Streptococcus salivarius subsp. Thermophilus, microbial inoculum and application of microbial inoculum in preparation of fermented milk

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to a streptococcus salivarius subsp. Thermophilus, a microbial agent and application of the streptococcus salivarius subsp. Thermophilus in preparation of fermented milk, and the preservation number of the strain is CGMCC (China General Microbiological Culture Collection Center) No.31385. The invention further discloses a preparation method of the streptococcus salivarius subsp. Thermophilus. The strain has excellent fermentation performance and is high in fermentation speed and weak in post-acidity during preparation of the fermented milk, and the fermented milk obtained through fermentation is firm in texture and free of whey precipitation.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a thermophilic subspecies of Streptococcus salivarius, a bacterial agent and application thereof in preparing fermented milk. Background Art

[0002] Fermented dairy products (especially yogurt) are made from raw cow's (or sheep's) milk or milk powder, sterilized and fermented to increase acidity. Studies have shown that consuming fermented dairy products can have beneficial effects on the human body, such as regulating the gastrointestinal microecological environment, maintaining a balanced intestinal flora, supplementing high-quality protein and calcium, and improving immunity. The quality of fermented dairy products is highly dependent on the performance of the fermentation strain.

[0003] Among them, Streptococcus salivarius thermophilus subsp. Streptococcus salivarius subsp. thermophilus ) is one of the most commonly used fermentation strains and has been recognized as a food-grade safe strain by the European Food Safety Authority. In my country, Streptococcus salivarius subsp. thermophilus has also been included in the list of strains that can be used in food and health foods, demonstrating its widespread recognition for its safety and health benefits.

[0004] Therefore, screening out a thermophilic subspecies of Streptococcus salivarius with excellent fermentation performance is of great significance to the development of the dairy industry. Summary of the Invention

[0005] In order to solve the above problems, the present invention separated and screened a strain of Streptococcus salivarius thermophilic subsp. Streptococcus salivarius subsp. thermophilus ), the strain was isolated from homemade yak yogurt made by villagers in Amuhu Village, Youganning Town, Henan Mongolian Autonomous County, Huangnan Tibetan Autonomous Prefecture, Qinghai Province. When used to prepare fermented milk, it ferments quickly and has a weak aftertaste. The fermented milk has a firm texture and no whey precipitation.

[0006] In order to achieve the above object, the present invention can adopt the following technical solutions: On the one hand, the present invention provides a strain of Streptococcus salivarius subsp. thermophilus ( Streptococcus salivarius subsp. thermophilus ), its deposit number is CGMCC No.31385.

[0007] Another aspect of the present invention provides a bacterial agent, which includes the above-mentioned Streptococcus salivarius thermophilic subspecies, and the bacterial agent includes a freeze-dried bacterial agent, a solid bacterial agent, a bacterial suspension or a fermentation broth.

[0008] Preferably, the above-mentioned bacterial agent is a freeze-dried bacterial agent, and the raw materials for preparing the freeze-dried bacterial agent include bacterial mud and a freeze-drying protective agent, and the freeze-drying protective agent includes skim milk powder and maltodextrin.

[0009] More preferably, the mass volume ratio of the bacterial sludge and the lyophilization protective agent is 1g: (5mL-10mL).

[0010] In another aspect, the present invention provides a use of the thermophilic Streptococcus salivarius subspecies or the bacterial agent in the preparation of fermented dairy products.

[0011] Preferably, in the above application, the Streptococcus salivarius subspecies thermophilic or the bacterial agent has one or more of the following functions: (i) Streptococcus salivarius subspecies thermophilic or the bacterial agent has the function of increasing the fermentation rate, and the pH of the fermented milk reaches 4.5-4.6 within 10 hours; (ii) Streptococcus salivarius subspecies thermophilic or bacterial agents have a weak post-acidification function; (iii) the fermented dairy product is fermented milk, and the Streptococcus salivarius subspecies thermophilic or bacterial agent has the function of improving the texture of the fermented milk, and the fermented milk prepared has a firm texture; (iv) The fermented milk product is fermented milk, and the Streptococcus salivarius subspecies thermophilic or the bacterial agent has the function of reducing whey precipitation in the fermented milk, and the fermented milk prepared does not have whey precipitation.

[0012] In another aspect, the present invention provides a method for preparing fermented milk, comprising: fermenting a fermented milk base using the above-mentioned Streptococcus salivarius subspecies thermophilic or the above-mentioned bacterial agent to obtain the fermented milk.

[0013] In another aspect, the present invention provides fermented milk prepared by the above preparation method.

[0014] In another aspect, the present invention provides a method for culturing the thermophilic Streptococcus salivarius subsp. salivarius, comprising: inoculating the thermophilic Streptococcus salivarius subsp. salivarius into M17 broth culture medium and culturing for 4-8 hours.

[0015] Preferably, in the above culture method, the culture time is 5.5 hours.

[0016] The deposit information of Streptococcus salivarius thermophilus subsp. salivarius in the present invention is as follows: depository institution: General Microbiology Center of China Culture Collection Administration (CGMCC); deposit address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; deposit date: July 22, 2024; deposit number: CGMCC No. 31385; classification name: Streptococcus salivarius thermophilus subsp. Streptococcus salivarius subsp. thermophilus ).

[0017] The beneficial effects of the present invention include: (1) The thermophilic Streptococcus salivarius subspecies provided by the present invention has a fast fermentation speed as a starter, and the fermented milk obtained by fermentation can reach a pH of 4.5 within 5 hours.

