PiRNA marker for diagnosing and evaluating sepsis cardiomyopathy, kit and application thereof

Abstract

The invention discloses application of a substance for detecting a piRNA marker. The application comprises one or more of the following applications: A1) application in preparation of a product for diagnosing sepsis cardiomyopathy; a2) in preparation of a product for screening sepsis cardiomyopathy; a3) in preparation of a product for evaluating sepsis cardiomyopathy risk; a4) in preparation of a sepsis cardiomyopathy condition assessment product; a5) in preparation of products for identifying and distinguishing sepsis cardiomyopathy and other diseases; the piRNA marker is hsapiR019301, and the nucleotide sequence of the piRNA marker is as shown in SEQ ID No. 1. The expression quantity of the hsapiR019301 marker provided by the invention in plasma of a patient with sepsis cardiomyopathy is obviously increased compared with that of a healthy control person, so that the hsapiR019301 marker is indicated to be a potential biomarker for the sepsis cardiomyopathy. The ROC curve of the efficacy in the aspect of diagnosing sepsis cardiomyopathy patients shows that the hsapiR019301 has good diagnosis efficacy.

Description

Technical Field

[0001] The present invention relates to a marker for diagnosing septic cardiomyopathy, specifically a piRNA marker, and also relates to a kit for detecting the piRNA marker and application thereof, belonging to the field of medical molecular diagnosis. Background Art

[0002] Since 2016, sepsis has been defined as life-threatening organ dysfunction caused by a dysregulated host response to infection. When the inflammatory state persists, severe organ damage can result. Septic cardiomyopathy, in particular, is a systemic disease with devastating consequences for the patient's health. Septic cardiomyopathy was first described in 1921 by E. Romberg in his Textbook of Cardiac and Vascular Diseases as an infectious acute myocarditis (septic acute myocarditis), before the advent of antibiotics. Infection leads to a dysregulated host response, which in turn causes organ dysfunction, disability, and even death. In such cases, vasopressor infusions are often required to maintain blood pressure. The mortality rate for patients with sepsis is approximately 10%, while that of patients with septic cardiomyopathy often exceeds 40%. Progressive cardiovascular dysfunction is often the final stage of septic shock. Understanding cardiac dysfunction in sepsis is particularly important given the central role of circulatory disturbances in disrupting multi-organ function.

[0003] How to improve the ability to diagnose septic cardiomyopathy early has always been an important topic in the field of cardiovascular disease research. Common methods for evaluating cardiac function in the clinic include echocardiography and electrophysiological testing, but these methods can only detect abnormalities when there are organic changes in the heart and a significant decline in function. In addition, most of the biomarkers commonly used in clinical practice are protein markers, such as cardiac troponin I (cTnI), creatine kinase isoenzyme (CK-MB), and myoglobin (Myo), which are released by cardiomyocytes when myocardial damage occurs. However, these protein biomarkers have certain limitations. For example, their increase requires a certain amount of time to be detected, and therefore cannot meet the needs of early diagnosis of septic cardiomyopathy.

[0004] With the continuous advancement of high-throughput sequencing technology, piwi-interacting RNAs (piRNAs) have gradually attracted great interest among researchers. piRNAs are a class of small noncoding RNAs (24-31 nucleotides) in length that can be divided into three groups based on their origin: messenger RNA (mRNA)-derived piRNAs, transposon-derived piRNAs, and long noncoding RNA (lncRNA)-derived piRNAs. piRNAs bind to PIWI proteins to form piRNA / PIWI silencing complexes. In somatic cells and germline tissues of diverse organisms, piRNAs regulate a variety of physiological and pathological activities at both transcriptional and posttranscriptional levels. At the transcriptional level, PIWI proteins and piRNAs can modify histones and chromatin methylation, which is an essential epigenetic modification. At the posttranscriptional level, piRNAs participate in a variety of functions, including regulation of gene and protein expression, genome rearrangements, spermatogenesis, and transposon silencing (TEs). Based on these properties, piRNAs have the potential to become novel diagnostic biomarkers for septic cardiomyopathy, offering new possibilities for early diagnosis and treatment. Summary of the Invention

[0005] The primary technical problem to be solved by the present invention is to provide an application of a new piRNA marker, which can be prepared for diagnosis, screening, as a therapeutic target, assessment of septic cardiomyopathy, and differentiation of septic cardiomyopathy from other disease substances.

