioreactor

[0068] 1 Test method

[0069] 1.1 Target gene synthesis and recombinant plasmid construction

[0070] The amino acid sequence of grass carp interferon-γ with accession number AGQ16236.1 on the NCBI website was used as the original sequence. The amino acid sequence thereof is shown in SEQ ID NO.1, and the nucleotide sequence of the encoding gene thereof is shown in SEQ ID NO.2.

[0071] The amino acid sequence of grass carp interferon-γ is shown in SEQ ID NO.1:

[0072]

[0073] The nucleotide sequence of the gene encoding grass carp interferon-γ is shown in SEQ ID NO.2:

[0074]

[0075]

[0076] Using OptimumGene TM The technology is used to optimize the codons of the grass carp gamma interferon gene, modify the gene sequence according to the codon preference of the bioreactor silkworm, and optimize the design of various related parameters affecting gene transcription efficiency, translation efficiency and protein folding, such as GC content, CpG dinucleotide content, codon preference, mRNA secondary structure, mRNA free energy stability, RNA instability motif, and repeat sequence. This is beneficial to improving the transcription efficiency and translation efficiency of the optimized gene in silkworms, while keeping the final translated protein sequence unchanged. The nucleotide sequence used to encode the gene is shown in SEQ ID NO.3.

[0077] The codon-optimized nucleotide sequence of the grass carp interferon-γ coding gene is shown in SEQ ID NO.3:

[0078]

[0079] The amino acid sequence was further predicted for signal peptide and transmembrane domain. To avoid the effects of signal peptide and transmembrane domain on protein expression, the signal peptide and transmembrane domain were removed. The amino acid sequence of grass carp gamma interferon after optimization is shown in SEQ ID NO.4, and the nucleotide sequence of its coding gene is shown in SEQ ID NO.5. DNAman software was used to analyze restriction enzyme sites. According to the results of the enzyme site analysis and the multiple cloning sites on the vectors pBR and pUC57, restriction enzyme sites that did not exist in the coding gene sequence were added to both ends of the coding gene. According to the analysis results, a BamHI enzyme site, a protective base, and a Kozak sequence were added to the 5' end, and an EcoRI enzyme site and a protective base were added to the 3' end. The determined gene sequence was handed over to the company for synthesis and inserted into the pUC57 vector to form the plasmid pUC57-GcIFNγ.

[0080] The optimized amino acid sequence of grass carp interferon-γ is shown in SEQ ID NO.4:

[0081]

[0082]

[0083] The optimized nucleotide sequence of grass carp interferon-γ is shown in SEQ ID NO.5:

[0084]

[0085] 1.2 Construction of recombinant baculovirus transfer vector

[0086] First, the plasmid of the synthetic sequence pUC57-GcIFNγ was extracted and preserved. The synthetic plasmid and the pBR vector stored in the laboratory were double-digested according to the concentration of the extracted plasmid. The enzyme digestion system is shown in Table 1:

[0087] Table 1 Plasmid vector enzyme digestion system

[0088]

[0089] The reaction products were electrophoresed on a 1% agarose gel at 110V for 30 minutes. After completion, the results were recorded. A gel strip containing the target band was cut and weighed, then recovered using a Tiangen Biochemical Technology Co., Ltd. agarose gel DNA recovery kit. The recovered product was used for concentration determination to facilitate subsequent calculation of the ligation system. T4 DNA ligase was then used to ligate the target fragment to the baculovirus transfer vector pBR. The reaction was performed in a PCR instrument set to 25°C for 10 minutes. The ligation system is shown in Table 2.

[0090] Table 2 Connection system

[0091]

[0092]

[0093] Add 10 μL of the ligation product to 100 μL of Trans5α competent cells, place on ice for 30 minutes, heat shock at 42°C for 90 seconds, and place on ice for 2 minutes. Add approximately 1 mL of LB liquid medium, mix thoroughly, and incubate at 37°C for 1 hour. Harvest the cells at 8000 rpm for 2 minutes, retain 200 μL of the medium, and evenly suspend the cells on LB solid selective medium containing 60 μg / mL ampicillin. Incubate inverted at 37°C for 8-12 hours. Pick a single colony, shake it, and extract the plasmid. Identify positive clones with BamHI and EcoRI double digestion. The correctly identified recombinant plasmid is sent to the company for sequencing. The correctly sequenced plasmid is named pBR-GcIFNγ.

