Real-time fluorescent quantitative PCR probe primer combination for identifying bullfrog TaqMan, kit and application

Abstract

The embodiment of the invention discloses a real-time fluorescent quantitative PCR (Polymerase Chain Reaction) fluorescent primer combination for identifying bullfrog TaqMan, a kit and application. Comprising a probe, an upstream primer and a downstream primer, the nucleotide sequence of the probe is 5 '-FAM-CCAAACATTATTC-MGB-3', the nucleotide sequence of the upstream primer is 5 '-GAAGGGATAAAAGTAGRACTGCG-3', and the nucleotide sequence of the downstream primer is 5 '-GGTGGAAGGAGTCAAACTTG-3'. The invention develops a fluorescent primer combination for real-time fluorescent quantitative PCR of bullfrog TaqMan with strong specificity and amplification efficiency meeting the requirement in the range of 90-110%, the accuracy and reliability of detection are greatly improved, and a solid technical support is provided for healthy development of bullfrog culture industry, protection of ecological environment and public health safety.

Description

Technical Field

[0001] The embodiments of the present invention relate to the field of biological detection technology, and specifically to a probe primer combination, a kit and an application thereof for identifying bullfrog TaqMan real-time fluorescence quantitative PCR. Background Art

[0002] The bullfrog (Rana catesbeiana) is native to North America. As a large edible frog with delicious meat and rapid growth, it occupies an important position in the global aquaculture industry, bringing considerable economic benefits to many farmers. However, the disorderly introduction and breeding of bullfrogs have also brought about a series of ecological problems. Bullfrogs have strong adaptability and a wide range of diets. After entering natural water bodies, they will prey on a large number of local aquatic organisms, including small fish, amphibians, insects, etc., seriously threatening the survival of native species and disrupting the local ecological balance. At the same time, bullfrogs are also potential hosts for a variety of pathogens and parasites, such as frog iridovirus and Aeromonas hydrophila. These pathogens can be transmitted to other aquatic animals through bullfrogs, and may even have indirect effects on human health under suitable conditions.

[0003] At present, there are many limitations in the detection technology for bullfrogs. Traditional morphological detection methods mainly rely on the bullfrog's body shape, color, skin texture and other external features for identification. However, this method is highly subjective, and it is difficult to unify the judgment standards of different inspectors. It is very easy to misjudge young frogs or other frog species with similar appearances. Moreover, morphological testing makes it difficult to detect pathogens carried by bullfrogs in the early stages, which is not conducive to disease prevention and control. In terms of molecular biology testing, although ordinary PCR technology can detect bullfrog-specific genes or pathogen genes, it has problems such as easy contamination and inability to accurately quantify. In practical applications, it is impossible to determine the exact number of bullfrogs in the sample or the degree of infection of the pathogen, which is extremely unfavorable for the scientific assessment of bullfrog breeding conditions and ecological risks.

[0004] Real-time fluorescence quantitative PCR (qPCR) has attracted significant attention in the field of biological testing due to its high sensitivity, strong specificity, and precise quantification. However, existing real-time fluorescence quantitative PCR probe and primer combinations for bullfrogs have significant shortcomings. Some primer combinations lack specificity, making nonspecific binding prone to occur during the amplification process, leading to nonspecific amplification and seriously interfering with the accuracy of test results. Furthermore, the amplification efficiency of some probe and primer combinations fails to reach the ideal range of 90%-110%, limiting detection sensitivity. Summary of the Invention

[0005] To this end, the embodiments of the present invention provide a probe and primer combination, a kit, and an application for identifying bullfrogs using TaqMan real-time fluorescence quantitative PCR.

[0006] In order to achieve the above objectives, the embodiments of the present invention provide the following technical solutions:

[0007] According to a first aspect of an embodiment of the present invention, the present invention provides a probe primer combination for identifying bullfrog TaqMan real-time fluorescence quantitative PCR, comprising a probe, an upstream primer and a downstream primer, wherein the nucleotide sequence of the probe is: 5'-FAM-CCAAACACCTTTATTC-MGB-3', the nucleotide sequence of the upstream primer is 5'-GAAGGGATAAAAGTAGTAGRACTGCG-3', and the nucleotide sequence of the downstream primer is 5'-GGTGGAAGGAGTCAGAAACTTATG-3'.

[0008] According to a second aspect of the embodiments of the present invention, the present invention provides a kit for identifying bullfrogs by TaqMan real-time fluorescence quantitative PCR, comprising the probe and primer combination described above.

[0009] According to a third aspect of the embodiments of the present invention, the present invention provides the use of the probe and primer combination as described above, or the kit as described above, in bullfrog species identification.

[0010] According to a fourth aspect of the embodiments of the present invention, the present invention provides a method for identifying bullfrog species, the method comprising:

[0011] (1) Extracting cDNA or genomic DNA from the sample to be tested;

[0012] (2) performing TaqMan real-time fluorescence quantitative PCR reaction using the probe, upstream primer, and downstream primer described above to obtain a Ct value and an amplification curve;

[0013] (3) Determination of test results: If the Ct value is ≤35 and a typical amplification curve appears, the result is positive; if there is no Ct value or no amplification curve, the result is negative; if the Ct value is >35, the sample is repeated. If there is no Ct value in the repeated result, it is negative; otherwise, it is positive.