[0006] Another technical problem to be solved by the present invention is to provide a kit for detecting new piRNA markers, which can be used for diagnosis, screening, as a therapeutic target, assessment of septic cardiomyopathy, and differentiation of septic cardiomyopathy from other diseases.

[0007] Another technical problem to be solved by the present invention is to provide a primer for detecting new piRNA markers.

[0008] In order to achieve the above technical objectives, the present invention adopts the following technical solutions:

[0009] According to a first aspect of an embodiment of the present invention, there is provided an application of a substance for detecting piRNA markers, including one or more of the following applications:

[0010] A1) Application in the preparation of products for diagnosing septic cardiomyopathy;

[0011] A2) Application in the preparation of a product for screening septic cardiomyopathy;

[0012] A3) Use in the preparation of a product for treating myocardial sepsis;

[0013] A4) Application in the preparation of a product for assessing septic cardiomyopathy;

[0014] A5) Application in the preparation of products for identifying and distinguishing septic cardiomyopathy from other diseases;

[0015] The piRNA marker is hsa_piR_019301, and the nucleotide sequence is shown in SEQ ID No.1.

[0016] The "product" described above can be a product for diagnosing septic cardiomyopathy by detecting the expression level of hsa_piR_019301 through RT-PCR, real-time quantitative PCR, in situ hybridization, chip or high-throughput sequencing platform.

[0017] In the above application, hsa_piR_019301 expression was significantly upregulated in the plasma samples of patients with septic cardiomyopathy; the expression level of hsa_piR_019301 in healthy people was significantly lower than that in patients with septic cardiomyopathy.

[0018] Preferably, the substance is a reagent for detecting the expression level of hsa_piR_019301, or a reagent for specifically identifying hsa_piR_019301, or a reagent for detecting the content of hsa_piR_019301.

[0019] Preferably, the substance is a substance for detecting hsa_piR_019301, specifically the following a), b) or c)

[0020] a) primers for detecting or specifically recognizing hsa_piR_019301;

[0021] b) a reagent set containing the reagent described in a);

[0022] c) A kit containing a) or b).

[0023] Preferably, the primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0024] According to a second aspect of an embodiment of the present invention, a kit for detecting piRNA markers is provided, wherein the kit comprises one or more of the following applications:

[0025] A1) Application in the preparation of products for diagnosing septic cardiomyopathy;

[0026] A2) Application in the preparation of a product for screening septic cardiomyopathy;

[0027] A3) Use in the preparation of a product for treating septic cardiomyopathy;

[0028] A4) Application in the preparation of a product for assessing septic cardiomyopathy;

[0029] A5) Application in the preparation of products for identifying and distinguishing septic cardiomyopathy from other diseases;

[0030] The piRNA marker is hsa_piR_019301, and the nucleotide sequence is shown in SEQ ID No. 1; the kit includes a reagent for detecting or specifically identifying hsa_piR_019301, or a reagent for detecting the expression level of hsa_piR_019301.

[0031] The kit provided by the present invention can be used to detect the expression of the hsa_piR_019301 characteristic gene sequence shown in SEQ ID NO.1 in the peripheral blood of the subject, and then the probability of septic cardiomyopathy in the subject can be judged based on the information of upregulation or downregulation of these gene expressions, thereby realizing the diagnosis and screening of septic cardiomyopathy.

[0032] The kits provided herein may include appropriate packaging and instructions for use in the methods disclosed herein. The detection kits provided herein are nucleic acid detection kits that include reagents required for RNA extraction and real-time quantitative PCR (qRT-PCR). The kits may further include an appropriate buffer and polymerase, and may also include control primers and / or probes.

[0033] Preferably, the reagent for detecting or specifically identifying hsa_piR_019301 is a specific primer, and the specific primer is the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0034] According to a third aspect of an embodiment of the present invention, a primer for detecting a piRNA marker is provided, wherein the primer comprises one or more of the following applications:

[0035] A1) Application in the preparation of products for diagnosing septic cardiomyopathy;

[0036] A2) Application in the preparation of a product for screening septic cardiomyopathy;

[0037] A3) Use in the preparation of a product for treating septic cardiomyopathy;

[0038] A4) Application in the preparation of a product for assessing septic cardiomyopathy;

[0039] A5) Application in the preparation of products for identifying and distinguishing septic cardiomyopathy from other diseases;

[0040] The primers are primers for detecting the expression level of hsa_piR_019301 or specifically identifying hsa_piR_019301.