[0094] 1.3 Acquisition, purification and amplification of recombinant silkworm baculovirus

[0095] BmN cell recovery, passage, and recombinant virus screening were performed according to published methods. First, BmN cells were plated in a six-well plate at a final density of 80%, and the number of samples and the required plasmid concentration were calculated. During co-transfection, pBR-GcIFNγ and the Bombyx mori baculovirus BmBac DNA stored in the laboratory were co-transfected into BmN cells. To visualize the transfection efficiency of the samples, a fluorescent plasmid carrying a Luc tag was transfected in other wells as a control. The transfection reagent used was Lipofectamine. TM 2000, 2μL of liposomes per sample, add the liposomes to 50μL of sterile ultrapure water and incubate at room temperature for 5 minutes. Add the co-transfection plasmids proportionally to 40μL of sterile ultrapure water and incubate at room temperature for 5 minutes. Add the mixed liposome dilution dropwise to the plasmid dilution and incubate at room temperature for 20 minutes. During this incubation period, gently rinse the remaining medium in the six-well plate with serum-free insect cell culture medium. After rinsing, add 2mL of serum-free culture medium. Subsequently, add the mixed liposome solution dropwise to the corresponding sample wells of the six-well plate, seal with sealing film, and place in a cell culture incubator at 27°C. 6 hours after transfection, to ensure normal cell culture, add 4 mL of serum-free culture medium, 600 μL of fetal bovine serum, and 6 μL of double antibody to each well (i.e., restore the normal culture medium concentration in each well), seal with sealing film, and culture in a constant temperature of 27°C incubator for 4 to 5 days until the cells fall off and float up. Collect the cell culture fluid to obtain the recombinant virus reBmBac-GcIFNγ containing the target gene.

[0096] The purification and amplification method for recombinant B. mori baculovirus is as follows: Inoculate an appropriate number of cells (approximately 70-80%) in a 35mm dish. After the cells have adhered, remove the culture medium by aspiration. Dilute the collected cell culture medium to various concentrations, and evenly add 1 mL dropwise to the adherent cells. Infect at 27°C for 1 hour, then aspirate the infection medium. Melt 2% low-melting-point agarose gel in a 60°C water bath, cool to 40°C, and mix thoroughly with 2× TC-100 medium (containing 20% ​​FBS) preheated at 40°C. Add 4 mL of melted agarose gel to each dish. Once the gel has solidified, seal with parafilm, return to the incubator, and culture inverted at 27°C for 3 to 5 days. Observe under a microscope. Select plaques and repeat the above steps. After two to three rounds of purification, pure recombinant B. mori baculovirus reBmBac-GcIFNγ can be obtained.

[0097] Normally growing BmN cells were infected with the recombinant Bombyx mori baculovirus reBmBac-GcIFNγ, and the supernatant was collected after culturing for 3 to 5 days. At this time, the supernatant contained a large amount of the recombinant virus reBmBac-GcIFNγ.

[0098] 1.4 Identification of reBmBac-GcIFNγ and its expression in a silkworm bioreactor

[0099] To quantify the recombinant virus containing the fluorescently tagged plasmid, centrifuge at 8000 rpm for 5 minutes, discard the supernatant, harvest the cells, add 60 μL of Lysis Buffer, and incubate on ice for 5 minutes to lyse the cells. Centrifuge at 6000 rpm for 3 minutes, remove 20 μL of the supernatant and transfer it to an Eppendorf tube. Add 30 μL of luciferase substrate, mix well, react for 30 seconds, and measure the concentration in a photon analyzer. A count of more than 2 million cpm indicates a successful co-transfection.

[0100] The supernatant containing the recombinant virus reBmBac-GcIFNγ was filtered through a 0.22 μM filter membrane and then injected into silkworms and pupae at a rate of 5 μL per pupae and silkworm. After 4-5 days, the infected pupae were collected and blood was taken, then frozen at -20°C for subsequent testing. The silkworm pupae used were from the high-expressing strain JY1 (preserved in the inventor's laboratory). The JY1 strain was reared according to the conventional methods outlined in "Chinese Sericulture," edited by Lü Hongsheng (Shanghai Science and Technology Press, 1991).

