Application of biological bacterium mixture in prevention and treatment of tobacco target leaf spot

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to application of a biological bacterium mixture in prevention and treatment of tobacco target leaf spot, the biological bacterium mixture is a mixture formed by mixing bacillus velezensis and bacillus amyloliquefaciens according to the effective bacterium number of (1-2): 1, the bacterial strain is sent to the China General Microbiological Culture Collection Center, and the bacillus amyloliquefaciens has been sent to the China General Microbiological Culture Collection Center. The bacillus velezensis is Apcs-1, the preservation number of the Apcs-1 is CGMCC (China General Microbiological Culture Collection Center) NO.33437, the bacillus amyloliquefaciens is Apcs-2, and the preservation number of the Apcs-2 is CGMCC NO.33438. After the two bacteria are compounded, the target leaf spot caused by two subgroups of rhizoctonia solani AG-3 is prevented and treated, and the tobacco target leaf spot is well prevented and treated.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to application of a biological bacteria mixture in preventing and treating tobacco target spot disease. Background Art

[0002] Tobacco is a key cash crop, and tobacco target spot disease poses a serious threat to its industrial development. During epidemics, tobacco production is severely reduced, by as much as 20%-50%, with some areas even experiencing total crop failure. Diseased tobacco leaves significantly deteriorate in quality, exhibiting thinner, darker leaves, and an imbalance in chemical composition. The flue-cured leaves are graded lower, severely damaging economic returns. Currently, the primary pesticides used to control tobacco target spot disease are 8% Jinggangmycin and several other chemical agents. However, increasing resistance among pathogens has weakened their effectiveness. Furthermore, the primary pathogens of tobacco target spot disease are composed of two subgroups: Rhizoctonia solani AG-3 fusion group TB (distributed in southern China) and TM (distributed in Northeast China). These two subgroups differ in biological characteristics and sensitivity to pesticides. Previously, a combined biocontrol agent combining Bacillus velezensis and Bacillus amyloliquefaciens for tobacco target spot disease control had not been used. Summary of the Invention

[0003] In order to solve the above problems, the present invention provides the use of a biological bacteria mixture in preventing and controlling tobacco target spot disease.

[0004] The invention discloses an application of a biological bacteria mixture in preventing and controlling tobacco target spot disease. The biological bacteria mixture is a mixture of Bacillus velez and Bacillus amyloliquefaciens. The strains have been sent to the General Microbiology Center of the China Culture Collection Administration of Microorganisms. The Bacillus velez is Apcs-1, and the preservation number of Apcs-1 is CGMCC No. 33437. The Bacillus amyloliquefaciens is Apcs-2, and the preservation number of Apcs-2 is CGMCC No. 33438.

[0005] Preferably, in the biological bacteria mixture, the concentrations of Bacillus Velez subtilis and Bacillus amyloliquefaciens are both 1×10 7 CFU·g -1 ~1×10 9 CFU·g -1 .

[0006] Preferably, the concentrations of Bacillus Velez and Bacillus amyloliquefaciens are both 1×10 8 CFU·g -1 .

[0007] Preferably, when preventing and controlling tobacco target spot disease, the biological bacteria mixture is sprayed onto tobacco leaves.

[0008] Preferably, the spraying frequency is 2 to 3 times, with an interval of 6 to 8 days between each spraying.

[0009] Preferably, 100L to 200L of the biological bacteria mixture is sprayed per hectare each time.

[0010] Preferably, the method for obtaining the biological bacteria mixture is: 1×10 8 CFU·g -1 Bacillus amyloliquefaciens and 1×10 8 CFU·g -1 The bacterial suspension of Bacillus velez is prepared in a volume ratio of 1:1 to obtain the biological bacteria mixture.

[0011] Preferably, the bacterial suspension is obtained by streaking Bacillus amyloliquefaciens and Bacillus velezensis on LB medium and culturing for 1 to 3 days, then inoculating the culture medium into LB liquid medium and culturing for 1 to 3 days.