[0041] Preferably, the primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0042] Compared with the prior art, the present invention has the following technical effects:

[0043] (1) The present invention provides a piRNA marker, hsa_piR_019301, which can be used as a diagnostic tool for septic cardiomyopathy. Clinical validation trials showed that the expression level of hsa_piR_019301 in the plasma of patients with septic cardiomyopathy was significantly higher than that in healthy controls, indicating that hsa_piR_019301 is a potential biomarker for the early diagnosis of septic cardiomyopathy.

[0044] (2) Further analysis showed that the efficacy of hsa_piR_019301 in diagnosing patients with septic cardiomyopathy was verified by ROC curve analysis, with excellent sensitivity and specificity, indicating that this marker has good diagnostic efficacy. In addition, compared with traditional cardiac troponin I (cTnI), hsa_piR_019301 showed higher accuracy in predicting the 28-day mortality rate of patients with septic cardiomyopathy, suggesting that it may have greater value in clinical applications.

[0045] (3) In clinical trials, the study found that CK-MB and interleukin-6 (IL-6) in patient plasma were positively correlated with the expression of hsa_piR_019301. CK-MB is a marker of myocardial cell damage, while IL-6 reflects the inflammatory response of myocardial cells and the whole body. The combined detection of the two can reflect the severity of septic cardiomyopathy, and the correlation between the expression level of hsa_piR_019301 and these indicators indicates that its level in plasma can effectively reflect the severity of the disease.

[0046] (4) In an in vitro cellular experiment, the expression changes of hsa_piR_019301 were verified in an AC16 cardiomyocyte model treated with lipopolysaccharide (LPS). The results showed that after simulated sepsis stimulation, the expression level of hsa_piR_019301 in cardiomyocytes was significantly increased, which provides a cellular and molecular basis for the use of this marker as a diagnostic tool.

[0047] (5) Finally, cytological experiments also verified the effects of hsa_piR_019301 knockdown. The experiments showed that knockdown of hsa_piR_019301 could reduce the expression levels of CK-MB and IL-6, and alleviate the damage of septic cardiomyocytes. In addition, the LPS-induced increase in hsa_piR_019301 expression and cell death were significantly improved after knockdown of this marker, indicating that hsa_piR_019301 is not only an effective diagnostic marker, but also a potential therapeutic target for septic cardiomyopathy. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 The volcano plot of piRNA expression differences between the septic cardiomyopathy cell model and normal controls was obtained for the sequenced LPS-induced AC16 cardiomyocytes;

[0049] Figure 2 To determine the hsa_piR_019301 level in the plasma of patients with septic cardiomyopathy and normal controls using qRT-PCR;

[0050] Figure 3 ROC curve for hsa_piR_019301 in diagnosing patients with septic cardiomyopathy;

[0051] Figure 4 ROC curves for hsa_piR_019301 and cTnI in predicting 28-day mortality in patients with septic cardiomyopathy in the external validation cohort;

[0052] Figure 5A The relationship between CK-MB and hsa_piR_019301 expression in patients;

[0053] Figure 5B is the relationship between the expression levels of IL-6 and hsa_piR_019301 in patients;

[0054] Figure 6 is the relationship between the percentage of dead cells and the expression level of hsa_piR_019301 in LPS-induced cardiomyocytes;

[0055] Figure 7A Figure 2 is the expression level of hsa_piR_019301 after AC16 cardiomyocytes were transfected with small interfering RNA (siRNA) of hsa_piR_019301;

[0056] Figure 7B This is a graph showing the mRNA expression level after AC16 cardiomyocytes were transfected with hsa_piR_019301 siRNA;

[0057] Figure 8AThe expression of LPS-induced cardiomyocyte CM-MBs after siRNA knockdown of hsa_piR_019301 in AC16 cardiomyocytes;

[0058] Figure 8B The expression of LPS-induced cardiomyocyte IL-6 in AC16 cardiomyocytes after siRNA knockdown of hsa_piR_019301;

[0059] Figure 9 The changes in the proportion of myocardial cell death in AC16 cardiomyocytes of the hsa_piR_019301 knockdown group and the control group after LPS treatment. DETAILED DESCRIPTION

[0060] The present invention is further described below with reference to specific examples. These examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. Experimental methods in the following examples, where specific conditions are not specified, are generally performed under conventional conditions or according to the conditions recommended by the manufacturer. Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred embodiments and materials described herein are for exemplary purposes only.