[0101] Based on the nucleotide sequence of grass carp interferon-γ, flanking primers were designed using SnapGene software to detect the expression of the target gene in silkworms. Following the basic principles of primer design, the primer length was kept between 18 and 30 bp to prevent primers that were too short from reducing specific binding to the template, and to prevent primers that were too long from causing excessive annealing temperatures or increasing synthesis costs. The GC content was also maintained between 40% and 60%, the Tm values ​​of the primers between 55°C and 65°C, and the Tm values ​​of the upstream and downstream primers from differing by no more than 5°C. The designed primer sequences are as follows:

[0102] GcIFNγ-F: CGGGATCCGCCACCCATGA;

[0103] GcIFNγ-R: CGGAATTCTTAGCTTTTTTGACGCTT.

[0104] 1.5 Antiviral activity detection of GcIFNγ

[0105] Because there is no standard reference in the grass carp interferon determination system, the present invention uses the mammalian determination method and process as a standard and uses the microcytopathic effect inhibition method on the Vero / VSV*GFP system to detect the antiviral activity of GcIFNγ expressed in silkworm hemolymph. 5 The silkworm blood lymph was inoculated at a density of 100 μL / mL in a 96-well culture plate. The silkworm blood lymph that had been ultrasonically broken and filtered for sterilization was gradiently diluted with 7% fetal bovine serum DMEM culture medium to form solutions of different concentrations. The diluted samples were inoculated into culture wells that were already covered with Vero cells at 100 μL / well. At least 8 replicate wells were set up for each dilution and control silkworm blood. At the same time, a cell control group without silkworm blood lymph and VSV*GFP and a virus control group with VSV*GFP were set up. The cells were cultured at 37°C and 5% CO2 for 18-24 hours. The titer of the VSV*GFP virus was determined in advance and diluted to 100 TCID according to its titer. 50 100 μL of the supernatant was added to the culture wells after aspirating the supernatant, and the cells were incubated at 37°C and 5% CO2. Observation under an inverted fluorescence microscope indicated that the experimental system was established when a large number of cells in each well of the virus control group showed fluorescence, while the cells in the cell control group remained fully grown and showed no fluorescence. The degree of disease in each well was counted and recorded, and the interferon titer was calculated according to the Reed-Muench method.

[0106] 2 Test results

[0107] 2.1 Identification of recombinant transfer vectors

[0108] The recombinant transfer vector pBR-GcIFNγ was double-digested with BamHI and EcoRI and identified by 1% agarose gel electrophoresis. The target gene fragment was about 500bp. The electrophoresis results were consistent with the theoretical results. The double-digestion results of the recombinant transfer vector were as follows: Figure 2 The plasmid identified by enzyme digestion was sent to the company for nucleotide sequencing. The sequencing results were compared with the electronic cloning map sequence using SnapGene software, which was consistent with the sequence of the electronic cloning map, indicating that grass carp gamma interferon had been inserted into the pBR transfer vector and pBR-GcIFNγ was successfully constructed.

[0109] 2.2 Obtaining grass carp interferon-γ recombinant virus and detecting the recombinant product

[0110] The supernatant containing the Luc fluorescent-tagged plasmid was centrifuged, collected, and cells were lysed. Luciferase substrate was then added to the supernatant for a mixed reaction. Detection by a photon analyzer revealed a photon count of 4 million cpm, which was greater than 2 million cpm. This data indicated that the transfection effect of this batch was good.

[0111] The purified reBmBac-GcIFNγ supernatant prepared in this batch was injected into silkworms and silkworm pupae, wherein the silkworms became ill at about 96 hours. Figure 3 As shown. Healthy silkworms have normal body color and are in overall healthy condition ( Figure 3 -(a)); The affected silkworms showed yellow body color, high protrusion of intersegmental membrane, frantic crawling, and no longer consuming mulberry leaves ( Figure 3 -(b)). After collecting silkworm hemolymph, the luciferase expression level of the reBmBac-Luc group was measured. The expression level reached over 40 million cpm as measured by a photon analyzer, indicating that the silkworms were healthy, free of wild virus contamination, and suitable for target protein expression.

[0112] To ensure the normal expression of the target gene in silkworms, the collected silkworm blood was processed and PCR was performed using the silkworm blood as a template and primers designed on both sides of the target gene to verify whether the target gene was successfully expressed in the silkworm blood. Figure 4 As shown in the figure, a band appeared at around 500 bp, which is consistent with the size of the target band, indicating that the target gene was successfully expressed in silkworms.