[0012] Compared with the prior art, the present invention is beneficial in that: The present invention finds that a combination of two biocontrol bacteria, Bacillus velezensis Apcs-1 and Bacillus amyloliquefaciens Apcs-2, can prevent and control target spot disease caused by two subgroups of Rhizoctonia solani AG-3. There is no inhibitory effect between the two biocontrol bacteria, and both have good preventive effect on tobacco target spot disease. Therefore, the application of the biological bacteria mixture in preventing and controlling tobacco target spot disease is proposed. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 It is a confrontation culture of biological bacteria Apcs-1, Apcs-2 and tobacco target spot disease.

[0014] Figure 2 The Gram staining, colony characteristics and electron microscopy observation of strain Apcs-1, where A is Gram staining, B is the colony morphology on the LB plate, C is the morphology under an electron microscope at 30.0K times, and D is the morphology under an electron microscope at 70.0K times.

[0015] Figure 3 The Gram staining, colony characteristics and electron microscopy observation of strain Apcs-3, where A is Gram staining, B is the colony morphology on the LB plate, C is the morphology under an electron microscope at 50.0K times, and D is the morphology under an electron microscope at 30.0K times.

[0016] Figure 4 A phylogenetic tree of strain Apcs-2 (i.e., CTXM 2-2 in the figure) was constructed for the 16S rDNA sequence.

[0017] Figure 5 for gyrB The phylogenetic tree of strain Apcs-2 (i.e., CTXM 2-2 in the figure) was constructed based on the sequences.

[0018] Figure 6A phylogenetic tree of strain Apcs-1 was constructed for the 16S rDNA sequence.

[0019] Figure 7 for gyrB Genetic construction and phylogeny of strain Apcs-1.

[0020] Figure 8 The Bacillus amyloliquefaciens and Bacillus velezii were cultured in confrontation, with A being the target of Bacillus velezii and B being the target of Bacillus amyloliquefaciens. DETAILED DESCRIPTION

[0021] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited by the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are all conventional methods unless otherwise specified.

[0022] In the present invention, Bacillus velezensis is Apcs-1, the preservation number of Apcs-1 is CGMCC NO.33437, and it was deposited in the General Microbiology Center of China Culture Collection Administration Committee on January 16, 2025. Bacillus amyloliquefaciens is Apcs-2, the preservation number of Apcs-2 is CGMCC NO.33438, and it was deposited in the General Microbiology Center of China Culture Collection Administration Committee on January 16, 2025.

[0023] The culture medium information used in the present invention is as follows: The formula of LB medium is: yeast extract 5.0 g, peptone 10.0 g, NaCl 5.0 g, agar powder 15.0 g, and water is added to 1 L.

[0024] LB liquid medium: The formula is: yeast extract 5.0 g, peptone 10.0 g, NaCl 5.0 g, and water to 1 L.

[0025] The formula of PDA culture medium is: 200.0 g of potato, 20.0 g of glucose, 15.0 g of agar powder, and water to 1 L.

[0026] Example 1 Strain identification 1. Observation of morphological characteristics and determination of physiological and biochemical characteristics After single colony purification on LB medium, single colonies were picked with an inoculation loop and streaked in a zigzag pattern on LB medium. After 24 hours, the colony morphology of the strain on LB medium was observed. Gram staining was performed, and bacterial morphology was observed using a scanning electron microscope.

[0027] Physiological and biochemical indicators of the strains were determined according to the Bergey's Manual of Bacterial Identification and the Manual of Common Bacterial Systematic Identification. These included starch hydrolysis, catalase reaction, VP reaction, H2S production, methyl red reaction, citrate utilization, nitrate reduction, casein hydrolysis, gelatin hydrolysis, phenylalanine dehydrogenase detection, and common carbon source utilization.