[0014] Furthermore, the TaqMan real-time fluorescence quantitative PCR reaction system was as follows: 10 μL of premixed reagent, 0.7 μL of 10 μM upstream primer, 0.7 μL of 10 μM downstream primer, 0.6 μL of 10 μM TaqMan probe, 1 μL of DNA template, and supplemented with ddH2O to a total volume of 20 μL.

[0015] Furthermore, the TaqMan real-time fluorescence quantitative PCR reaction conditions were as follows: pre-denaturation at 95°C for 2 min; 95°C for 15 s, 60°C for 30 s, and 40 cycles.

[0016] The embodiments of the present invention have the following advantages:

[0017] The present invention develops a fluorescent primer combination for bullfrog TaqMan real-time fluorescence quantitative PCR with strong specificity and an amplification efficiency that meets the requirements of the 90%-110% range, which greatly improves the accuracy and reliability of detection and provides solid technical support for the healthy development of the bullfrog breeding industry, the protection of the ecological environment and public health safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the embodiments or the description of the prior art. Obviously, the drawings described below are merely exemplary, and those skilled in the art can derive other implementation drawings based on the provided drawings without inventive effort.

[0019] Figure 1 A specificity verification amplification curve provided by the present invention;

[0020] Figure 2 Amplification curve diagram of different copy numbers of bullfrog genes provided by the present invention;

[0021] Figure 3 This is a standard curve diagram for bullfrog gene detection provided by the present invention. DETAILED DESCRIPTION

[0022] The following describes the implementation of the present invention using specific embodiments. Those skilled in the art will readily understand the other advantages and benefits of the present invention from the disclosure herein. Obviously, the embodiments described are only a portion of the present invention, not all of it. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without inventive effort are intended to fall within the scope of protection of the present invention.

[0023] Example 1 Design of primers and probes

[0024] Mitochondrial sequences of the target species and related species were downloaded from the NCBI database and aligned using MEGA6 software. Species-specific regions were selected and primers and probes were designed using Primer Express 3.0.1 software to ensure specific detection of the target species. Primer and probe design and synthesis were performed by Beijing Qingke Biotechnology Co., Ltd. Primer and probe information is provided in Table 1 below.

[0025] Table 1

[0026] name Sequence (5'→3') Upstream primer 5'-CAATTATTAATATGAAGCCATCCTCAAC-3'(SEQ ID NO:1) Downstream primer 5'-GAAGGGATAAAAGTAGTAGRACTGCG-3'(SEQ ID NO:2) probe 5'-FAM-CCAAACACCTTTTATTC-MGB-3'(SEQ ID NO:3)

[0027] Example 2 Specificity Detection

[0028] DNA templates were extracted from bullfrogs as positive samples, and from red-eared sliders, golden apple snails, giant African land snails, alligator snapping turtles, snapping turtles, and Procambarus clarkii as negative samples. ddH2O was used instead of the nucleic acid in the system as a no-template control (NFC). Amplification was performed using the upstream and downstream primers and probes listed in Table 1. Primer and probe specificity was verified by Ct values. Each sample was assayed in triplicate. DNA templates were extracted using a commercially available kit.

[0029] The real-time fluorescence PCR reaction system was as follows: 2xT5 Fast qPCR Mix (Qingke, TSE301) 10 μL, upstream primer 10 μM 0.7 μL, downstream primer 10 μM 0.7 μL, probe 10 μM 0.6 μL, DNA template 1 μL, and ddH2O was added to make up the total volume to 20 μL.

[0030] The real-time fluorescence amplification program was as follows: pre-denaturation at 95°C for 2 min, 1 cycle; 95°C for 15 s, 60°C for 30 s, 40 cycles; and collection of fluorescence signals during annealing and extension (60°C).

[0031] The results are shown in Table 2 and Figure 1 , the positive sample showed a typical S-shaped amplification curve (see Figure 1 ), while other negative samples and no-template controls showed a straight line (see Figure 1 There was no increase in fluorescence value, indicating that the primers and probes provided by the present invention can specifically detect bullfrog DNA.

[0032] Table 2

[0033]

[0034]

[0035] Example 3 Probe amplification efficiency detection

[0036] The target product obtained by amplification in Example 2 was cloned into a vector (Qingke pClone007 Versatile SimpleVector). The resulting plasmid was sequenced and verified as a bullfrog standard plasmid for amplification efficiency testing. The nucleotide sequence of the bullfrog standard plasmid is as follows:

[0037] AGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTT

[0038] TACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCC

[0039] GCAAAAAACGGAATAAGTGCGACACGGAAATGTTGAATACTCATTTTAG

[0040] CTTCCTTAGCTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGT

[0041] GATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAAGT

[0042] CAAAAGCCTCCGGTCGGAGGCTTTTGACTTTCTGTTCCGGCTCGTATGTT

[0043] GTGTCTATGGAAGCGGATAACAATTTCACACAGGAAACAGCTATGACCA

[0044] AGTTTGACATCCTTCAGGTGGACTCAAGACTGCAATCGCGTGTCGCCCTT

[0045] GAAGGGATAAAAGTAGTAGGACTGCGGTGATTAAAACTGATCAGACGAA

[0046] TAAAGGTGTTTGGTATTGTGTAGTTGAGGATGGCTTCATATTAATAATTGA

[0047] AGGGCGACACGCGATTGCAGTGTAACACGAGTGATCCTGAGTTCAGATC

[0048] AACTGGCCGTCGTTTTACACAATCAAGTCGTGACTGGGAAAACCCTGGC

[0049] GCTCCAACTTAATCGCCTTGCAGCACTGGCTCACCTTCACGGGTGGGCCT

[0050] TTCTTCGGTAGAAAATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGC

[0051] GTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTT

[0052] GTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAGGTAACTGGCTTCA

[0053] GCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGC

[0054] CACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAAT

[0055] CCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGT

[0056] TGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAAC

[0057] GGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGA

[0058] ACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAA

[0059] GGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGA

[0060] GAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTC

[0061] CTGTCGGGTTTCGCCACCTCTGACTTGAGCATCGATTTTTGTGATGCTCG

[0062] TCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCAGAAAGGCCC

[0063] ACCCGAAGGTGAGCCAGGTGATTACATTTGGGCCCTCATTACCAATGCTT

[0064] AATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGT

[0065] TGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCAT

[0066] CTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCC

[0067] AGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGT

[0068] GGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAA

[0069] GCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCAT

[0070] TGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCA

[0071] GCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGC

[0072] AAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGT

[0073] TGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTA

[0074] CTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACC

[0075] AAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGC

[0076] GTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCA

[0077] TCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCT

[0078] GTTGAGATCC, see SEQ ID NO:4.

[0079] The bullfrog standard plasmid was gradiently diluted as a positive standard and detected according to the real-time fluorescence PCR reaction system and amplification procedure of Example 2. Each dilution factor was repeated 3 times to obtain the probe gradient amplification curve ( Figure 2 , 1: dilution factor 10^3, 2: dilution factor 10^4, 3: dilution factor 10^5, 4: dilution factor 10^6, 4: dilution factor 10^7), CT and copy number LOG values were fitted to obtain the standard curve equation ( Figure 3 ), detect R 2 The results showed a good linear relationship between the CT and the logarithmic copy number values for the bullfrog gene within the range of 4.59E+7 to 4.59E+3 copies / µL. Based on the established standard curve, the amplification efficiency was calculated to be 96.4%. The test data are shown in Table 3.

[0080] Table 3

[0081]

[0082] After the plasmid was diluted 10^7 times, the detection repeatability was good, and the probe detection efficiency was within the normal range (90%-110%). The sensitivity of the primers and probes provided by the present invention met the detection requirements.

[0083] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made thereto. Therefore, such modifications and improvements, without departing from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

[0084]

[0085]

[0086]

Claims

1. A probe and primer combination for identifying bullfrog TaqMan real-time fluorescence quantitative PCR, characterized in that: The method comprises a probe, an upstream primer and a downstream primer, wherein the nucleotide sequence of the probe is 5'-FAM-CCAAACACCTTTATTC-MGB-3', the nucleotide sequence of the upstream primer is 5'-GAAGGGATAAAAGTAGTAGRACTGCG-3', and the nucleotide sequence of the downstream primer is 5'-GGTGGAAGGAGTCAGAAACTTATG-3'.

2. A kit for identifying bullfrogs using TaqMan real-time fluorescence quantitative PCR, characterized in that: Comprising the probe primer combination as claimed in claim 1.

3. Use of the probe-primer combination according to claim 1 or the kit according to claim 2 in identifying bullfrog species.

4. A method for identifying bullfrog species, characterized in that: The method comprises: (1) Extracting cDNA or genomic DNA from the sample to be tested; (2) performing a TaqMan real-time fluorescence quantitative PCR reaction using the probe, upstream primer, and downstream primer as claimed in claim 1 to obtain a Ct value and an amplification curve; (3) Determination of test results: If the Ct value is ≤35 and a typical amplification curve appears, the result is positive; if there is no Ct value or no amplification curve, the result is negative; if the Ct value is >35, the sample is repeated. If there is no Ct value in the repeated result, it is negative; otherwise, it is positive.

5. The bullfrog identification method according to claim 4, wherein The TaqMan real-time fluorescence quantitative PCR reaction system is as follows: 10 μL of premixed reagent, 0.7 μL of 10 μM upstream primer, 0.7 μL of 10 μM downstream primer, 0.6 μL of 10 μM TaqMan probe, 1 μL DNA template, and ddH2O is added to make up the total volume to 20 μL.

6. The bullfrog identification method according to claim 4, wherein The reaction conditions of TaqMan real-time fluorescence quantitative PCR were as follows: pre-denaturation at 95°C for 2 min; 40 cycles of 95°C for 15 s and 60°C for 30 s.

Images