[0113] 2.3 Antiviral activity detection of GcIFNγ

[0114] The activity of fish interferon was calibrated with reference to the national standard method for determining the activity of human interferon, and the antiviral activity of grass carp gamma interferon was detected on the Vero / VSV*GFP system using the microcytopathic effect inhibition method. An inverted fluorescence microscope was used to observe the state of cells. The cells in the negative control group grew well, and no fluorescence appeared in the dark field; the cells in the positive control group (virus-induced disease) became diseased, and green fluorescence appeared in all eight replicate wells. The disease was observed in sequence according to the virus dilution gradient, and it was found that the grass carp gamma interferon pretreatment group could effectively inhibit the fluorescence number, that is, it had an antiviral effect. In order to quantify the inhibitory effect of interferon, the wells with green fluorescence were recorded as "+", and the wells without green fluorescence were recorded as " - ", some wells suspected to be false positive or with weak fluorescence were marked as "±", as shown in the schematic diagram Figure 5 Finally, the interferon potency was calculated based on the recorded results and the Reed-Muench method. The potency of grass carp interferon-γ was 10 4.17 U / mL, indicating that GcIFNγ expressed in silkworm larvae has a more significant antiviral activity.

[0115] Experimental Example 2 Expression and determination of grass carp interferon-γ and ferritin fusion protein in a eukaryotic expression system

[0116] 1 Test method

[0117] 1.1 Target gene synthesis

[0118] The grass carp ferritin sequence information was searched on the NCBI website. After comparison and integration, the amino acid sequence with the NCBI accession number XP_051756079.1 was finally determined to be the original sequence. Its amino acid sequence is shown in SEQ ID NO.6, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.7.

[0119] The amino acid sequence of grass carp ferritin is shown in SEQ ID NO.6:

[0120]

[0121]

[0122] The nucleotide sequence of the gene encoding grass carp ferritin is shown in SEQ ID NO.7:

[0123]

[0124] The present invention utilizes OptimumGene TMThe technology was used to codon-optimize the nucleotide sequence of the above-mentioned ferritin subunit gene, and the gene sequence was modified according to the codon preference of the bioreactor silkworm. Various relevant parameters that affect gene transcription efficiency, translation efficiency and protein folding, such as GC content, CpG dinucleotide content, codon preference, mRNA secondary structure, mRNA free energy stability, RNA instability motif, and repetitive sequence, were optimized and designed. This is beneficial to improving the transcription efficiency and translation efficiency of the optimized gene in silkworm, while keeping the final translated protein sequence unchanged. The nucleotide sequence after codon optimization is shown in SEQ ID NO.8.

[0125] The nucleotide sequence of the grass carp ferritin coding gene after codon optimization is shown in SEQ ID NO.8:

[0126]

[0127] According to the ferritin sequence, AlphaFold was used to analyze its structure. To ensure that interferon was not encapsulated by ferritin and to facilitate the efficient expression of the grass carp gamma interferon and grass carp ferritin heavy chain subunit fusion protein, the selected grass carp ferritin amino acid sequence was edited and optimized, and the tail 17 amino acids were removed. The adjusted and optimized amino acid sequence is shown in SEQ ID NO.9, and a linker (GGGSGGGGSGGGS (SEQ ID NO.10)) was added to the C-terminus. DNAman software was used to analyze restriction enzyme sites. According to the results of the enzyme site analysis and the multiple cloning sites on the transfer vectors pBR and pUC57, restriction enzyme sites that did not exist in the target gene sequence were added to both ends of the target gene. According to the analysis results, a BamHI enzyme site, a protective base, and a Kozak sequence were added to the 5' end, an EcoRI enzyme site and a protective base were added to the 3' end, and TAA was used as the stop codon. The determined gene sequence was synthesized by the company and inserted into the pUC57 vector to form the plasmid pUC57-Fe.