[0028] 2. Molecular identification of strain Apcs-2 The strain was inoculated into LB liquid medium and cultured at 28°C and 180 rpm for 2 d. DNA was extracted by SDS method. 16S rDNA and 2S rDNA of the strain were amplified by PCR using two sets of primers: PAF (AGAGTTTGATCCTGGCTCAG, recorded as SEQ ID NO.1) / PHR (AAGGAGGTGATCCAGCCGCA, recorded as SEQ ID NO.2) and gyrB-F (GAAGTCATCATGACCGTTCTGCAYGCNGGNGGNAARTTYGA, recorded as SEQ ID NO.3) / gyrB-R (AGCAGGGTACGGATGTGCGAGCCRTCNACRTCNGCRTCNGTCAT, recorded as SEQ ID NO.4). gyrB Gene sequence. The reaction system included 25 µL of 2xTaq PCR Mix, 22 µL of ddH₂O, 1 µL of Primer-F, 1 µL of Primer-R, and 1 µL of DNA. The amplification procedure was as follows: initial denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 59°C for 30 s, extension at 72°C for 1 min, and final extension at 72°C for 5 min. PCR products were electrophoresed on a 1% agarose gel, stained with ethidium bromide (EB), and visualized on a gel imager. Products with clear bands were sent to Beijing Liuhe BGI Genomics Co., Ltd. for purification and sequencing. Sequencing results were compared using BLAST comparisons against the NCBI database, and a phylogenetic tree was constructed using the neighbor-joining method using MEGA11 software. In SEQ ID NOs. 3 and 4, Y represents C or T, R represents A or G, and N represents A, T, C, or G.

[0029] result 1. Identification of Bacillus amyloliquefaciens (1) Morphological identification of Bacillus amyloliquefaciens, strain Apcs-2 is purple in Gram staining, positive ( Figure 3 A); After the strain Apcs-2 was cultured in a 28℃ incubator for 24 h, the colonies on the LB medium were yellow-white, round or oval, sticky, and opaque ( Figure 3 ), and the strain was observed to be rod-shaped and spore-forming.

[0030] (2) Physiological and biochemical identification of Bacillus amyloliquefaciens: The results of physiological and biochemical tests (Table 1) showed that strain Apcs-2 was catalase-positive and was able to decompose starch and gelatin during metabolism. The catalase reaction, VP reaction, citrate utilization, and phenylalanine dehydrogenase reaction were all positive. H2S production and methyl red reactions were all negative. It was able to utilize sucrose, fructose, mannitol, maltose, glucose, starch, and yeast powder. Combined with morphological characteristics, according to the "Common Bacterial System Identification Manual" and the "Berger's Manual of Bacterial Identification", and combined with previous research results, the above characteristics are consistent with Bacillus amyloliquefaciens.

[0031] Table 1 Physiological and biochemical characteristics identification Note: “+” represents a positive reaction, and “-” represents a negative reaction.

[0032] (3) Molecular biological identification of Bacillus amyloliquefaciens The 16S rDNA sequence of the strain was found to be similar to that of Bacillus velezinis by BLAST comparison. Bacillus velezensis , Bacillus amyloliquefaciens Bacillus amyloliquefaciens The similarity is 100%, and the phylogenetic tree is clustered into one branch ( Figure 4 ). gyrB The gene sequences of the strains were compared by BLAST. gyrB The sequence can be clustered into a separate branch with Bacillus amyloliquefaciens ( Figure 5 ).

[0033] Based on the results of colony morphology, physiological and biochemical as well as molecular biology, strain Apcs-2 was identified as Bacillus amyloliquefaciens.

[0034] 2. Identification of Bacillus Velez (1) Morphological identification of Bacillus velezensis The strain Apcs-1 was purple in Gram stain and positive ( Figure 3 A); After culturing on LB medium for 24 h, the colonies were milky white and opaque. The surface of the colonies was moist and smooth at the beginning of the culture, but later the surface became wrinkled and no pigment was produced ( Figure 3B). Observed under an electron microscope, the newly formed strain is plump, rod-shaped, and divides symmetrically, forming a septum in the middle of the cell, producing two daughter cells of equal size ( Figure 3 C, D).