[0061] First, total RNA was extracted from three LPS-induced AC16 cardiomyocytes and three normal control cells. The cells were then sent to Guangzhou Epigenetics for piRNA sequencing. PiRNAs with significant differences in expression (Fold change ≥ 2.0, P value < 0.05) were identified. qRT-PCR was then used to measure the levels of the top 10 piRNAs in the patient plasma, and the first piRNA with a significant increase was selected for subsequent experiments. The inventors then used in vitro cell-based assays to further validate the relationship between hsa_piR_019301 expression and septic cardiomyopathy. The specific data are shown below.

[0062] Example 1 Screening and correlation study of piRNA markers in septic cardiomyopathy

[0063] 1. Clinical samples:

[0064] Methods: Patients with sepsis and septic shock admitted to the Department of Critical Care Medicine of the General Hospital of PLA from 2020 to 2023 were collected and divided into a non-septic cardiomyopathy group (50 cases) and a septic cardiomyopathy group (50 cases) according to whether septic cardiomyopathy occurred.

[0065] An external validation cohort (2022-2023) was also selected from Fuwai Hospital: a non-septic cardiomyopathy group (45 patients) and a septic cardiomyopathy group (44 patients). Blood samples and relevant laboratory test results were collected. The diagnostic criteria for septic cardiomyopathy are: a decreased left ventricular stroke work index (indicating decreased myocardial contractility) on PiCCO monitoring and clinical exclusion of possible coronary artery obstruction.

[0066] Inclusion criteria: ① The definition and diagnostic criteria of Sepsis 3.0 jointly released by the American Society of Critical Care Medicine and the European Society of Intensive Care Medicine in 2016 were met: acute change in the Sequential Organ Failure Score score associated with sepsis ≥ 2 points; ② Diagnostic criteria for septic shock: sepsis patients still had persistent hypotension after adequate fluid resuscitation, required vasoactive drugs to maintain mean arterial pressure ≥ 65 mmHg and serum lactate level ≥ 2 mmol / L.

[0067] Exclusion criteria: ① Age younger than 18 years or older than 70 years; ② Concurrent acute myocardial infarction, myocarditis, cardiomyopathy, valvular heart disease, cardiopulmonary resuscitation, defibrillation and cardioversion, or cardiac surgery; ③ Pregnancy, lactation, tumor, extensive burns, human immunodeficiency virus (HIV) infection, or long-term use of immunosuppressants; ④ ICU stay of less than 24 hours; ⑤ Clinical data were not collected within 6 hours of admission; ⑥ Treatment waiver or voluntary discharge.

[0068] 2. Plasma extraction:

[0069] Human peripheral blood was collected using EDTA anticoagulant blood collection tubes, centrifuged at 2500 g for 15 min, and the upper plasma was transferred to a 2 ml sterile tube and frozen in a -80 °C refrigerator.

[0070] 3. RNA extraction and qRT-PCR:

[0071] RNA extraction

[0072] Total RNA was extracted from plasma using the RNAsimple Total RNA Kit (DP419, TIANGEN). Add 1 ml of TRIZOL Reagent and 200 μl of chloroform to the plasma, shake for 20 seconds, and incubate at room temperature for 10 minutes. Centrifuge at 13,000 rpm at 4°C for 15 minutes. Carefully aspirate the supernatant, add 800 μl of isopropanol, gently mix by inversion, incubate at -20°C for 1 hour, and centrifuge at 13,000 rpm at 4°C for 15 minutes. Discard the supernatant. Add 1 ml of 75% ethanol and gently wash the precipitate. Centrifuge at 13,000 rpm at 4°C for 5 minutes, remove the supernatant, and air dry. Add an appropriate amount of enzyme-free water and dissolve the solution at 65°C for 10 minutes. Measure the OD value and concentration of the RNA and store at -80°C until needed.

[0073] 3.2. RNA Reverse Transcription to cDNA

[0074] 500 ng of RNA was reverse transcribed into cDNA using a reverse transcription kit (Takara RR037A). 3.3. Reverse transcription of piRNA:

[0075] Operate on ice, 20 μl per reaction system, as shown in the following table:

[0076] Table 1

[0077]

[0078] 3.4. Reverse transcription of mRNA:

[0079] Operate on ice, 20 μL per reaction system, as shown in the following table:

[0080] Table 2

[0081]

[0082] The reaction procedure was: 37°C for 45 min, 85°C for 5 min, and then maintained at 4°C.