[0128] The optimized amino acid sequence of grass carp ferritin is shown in SEQ ID NO.9:

[0129]

[0130] 1.2 Construction of grass carp interferon-γ and ferritin subunit fusion expression plasmid

[0131] First, the (pUC57-Fe) plasmid containing the ferritin sequence synthesized by the company was amplified and preserved. The ferritin sequence and the pBR-GcIFNγ sequence constructed in Experimental Example 1 were analyzed using SnapGene software to design recombination primers. The ferritin subunit sequence and pBR-GcIFNγ were amplified by PCR according to the grass carp gamma interferon sequence. The PCR amplification reaction system and reaction conditions are shown in Tables 3 and 4. After that, electrophoresis was performed on a 1% agarose gel, and the gel was recovered using a kit; and double-digested with BamHI and EcoRI, and the pBR vector and target gene product after enzyme digestion were recovered from the gel after electrophoresis. After determining the concentration of the gel-recovered sample, the recombinant loading ratio was calculated according to the measured concentration, and the recombination seamless cloning technology was used for recombinant connection. After that, it was transformed into the Escherichia coli competent cell Trans5α, the positive clones were selected, and sent to the company for sequencing.

[0132] Recombinant PCR primers:

[0133] Fe-F: CCGCCAACATGAGCAGCCAAGTGCGT;

[0134] Fe-γ-R: GGAACCGCTGCTGCCACCGCCGCTACC.

[0135] Fe-γ-F: CACCGTCGAGCGTTCCGGAGAACCTGGACAAG;

[0136] GcIFNγ-R: CGGAATTCTTAGCTTTTTTGACGCTT.

[0137] Table 3 PCR amplification reaction system

[0138]

[0139] Table 4 PCR amplification reaction conditions

[0140]

[0141]

[0142] 1.3 Acquisition, purification and amplification of recombinant silkworm baculovirus

[0143] Replace pBR-GcIFNγ with pBR-Ferritin-GcIFNγ. Other steps and conditions are the same as those in 1.3 of Experimental Example 1.

[0144] 1.4 Identification of reBmBac-Ferritin-GcIFNγ and its expression in a silkworm bioreactor

[0145] reBmBac-GcIFNγ was replaced with reBmBac-Ferritin-GcIFNγ. The PCR primers used were as follows. The annealing temperature of the PCR reaction was 65°C. Other steps and conditions were the same as those in 1.4 of Experimental Example 1.

[0146] The PCR identification primer sequences are as follows:

[0147] F: GCTCTGTCCGTTTGCTGGCAACTGC;

[0148] R: CGATTAACTTCATGGTATCGGGTTTCACACTGCG.

[0149] 1.5 Antiviral activity detection of Ferritin-GcIFNγ

[0150] Same as 1.5 in Test Example 1.

[0151] 2 Test results

[0152] 2.1 Identification of recombinant transfer vectors

[0153] The recombinant transfer vector pBR-Ferritin-GcIFNγ was double-digested with BamHI and EcoRI and identified by 1% agarose gel electrophoresis. The target gene fragment was about 1000bp. The electrophoresis results were consistent with the theoretical results. The double-digestion results of the recombinant transfer vector were as follows: Figure 6 The plasmid identified by enzyme digestion was sent to the company for nucleotide sequencing. The sequencing results were aligned with the electronic cloning map sequence using SnapGene software, indicating that the grass carp gamma interferon was successfully linked to the ferritin subunit and successfully inserted into the pBR transfer vector. The pBR-Ferritin-GcIFNγ was successfully constructed.

[0154] The amino acid sequence of the fusion protein is shown in SEQ ID NO.11:

[0155]

[0156] 2.2 Obtaining the recombinant virus reBmBac-Ferritin-GcIFNγ and detecting the recombinant product

[0157] The successfully constructed fusion protein recombinant transfer vector was co-transfected with laboratory-stored Bombyx mori baculovirus BmBac DNA into BmN cells. After about five days, the cells were observed to see if they shed. The supernatant from samples with shed cells was collected, along with the supernatant from a control plasmid (carrying a Luc tag). The photon count of the supernatant from the control well was measured at 8 million cpm. This value, greater than 2 million cpm, indicated that this co-transfection batch was successful and suitable for use in subsequent experiments.

[0158] 2.3 Expression and identification of the recombinant product reBmBac-Ferritin-GcIFNγ in silkworms

[0159] The purified reBmBac-Ferritin-GcIFNγ supernatant prepared in this batch was injected into silkworms and silkworm pupae. The silkworms became obviously ill around 96 hours after infection. The hemolymph of the diseased silkworms was collected and stored at -20°C. PCR was used to identify whether the recombinant product (reBmBac-Ferritin-GcIFNγ) was successfully expressed in the silkworms. The test results are shown in Figure 2. Figure 7 As shown in the figure, a thick band appeared at about 1000 bp, which was consistent with the size of the target band, indicating that the fusion protein was successfully expressed in the silkworm bioreactor.