[0035] (2) Physiological and biochemical identification of strain Apcs-1: The results of physiological and biochemical tests (Table 2) showed that the strain was positive for catalase reaction, produced hydrogen sulfide gas during metabolism, and was able to decompose starch and gelatin. The phenylalanine deaminase and casein hydrolysis reactions were negative, and the citrate reaction, nitrate reduction reaction, VP reaction, and methyl red reaction were all positive. It can grow normally on LB medium containing 1%-7% NaCl and under pH 5.0-8.0 conditions; it can utilize sorbitol, sucrose, glucose, and mannitol. Combined with morphological characteristics, according to the "Common Bacterial System Identification Manual" and the "Bergey Bacterial Identification Manual", the above characteristics are consistent with Bacillus velezinis.

[0036] Table 2 Physiological and biochemical identification Note: “+” represents a positive reaction, and “-” represents a negative reaction.

[0037] (3) Molecular biological identification of Bacillus velezensis The amplified length of the 16S rDNA sequence of the strain was 1487 bp. The sequence was submitted to NCBI (accession number: PQ10075). BLAST comparison showed that the 16S rDNA sequence of strain Apcs-1 was similar to that of Bacillus velezensis. Bacillus velezensis (PQ093558.1, OM405507), Bacillus amyloliquefaciens Bacillus amyloliquefaciens (KT961125.1, KC953598.1) similarity reached 100%, and the phylogenetic tree clustered into one branch ( Figure 6 ). gyrB The gene sequence length is 466bp. BLAST comparison revealed that the strain gyrB Bacillus velez Bacillus velezensis (MW736022) gyrB sequence similarity was the highest, and the related strains were selected to construct a phylogenetic tree, and it was found that it could be clustered into a separate branch with Bacillus velezinis ( Figure 7 ).

[0038] Based on the results of colony morphology, physiological and biochemical and molecular biological identification, the strain was identified as Bacillus velezensis Bacillus velezensis .

[0039] Example 2 Determination of the inhibitory effect on tobacco target spot caused by Rhizoctonia solani AG-3 (TB / TM) The plate standoff method was used. The pathogen strain was inoculated into PDA medium and cultured at 28°C for 3 days. A 6 mm diameter bacterial cake was taken from the edge of the colony using a borer and placed in the center of the plate. Four symmetrical spots were then applied 2.5 cm from the pathogen cake. A control plate inoculated with the pathogen alone was used. Each treatment was replicated three times. After 3 days of culture, the width of the inhibition zone was measured, and the inhibition rate was calculated.

[0040] The results are as follows Figure 1 As shown, the inhibition rate of tobacco target spot caused by Bacillus amyloliquefaciens Apcs-2 and Rhizoctonia solani AG-3 TB in confrontation culture was 76.04%±0.55%; the inhibition rate of tobacco target spot caused by Bacillus amyloliquefaciens Apcs-2 and Rhizoctonia solani AG-3 TM in confrontation culture was 77.03%±0.27%; The inhibition rate of tobacco target spot caused by Bacillus velezi Apcs-1 and Rhizoctonia solani AG-3 TB in confrontation culture reached 63.54%±0.55%; the inhibition rate of tobacco target spot caused by Bacillus velezi Apcs-1 and Rhizoctonia solani AG-3 TM in confrontation culture reached 64.57%±0.59%.

[0041] Example 3 Co-culture of Bacillus amyloliquefaciens and Bacillus velez 50 μL of Bacillus amyloliquefaciens suspension (1×10 8 CFU·g -1 ) was spread on LB medium, and a sterilized Oxford cup was placed in the center of the medium. 200 μL of Bacillus Velezii suspension (1×10 8 CFU·g -1 ) Each treatment was repeated three times, and the diameter of the inhibition zone was measured after incubation at 28°C for 7 days.

[0042] The results are as follows Figure 8 As shown, co-culture of Bacillus amyloliquefaciens and Bacillus Velez-Platform revealed no inhibitory effect between the two strains (A: Bacillus Velez-Platform in the Oxford cup and Bacillus amyloliquefaciens on the plate; B: Bacillus amyloliquefaciens in the Oxford cup and Bacillus Velez-Platform).