[0083] 3.5.qRT-PCR

[0084] piRNA primer sequences were designed according to the principles of piRNA primer design. The cDNA obtained by reverse transcription was diluted 1:10 and subjected to the following qRT-PCR reaction.

[0085] Operate on ice, 20 μL per reaction system, as shown in the following table:

[0086] Table 3

[0087]

[0088] Mix the reaction solution and perform the Real-time PCR reaction procedure as follows:

[0089] Stage 1: 95℃ for 2 min;

[0090] Stage 2: Cycle 35, 94℃ for 5s, 60℃ for 1min;

[0091] Stage 3: 95℃15s, 60℃1min, 95℃5s;

[0092] The relative levels of each mRNA were quantified using GAPDH and expressed as relative ratios.

[0093] 4.piRNA Sequencing Analysis:

[0094] Total RNA was extracted from three LPS-induced AC16 cardiomyocytes and three normal control cells and sent to Guangzhou Epigenetics for piRNA sequencing. piRNAs with significant expression differences (Fold change ≥ 2.0, P value < 0.05) were screened. qRT-PCR was then used to determine the levels of the top 10 piRNAs in the patient's plasma, and the first piRNA with significant increase was selected for subsequent experiments. Figure 1 The volcano plot of piRNA expression differences between LPS-induced cardiomyocytes AC16 and normal controls was obtained by sequencing; Table 4 shows the top 10 upregulated piRNAs obtained by sequencing, and hsa_piR_019301 with the highest expression level was selected for subsequent experiments.

[0095] Table 4 Top 10 upregulated piRNAs obtained by sequencing

[0096]

[0097] 5.ROC curve drawing:

[0098] The receiver operating characteristic (ROC) curve is a graph plotting the true positive rate against the false positive rate. It can be used to reflect the relationship between sensitivity and specificity. It uses sensitivity as the vertical axis and 1-specificity as the horizontal axis. Sensitivity and specificity are calculated based on a series of cutoff values determined by the measured values in the experimental and control groups. A line connecting these points is the ROC curve. GraphPad Prism software is used to draw ROC curves. The ROC curve reflects the diagnostic efficacy of a marker for a disease.

[0099] 6. Statistical Analysis

[0100] Student's t-test and analysis of variance were used for normal variables, and the Mann-Whitney U test and Kruskal-Wallis test were used for nonnormal variables. Statistical analyses were performed using R software (v 3.4.2) and GraphPad Prism (9.1.0). Biological replicates are shown as individual data points superimposed on the bar graph. P < 0.05 was considered significant.

[0101] 7. Experimental results:

[0102] like Figure 2As shown, the level of hsa_piR_019301 in the plasma of patients with septic cardiomyopathy was measured by qRT-PCR. The results showed that the expression of hsa_piR_019301 in the plasma of patients with septic cardiomyopathy was significantly increased compared with that in the plasma of healthy controls, indicating that hsa_piR_019301 is a potential biomarker for septic cardiomyopathy.

[0103] like Figure 3 As shown in the figure, the ROC curve of hsa_piR_019301 in diagnosing patients with septic cardiomyopathy; hsa_piR_019301 had excellent diagnostic sensitivity and specificity, indicating that hsa_piR_019301 had good diagnostic efficacy.

[0104] cTnI is a myocardial-specific protein primarily present in cardiomyocytes and is currently recognized as the most sensitive and specific biomarker of myocardial injury. In patients with sepsis, the combined effects of multiple factors, including inflammatory factors, oxidative stress, and microcirculatory disturbances, can lead to myocardial cell damage, resulting in elevated cTnI levels. Studies have shown that elevated cTnI levels in sepsis are closely correlated with prognosis. Higher cTnI levels are associated with increased mortality, making it an independent risk factor for the prognosis of septic cardiomyopathy. The mortality rate in patients with elevated cTnI levels in sepsis is 2-3 times that of those with normal cTnI levels. Furthermore, cTnI has early warning value. Its elevation can occur early in the course of myocardial injury, facilitating the early detection of septic cardiomyopathy and prompting timely intervention and treatment. Therefore, cTnI is not only useful for the diagnosis of septic cardiomyopathy but, more importantly, serves as a crucial indicator for predicting patient prognosis.