[0160] 2.4 Antiviral activity detection of Ferritin-GcIFNγ

[0161] The same as Experimental Example 1, the microcytopathic effect inhibition method was used to detect the antiviral activity of Ferritin-GcIFNγ expressed in the silkworm eukaryotic expression system on the Vero / VSV*GFP system. An inverted fluorescence microscope was used to observe the cell status. The cells in the negative control group grew well and no fluorescence appeared in the dark field; the cells in the positive control group (virus-induced) had pathological changes, and all eight replicate wells showed green fluorescence. The disease was observed in sequence according to the virus dilution gradient, and it was found that the Ferritin-GcIFNγ treatment group could effectively inhibit the fluorescence number, that is, it had an antiviral effect. To quantify the inhibitory effect of interferon, the wells with green fluorescence were marked as "+", and the wells without green fluorescence were marked as " - ", some wells suspected to be false positive or with weak fluorescence were marked as "±", as shown in the schematic diagram Figure 5 Finally, the titer of interferon was calculated based on the recorded results and the Reed-Muench method. The titer of Ferritin-GcIFNγ was 10 4.8 U / mL, compared with the expression of interferon-γ alone, the antiviral effect of grass carp interferon-γ expressed by ferritin was better, and the antiviral activity of interferon was increased by about 4 times compared with the expression alone, indicating that the fusion protein formed by the combination of interferon and ferritin in the eukaryotic expression system has high antiviral activity. Experimental Example 3 Expression and Detection of Grass Carp Interferon-γ Mutants in Silkworm Bioreactor

[0162] 1 Test method

[0163] 1.1 Construction of grass carp interferon-γ mutant gene

[0164] In Experimental Example 2, the method of expressing the fusion protein in the eukaryotic system effectively improved the antiviral effect of interferon. In order to further optimize the expression of Ferritin-GcIFNγ, the full-length structure prediction analysis was performed based on the amino acid sequence of grass carp gamma interferon in Experimental Example 1. Figure 1 The structural characteristics of grass carp gamma interferon are shown in FIG. A large number of mutant sites are designed in the α-helix region. After the mutation sites are designed according to the full-length structural characteristics, in order to optimize the expression efficiency, a series of optimized nucleotide sequences in Experimental Example 1 are used for subsequent experiments during expression. The mutation operation is based on the pBR-Ferritin-GcIFNγ obtained in Experimental Example 2, and the grass carp gamma interferon mutant gene recombinant vector pBR-Ferritin-GcIFNγ-X is constructed.

[0165] Multiple pairs of primers were designed to perform site-directed mutagenesis on pBR-Ferritin-GcIFNγ shown in SEQ ID NO. 11. Five sites with good antiviral effects were used as examples: A188L, L222P, R233S, V254I, and K260R. The mutants were named: Ferritin-GcIFNγ-A188L, Ferritin-GcIFNγ-L222P, Ferritin-GcIFNγ-R233S, Ferritin-GcIFNγ-V254I, and Ferritin-GcIFNγ-K260R. The primers required for amino acid site mutagenesis of the mutant nucleotide sequences are as follows:

[0166] (1) Upstream and downstream primers on both sides:

[0167] F: CGGGATCCGCCACCATGA;

[0168] R: CGGAATTCTTAGCTTTTTTGACGCTT.

[0169] (2) Single site mutation intermediate upstream and downstream primers:

[0170] 1.F: CGATGAACTGAAGCTGTACTACATT;

[0171] 1.R:TCTTTAATGTAGTACAGCTTCAGTTCATCG.

[0172] 2.F:GCGAACAGAACCTGCCGATGA;

[0173] 2.R:GTCCATAATGATGCTCATCGGCAG.

[0174] 3.F:GACACCTACAGCAGCATTTTCAC;

[0175] 3.R:GCATGCTGGTGAAAATACGGC.

[0176] 4.F:GCGTCTGGCTCACATTCA;

[0177] 4R: TGTTCAGCAATAACCTGAAAAAGCT.

[0178] 5.F:CGTTCAGCAACACCTGAAACGTC;

[0179] 5.R:GGGAAGTAGTTTTCTTTGCAGACGTTTC.