[0043] Example 4 Effect of mixed application of Bacillus Velez and Bacillus amyloliquefaciens on controlling tobacco target spot in the field Bacillus amyloliquefaciens and Bacillus velezensis were streaked onto LB medium and cultured at 180 rpm / min for 2 days. The strains were inoculated into LB liquid medium and cultured at 180 rpm / min for 2 days to obtain 1×10 8 CFU·g -1 Bacillus amyloliquefaciens and 1×10 8 CFU·g-1 The bacterial suspension of Bacillus veleziformis was prepared by mixing the bacterial suspensions of Bacillus amyloliquefaciens and Bacillus veleziformis in a volume ratio of 1:1 to obtain a mixed bacterial solution.

[0044] The experimental field was a continuous tobacco crop field, and the incidence of tobacco target spot disease in the previous year was greater than 50%. A randomized block design was used, with two treatments, three replicates per treatment, and a total of six plots, each with an area of 20 m2. 2 Use a backpack sprayer to evenly spray the mixed bacterial solution on the leaves for a total of 2 sprays, with an interval of 7 days between each spraying. Spray 150L per hectare each time. In each plot, 10 plants were surveyed, and 5 tobacco leaves were surveyed for each plant. Statistics were recorded according to the lesion classification standard. The disease situation was investigated 7 days after the last spraying, and the disease index and control effect were calculated according to the statistical disease level.

[0045] Grading standard for tobacco leaf spot disease: Grade 0: No lesions; Grade 1: Lesions occupy less than 1% of the total leaf area; Grade 3: Lesions occupy less than 10% of the total leaf area; Grade 5: Lesions occupy less than 30% of the total leaf area; Grade 7: Lesions occupy less than 50% of the total leaf area; Grade 9: Lesions occupy more than 50% of the total leaf area. The data were statistically analyzed and variance analysis was performed using the new multiple range method.

[0046] According to the investigation, the prevention efficiency of Bacillus Velez-Bacillus amyloliquefaciens was 62%, the prevention efficiency of Bacillus amyloliquefaciens was 67%, and the prevention efficiency of the mixed bacterial solution of Bacillus Velez-Bacillus amyloliquefaciens (1:1) was 73%.

[0047] Table 3 Field efficacy test of biocontrol bacteria against tobacco target leaf spot It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes preferred embodiments.

[0048] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0049] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.

Claims

1. The application of a biological bacteria mixture in preventing and controlling tobacco target spot disease is characterized in that: The biological bacteria mixture is a mixture of Bacillus velez and Bacillus amyloliquefaciens in an effective bacterial count of 1 to 2:

1. The strains have been sent to the General Microbiology Center of the China Culture Collection Administration of Microorganisms. The Bacillus velez is Apcs-1, and the preservation number of Apcs-1 is CGMCC NO.33437. The Bacillus amyloliquefaciens is Apcs-2, and the preservation number of Apcs-2 is CGMCC NO.33438.

2. The use according to claim 1, characterized in that In the biological bacteria mixture, the concentrations of Bacillus Velez and Bacillus amyloliquefaciens were both 1×10 7 CFU·g -1 ~1×10 9 CFU·g -1 .

3. The use according to claim 2, characterized in that In the biological bacteria mixture, the concentrations of Bacillus Velez and Bacillus amyloliquefaciens were both 1×10 8 CFU·g -1 .

4. The use according to claim 3, characterized in that When preventing and controlling tobacco target spot disease, the biological bacteria mixture is sprayed on tobacco leaves.

5. The use according to claim 4, characterized in that The spraying frequency is 2 to 3 times, with an interval of 6 to 8 days between each spraying.

6. The use according to claim 5, characterized in that 100L to 200L of the biological bacteria mixture is sprayed per hectare each time.

7. The use according to claim 1, characterized in that The method for obtaining the biological bacteria mixture is as follows: 1×10 8 CFU·g -1 Bacillus amyloliquefaciens and 1×10 8 CFU·g -1 The bacterial suspension of Bacillus velez is prepared in a volume ratio of 1:1 to obtain the biological bacteria mixture.

8. The use according to claim 7, characterized in that The bacterial suspension is obtained by streaking Bacillus amyloliquefaciens and Bacillus velezensis on LB culture medium and culturing for 1-3 days, then inoculating into LB liquid culture medium and culturing for 1-3 days.

Images