[0105] like Figure 4 As shown, the diagnostic efficacy of hsa_piR_019301 was validated in an external validation cohort. Receiver operating characteristic (ROC) curve analysis demonstrated that both the novel biomarker hsa_piR_019301 and the traditional biomarker cTnI exhibited good predictive value, with areas under the ROC curve (AUCs) of 0.8804 and 0.8468, respectively. Compared with cTnI, hsa_piR_019301 demonstrated higher predictive accuracy, suggesting that it may be a potential new biomarker for predicting 28-day mortality in patients with septic cardiomyopathy.

[0106] Example 2 Relationship between CK-MB, IL-6 and hsa_piR_019301 expression

[0107] 1. Research Background

[0108] CK-MB is an important myocardial enzyme marker. Its concentration is high in cardiomyocytes, particularly in the myocardium, where it typically accounts for 14% to 42% of total CK. It is a key diagnostic marker for acute myocardial infarction. Elevated CK-MB reflects the extent of myocardial cell damage, occurring earlier than changes in total creatine kinase activity. Therefore, it plays a crucial role in the early diagnosis of acute myocardial infarction. Elevated CK-MB can be used as a diagnostic criterion for acute myocardial infarction. Clinical significance is typically achieved only when the creatine kinase isoenzyme CK-MB increases by at least threefold. During acute myocardial infarction, CK-MB typically begins to rise 3 to 6 hours after onset, peaks 12 to 24 hours later, and returns to normal within 2 to 3 days. Elevated CK-MB levels can also be seen in conditions such as myocarditis, cardiac surgery, pericarditis, muscular dystrophy, polymyositis, muscle atrophy, crush injuries, and even intramuscular injection. The normal range for CK-MB, as measured by immunosuppression, is 0 to 25 U / L; elevated levels indicate myocardial damage. Therefore, the detection of CK-MB is of great significance for the diagnosis and treatment of myocardial diseases.

[0109] IL-6, an inflammatory factor, is rapidly produced during acute inflammatory responses such as surgery, stress, brain death, tumorigenesis, and other conditions. As an infection marker, IL-6 is widely used in auxiliary diagnosis, therapeutic efficacy observation, and prognosis assessment. Elevated IL-6 levels are positively correlated with disease severity, with the magnitude of the increase reflecting the severity of the condition. This increase is particularly pronounced in systemic infections, indicating a high risk of sepsis. Normally, the IL-6 level in healthy individuals should be less than 7 pg / mL.

[0110] 2. Experimental methods:

[0111] CK-MB and IL-6 assays: Plasma or cell supernatant were assayed using the Zhuocai Biotechnology Creatine Kinase Isoenzyme (CK-MB) EILSA Assay Kit (ZC-34224) and IL-6 Assay Kit (ZC-32446). First, add 100 μL of the standard or test sample to each well. The kit is equilibrated at room temperature for 30 minutes. Then, remove the desired strips from the aluminum foil pouch. Seal the remaining strips in a ziplock bag and return them to 4°C. Add 50 μL of the standard of varying concentrations to each standard well. Add 50 μL of the test sample to the sample well; no test sample is added to the blank well. Add 100 μL of horseradish peroxidase (HRP)-labeled detection antibody to each standard and sample well, except for the blank well. Seal the wells with plate sealing film and incubate at 37°C in a water bath or incubator for 60 minutes. Discard the liquid, pat dry on absorbent paper, and fill each well with wash solution (350 μL). Let stand for 1 minute, then discard the wash solution and pat dry on absorbent paper. Repeat this process five times (a plate washer can also be used). Add 50 μL each of substrates A and B to each well and incubate at 37°C in the dark for 15 minutes. Add 50 μL of stop solution to each well and measure the OD value of each well at a wavelength of 450 nm within 15 minutes.

[0112] 3. Experimental results:

[0113] like Figure 5A As shown in Figure 2, the relationship between plasma CK-MB and hsa_piR_019301 expression in patients with septic cardiomyopathy; Figure 5B The figure shows the relationship between plasma IL-6 and hsa_piR_019301 expression in patients with septic cardiomyopathy. The figure shows a positive correlation between CK-MB, IL-6, and hsa_piR_019301 expression. CK-MB and IL-6 are hallmark proteins of heart failure, and hsa_piR_019301 levels are positively correlated. Excluding other etiologies, myocardial inflammation and damage in these patients are suspected to be related to sepsis. These results suggest that plasma hsa_piR_019301 levels can reflect disease severity.