[0180] 1.2 Construction of recombinant baculovirus transfer vector

[0181] The PCR product was run on a gel and recovered from the gel. The recovered gel product was seamlessly cloned and homologously recombined with the baculovirus transfer vector pBR that had been double-enzyme digested and inactivated. Homologous recombinase was added, and the cells were incubated at 50°C for 15 minutes. After an ice bath at 4°C for 5 minutes, the recombinant product was transformed into Escherichia coli competent cells TOP10. Colonies were selected for culture, and plasmids were extracted. Positive clones were identified by double-enzyme digestion with BamHI and EcoRI. The correctly identified recombinant plasmid was sent to the company for sequencing. The correctly sequenced plasmid was named pBR-Ferritin-GcIFNγ-X (A188L, L222P, R233S, V254I, K260R. The vector and virus are named according to the mutation site, the same below).

[0182] 1.3 Acquisition, purification and amplification of recombinant silkworm baculovirus

[0183] The recombinant virus is named reBmBac-Ferritin-GcIFNγ-X, and the other steps and conditions are the same as those in 1.3 of Experimental Example 1.

[0184] 1.4 Expression of grass carp interferon-γ mutant in silkworms

[0185] The nucleotide sequence of the PCR identification primer was the same as that in 1.4 of Experimental Example 2, and the other steps and conditions were the same as those in 1.4 of Experimental Example 1.

[0186] 1.5 Antiviral activity detection of grass carp interferon-γ mutant protein

[0187] Same as 1.5 in Test Example 1.

[0188] 2 Test results

[0189] 2.1 Identification of recombinant transfer vectors

[0190] The recombinant transfer vector pBR-Ferritin-GcIFNγ-X was double-digested with BamHI and EcoRI. 1% agarose gel electrophoresis showed that the large fragment was located below 8000 bp, consistent with the size of the pBR fragment 7618 bp, and the small fragment was around 1000 bp, consistent with the size of the target gene fragment 990 bp. To further determine whether the mutation site was successfully mutated, the plasmid identified as correct by enzyme digestion was sent to the company for nucleotide sequencing. The results of MegaAlign alignment showed that the sequence was consistent with the originally designed sequence, indicating that the Ferritin-GcIFNγ-X mutant gene had been successfully inserted between BamHI and EcoRI in the pBR transfer vector.

[0191] 2.2 Obtaining recombinant viruses and detecting recombinant products

[0192] The successfully constructed mutant plasmid was labeled, extracted, and stored in large quantities. After measuring the plasmid concentration, it was co-transfected into BmN cells with Bombyx mori baculovirus (BmBac) DNA stored in the laboratory. The target gene plasmid:BmBac DNA ratio was approximately 1:2, and the total plasmid concentration to the actual transfection volume was approximately 1:1. Medium was added 6 hours after transfection, and after 96 hours, the supernatant was collected when partial cell detachment was observed. The supernatant was also collected from a transfection control plasmid (carrying a Luc tag) sample. The photon count of the control supernatant was measured to be 60 million cpm. If this value is greater than 2 million cpm, the preparation of this batch of recombinant virus is good and can be used for subsequent experiments.

[0193] 2.3 Expression and identification of the recombinant Ferritin-GcIFNγ-X product in silkworms

[0194] As in Experiment 1, the antiviral activity of grass carp interferon-γ expressed in silkworm larvae was detected using the microcytopathic effect inhibition assay on the Vero / VSV*GFP system. The interferon titer was calculated according to the Reed-Muench method. The mutations listed in the text are the corresponding mutations with prominent effects among the large number of mutations. The antiviral activity test results of these nine mutants are shown in Table 5 below. The test results show that the grass carp interferon-γ mutants K181R, A188L, R206H, L222P, R233S, H253Y, V254I, K260R, and D315E have a titer of 10 3.59 U / mL—10 5.91U / mL, among which A188L, L222P, R233S, V254I, and K260R mutations resulted in a slightly higher expression titer of the grass carp interferon-γ mutant than that measured by ferritin expression, further enhancing the expression activity of grass carp interferon-γ. Mutations in the remaining sites maintained or even decreased the titer, indicating that mutations in these five sites are effective mutations that can enhance the antiviral activity of GcIFNγ and Ferritin-GcIFNγ. Among them, the Ferritin-GcIFNγ-K260R mutant exhibited the strongest antiviral activity. The amino acid sequence of the grass carp interferon-γ fusion protein mutant K260R is shown in SEQ ID NO.12.