[0114] Example 3 In vitro experimental cell level verification of the relationship between the expression level of hsa_piR_019301 and septic cardiomyopathy relation

[0115] 1. Cell culture:

[0116] Human cardiomyocyte cell line (AC16) was purchased from Wuhan Punosai Company. The cells were cultured in RPMI-1640 medium + 10% fetal bovine serum in a 5% carbon dioxide incubator at 37°C.

[0117] siRNA knockdown method: siRNA was ordered from Thermo Fisher and added according to the instructions when the cell confluence reached 70%. The knockdown effect was determined by qRT-PCR after 24 hours of induction.

[0118] 2. Preparation of Sepsis-induced Cardiomyopathy Cell Model:

[0119] Cultured AC16 cardiomyocytes were exposed to 10 mM LPS for cell induction. LPS is a component of the outer cell wall of Gram-negative bacteria and is composed of lipids and polysaccharides (glycolipids). LPS induction for 24 hours revealed physiological and biochemical changes similar to those seen in septic cardiomyopathy. This method is an internationally recognized cell model for septic cardiomyopathy. The levels of piRNAs and CK-MB and IL-6 in the cell supernatant were compared with those in the control group.

[0120] 3. The qRT-PCR method was the same as in Example 1.

[0121] 4. Plasma CK-MB and IL-6 are the same as in Example 2.

[0122] 5. Cell Death Rate Determination

[0123] Determine cell mortality using the Proteintech Live / Dead Staining Kit (PF00007). Remove the 2 μM Calcein AM and 4.5 μM PI staining solution and allow it to return to room temperature. Mix 30 μL of Calcein AM and 4.5 μL of PI staining solution with 10 mL of PBS or other serum-free buffer or culture medium and vortex to mix thoroughly. Wash the cells thoroughly 2-3 times with PBS buffer to remove any residual esterase activity. Aspirate the PBS solution and add an adequate amount of Calcein AM / PI staining solution. Incubate at room temperature in the dark for 15-20 minutes. Observe positive cells under a fluorescence microscope.

[0124] 6. Experimental results:

[0125] like Figure 6 As shown, the expression level of hsa_piR_019301 in AC16 cardiomyocytes induced by LPS was well correlated with cardiomyocyte mortality, indicating that hsa_piR_019301 has good diagnostic efficacy.

[0126] Figure 7A After AC16 cardiomyocytes were transfected with hsa_piR_019301 siRNA, the expression of hsa_piR_019301 was reduced. Figure 7B The total amount of mRNA remains unchanged after hsa_piR_019301 knockdown, indicating successful transfection. Subsequent experiments were completed on this basis.

[0127] Figure 8ATo detect the expression of CK-MB (reflecting myocardial cell injury), a cell injury marker associated with sepsis cardiomyopathy, in AC16 cardiomyocytes after transfection with siRNA of hsa_piR_019301; Figure 8B After AC16 cardiomyocytes were transfected with hsa_piR_019301 siRNA, the expression of IL-6 (reflecting cardiomyocyte inflammation), a cell injury marker related to septic cardiomyopathy, in cardiomyocytes was detected. It can be seen that after knocking down hsa_piR_019301, the expression of CK-MB and IL-6 decreased, indicating that knocking down hsa_piR_019301 can alleviate the damage of septic cardiomyocytes and hsa_piR_019301 may serve as a therapeutic target for septic cardiomyopathy.

[0128] Figure 9 The relationship between hsa_piR_019301 expression and the proportion of cardiomyocyte death after LPS treatment in AC16 cardiomyocytes in the hsa_piR_019301 knockdown and control groups was investigated. The results showed that LPS induction led to increased hsa_piR_019301 expression and cell death, while hsa_piR_019301 knockdown reduced the proportion of cardiomyocyte death. This provides the basis for hsa_piR_019301 as a molecular target for the treatment of septic cardiomyopathy.

[0129] These results demonstrate that hsa_piR_019301 is significantly associated with septic cardiomyopathy, making it a novel biomarker for septic cardiomyopathy. The receiver operating characteristic (ROC) curve demonstrates that hsa_piR_019301 has good diagnostic potential for septic cardiomyopathy. Furthermore, hsa_piR_019301 expression is upregulated in cardiomyocytes treated with the inducing agent LPS, suggesting that hsa_piR_019301 may be involved in the LPS-induced cardiomyocyte damage. In summary, hsa_piR_019301 has the potential to become a novel diagnostic biomarker and therapeutic target for septic cardiomyopathy.

[0130] Example 4 The sequences, primers and kit compositions of the present invention

[0131] The nucleotide sequence of the septic cardiomyopathy marker hsa_piR_019301 provided by the present invention is shown in SEQ ID No. 1, which is derived from the piRbase database and numbered piR-hsa-019301.

[0132] SEQ ID No.1: TGGGCAGTTGGTTTGGATGACTTGGCTGCCA

[0133] The primer pair provided by the present invention for specifically recognizing hsa_piR_019301 includes an upstream primer shown in SEQ ID No. 2 and a downstream primer shown in SEQ ID No. 3:

[0134] SEQ ID No.2: TGGGCAGTTGGTTTGGATG

[0135] SEQ ID No.3:

[0136] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGCAGC

[0137] The kit provided by the present invention comprises:

[0138] 5x primer buffer, enzyme combination I, random 6mers, oligo dT primer, RNase-free water, SYBR probe II (Tli RNaseH Plus) (2x), PCR primers (F+R) (10μM), ROX Reference dye (50x).

Claims

1. An application of a substance for detecting piRNA markers, characterized in that Includes one or more of the following applications: A1) Application in the preparation of products for diagnosing septic cardiomyopathy; A2) Application in the preparation of a product for screening septic cardiomyopathy; A3) Use in the preparation of a product for treating septic cardiomyopathy; A4) Application in the preparation of a product for assessing septic cardiomyopathy; A5) Application in the preparation of products for identifying and distinguishing septic cardiomyopathy from other diseases; The piRNA marker is hsa_piR_019301, and the nucleotide sequence is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that: The product is a product for diagnosing septic cardiomyopathy by detecting the expression level of hsa_piR_019301 through RT-PCR, real-time quantitative PCR, in situ hybridization, chip or high-throughput sequencing platform.

3. The use according to claim 1, characterized in that: The substance is a reagent for detecting the expression level of hsa_piR_019301, or specifically identifying hsa_piR_019301, or a reagent for detecting the content of hsa_piR_019301.

4. The use according to claim 1, characterized in that The substance is a substance for detecting hsa_piR_019301, specifically the following a), b) or c) a) primers for detecting or specifically recognizing hsa_piR_019301; b) a reagent set containing the reagent described in a); c) A kit containing a) or b).

5. The use according to claim 4, characterized in that: The primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No.

3.

6. A kit for detecting piRNA markers, characterized in that Includes one or more of the following applications: A1) Application in the preparation of products for diagnosing septic cardiomyopathy; A2) Application in the preparation of a product for screening septic cardiomyopathy; A3) Use in the preparation of products for assessing the risk of septic cardiomyopathy; A4) Application in the preparation of a product for assessing septic cardiomyopathy; A5) Application in the preparation of products for identifying and distinguishing septic cardiomyopathy from other diseases; The piRNA marker is hsa_piR_019301, and the nucleotide sequence is shown in SEQ ID No. 1; the kit includes a reagent for detecting or specifically identifying hsa_piR_019301, or a reagent for detecting the expression level of hsa_piR_019301.

7. The kit according to claim 6, wherein: The reagent for detecting or specifically identifying hsa_piR_019301 is a specific primer, and the specific primer is the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.

3.

8. A primer for detecting piRNA markers, characterized in that Includes one or more of the following applications: A1) Application in the preparation of products for diagnosing septic cardiomyopathy; A2) Application in the preparation of a product for screening septic cardiomyopathy; A3) Use in the preparation of products for assessing the risk of septic cardiomyopathy; A4) Application in the preparation of a product for assessing septic cardiomyopathy; A5) Application in the preparation of products for identifying and distinguishing septic cardiomyopathy from other diseases; The primers are primers for detecting the expression level of hsa_piR_019301 or specifically identifying hsa_piR_019301. The piRNA marker is hsa_piR_019301, and the nucleotide sequence is shown in SEQ ID No.

1.

9. The primer according to claim 8, wherein The primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

Images