[0195] Table 5 Detection results of antiviral activity of recombinant grass carp interferon-γ single site mutations

[0196]

[0197] The amino acid sequence of the grass carp interferon-γ fusion protein mutant K260R is shown below:

[0198]

[0199]

Claims

1. Grass carp interferon-γ, characterized in that: Its amino acid sequence is shown in SEQ ID NO.

4.

2. The grass carp interferon-γ coding gene according to claim 1, characterized in that Its nucleotide sequence is shown in SEQ ID NO.

5.

3. A gene encoding grass carp interferon-γ, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

3.

4. A fusion protein, characterized in that The method is obtained by connecting grass carp gamma interferon to the C-terminus of a monomeric ferritin subunit via a connecting peptide.

5. The fusion protein according to claim 4, characterized in that The amino acid sequence of the grass carp gamma interferon is shown in SEQ ID NO.1 or SEQ ID NO.4; the ferritin subunit includes any one of a vertebrate ferritin subunit, a plant ferritin subunit, and a bacterial ferritin subunit; preferably, the ferritin is a grass carp ferritin heavy chain subunit, and its amino acid sequence is shown in SEQ ID NO.6 or SEQ ID NO.9; the connecting peptide sequence is shown in SEQ ID NO.10; most preferably, the amino acid sequence of the fusion protein is shown in SEQ ID NO.

11.

6. The mutant of the fusion protein according to claim 5, characterized in that Based on the amino acid sequence shown in SEQ ID NO.11, any one of A188L, L222P, R233S, V254I or K260R single-site mutations was performed.

7. A gene encoding the fusion protein of claim 5 or a gene encoding a mutant of the fusion protein of claim 6.

8. A recombinant expression vector or recombinant host cell containing the encoding gene according to claim 2, 3 or 7.

9. A method for preparing the grass carp interferon-γ according to claim 1, the fusion protein according to claim 4 or 5, or the mutant according to claim 6, characterized in that: include: (1) structural analysis and optimized synthesis of the coding gene of the fusion protein or mutant; (2) cloning the coding gene of the grass carp interferon-γ, the fusion protein or the mutant into a eukaryotic expression vector to construct a recombinant transfer vector; (3) co-transfecting the constructed recombinant transfer vector and baculovirus DNA into insect cells to obtain recombinant baculovirus; (4) The recombinant baculovirus infects host cells, and is propagated in insect cells or insect hosts, and the protein is purified. The baculovirus transfer vector is preferably selected from any one of Bac to Bac, AcRP23-lacZ, pAc373, pBR1393, pBR, Bacmid, pAc360, pBR1391, pP10, pPBac, pVTBac or pUAC-5; The baculovirus is preferably any one of the Bombyx mori baculovirus parent strains AcMNPV, BmBac, BmNPV, SeMNPV, ApNPV, OpMNPV, SlMNPV or SpltNPV; The insect host is preferably selected from any one of the group consisting of Bombyx mori, Bombyx mandarina, Philosamia cynthia ricim, Dictyoploca japanica, Philosamia cynthiapryeri, Antheraea pernyi and Antheraea yamamai; The infection refers to the recombinant baculovirus infecting 1-5 instar insect larvae or pupae by ingestion or penetration through the epidermis; preferably, the recombinant silkworm baculovirus is used to infect silkworm cells or puncture-inoculate 1-5 instar silkworm larvae or pupae, and body fluids or tissue homogenates of the silkworm larvae or pupae containing various grass carp gamma interferon genes are collected 3-6 days after infection; wherein, the pupae are most preferably early tender pupae of 1-2 days old. Most preferably, the baculovirus transfer vector is pBR; the baculovirus is Bombyx mori baculovirus; and the insect host is Bombyx mori.

10. Use of the grass carp interferon-γ according to claim 1, the fusion protein according to claim 4 or 5, or the mutant according to claim 6 in preparing drugs for improving grass carp immunity or resisting grass carp viruses.

Citation Information

Patent Citations

  • Insect bioreactors expressing multiple exogenous genes, their construction methods and applications

    CN102286534A

Cited By

  • Fusion protein of cytokine and ferritin subunit as well as preparation method and application of fusion protein

    CN117327194A

  • Bovine I-type alpha interferon-ferritin fusion protein, and mutant, preparation method and application of bovine I-type alpha interferon-ferritin fusion protein

    CN121293376A

  • Bovine II type gamma-interferon-ferritin fusion protein, and mutant, preparation method and application thereof

    CN122103378A