[0018] (2) The fermented milk obtained by fermenting the thermophilic Streptococcus salivarius subspecies provided by the present invention as a starter has a firm texture and no whey precipitation, indicating that the fermented milk obtained by fermentation is of excellent quality.

[0019] (3) The fermented milk obtained by fermenting the thermophilic Streptococcus salivarius subspecies provided by the present invention as a starter is weakly acidified, and the pH value does not change significantly (from pH 4.65 to 4.60) after storage at 4°C for 7 days. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the colony morphology of Streptococcus salivarius thermophilic subspecies TY-ST24; Figure 2 This is the Gram staining result of Streptococcus salivarius thermophilic subspecies TY-ST24; Figure 3 This is the pH curve of yogurt fermented by Streptococcus salivarius thermophilic subspecies TY-ST2; Figure 4 The yogurt is fermented by Streptococcus salivarius thermophilic subspecies TY-ST2; Figure 5 is the number of viable bacteria in TY-ST24 fermentation broth at different temperatures; Figure 6 is the number of viable bacteria in TY-ST24 fermentation broth at different times; Figure 7 The viable bacterial counts in the fermentation broth of Streptococcus salivarius subsp. thermophilus in TY-ST24 and commercial starter cultures and the pH curves of fermented yogurt (①② represent parallel experiments); Figure 8 The pH curves and viable bacteria counts of fermented yogurt by TY-ST24 and commercial starter isolates (①② represent parallel experiments); In the above figures, the experimental data are expressed as mean ± standard error (mean ± SEM). DETAILED DESCRIPTION

[0021] The examples are provided to better illustrate the present invention, but are not intended to limit the present invention to the examples. Therefore, non-essential improvements and adjustments to the embodiments made by those skilled in the art based on the above-mentioned invention still fall within the scope of protection of the present invention.

[0022] The terms used herein are only used to describe specific embodiments and are not intended to limit the present disclosure. Unless the context has a significantly different meaning, expressions in the singular include expressions in the plural. As used herein, it should be understood that terms such as "include", "have", "comprise" and the like are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials or combinations. The terms of the present invention are disclosed in the specification and are not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials or combinations thereof may exist or may be added. As used herein, " / " may be interpreted as "and" or "or", depending on the circumstances.

[0023] The quality of fermented milk is highly dependent on the performance of the fermentation bacteria. Streptococcus salivarius subsp. thermophilus serves as a core fermentation strain, and its acid production rate and ability to control post-acidification directly impact product texture and shelf stability. The strains currently used in industrial production often suffer from technical flaws such as long fermentation cycles (typically >6 hours) and uncontrollable post-acidification. Even after fermentation is complete, the strain continues to metabolize lactose to produce acid, resulting in an acidity increase exceeding 0.35°T / day during storage, leading to quality deterioration such as whey precipitation and flavor imbalance. Existing strains of Streptococcus salivarius subsp. thermophilus are mostly screened from European milk sources and lack compatibility with local milk bases. This can lead to reduced lactose utilization during the fermentation process.

[0024] In order to solve the above problems, the present invention can adopt the following technical solutions: In the first aspect, the present invention provides a strain of Streptococcus salivarius subsp. thermophilus ( Streptococcus salivarius subsp. thermophilus ), its deposit number is CGMCC No.31385.

[0025] It should be noted that the Streptococcus salivarius subsp. thermophilus in the present invention was isolated from home-brewed yak yogurt in Amuhu Village, Youganning Town, Henan Mongolian Autonomous County, Huangnan Tibetan Autonomous Prefecture, Qinghai Province, and is a locally screened strain of Streptococcus salivarius subsp. thermophilus. Furthermore, fermentation validation revealed that this strain exhibits excellent fermentation speed, weak post-acidification, and produces high-quality fermented milk with no significant whey precipitation. Furthermore, PCR amplification and sequencing of the Streptococcus salivarius subsp. thermophilus in the present invention revealed that its 16S rDNA is shown in SEQ ID NO: 1.

[0026] In a second aspect, an embodiment of the present invention provides a bacterial agent, which includes the above-mentioned thermophilic subspecies of Streptococcus salivarius, and the bacterial agent includes a freeze-dried bacterial agent, a solid bacterial agent, a bacterial suspension or a fermentation broth.

[0027] It should be noted that the thermophilic Streptococcus salivarius subspecies in the present invention can be processed to obtain different bacterial agents, for example, freeze-dried bacterial agents, solid bacterial agents, bacterial suspensions or fermentation broths. The preparation methods of different bacterial agents are well known in the art, and those skilled in the art can select according to different usage requirements.

[0028] In some specific examples, the bacterial inoculum can be a freeze-dried inoculum. The raw materials for preparing the freeze-dried inoculum can include bacterial slurry and a lyoprotectant, which can include skim milk powder and maltodextrin. Specifically, the bacterial slurry is obtained by centrifuging the bacterial solution of the thermophilic Streptococcus salivarius subsp. salivarius described herein. The centrifugation parameters can be adjusted according to the specific circumstances. Furthermore, the lyoprotectant can be any known in the art. In the present invention, skim milk powder and maltodextrin are preferred, as the freeze-dried inoculum prepared with such lyoprotectants has good stability and a high number of viable bacteria. Furthermore, the mass-to-volume ratio of the bacterial slurry to the lyoprotectant can be 1g:(5mL-10mL). Specifically, the units of the mass-to-volume ratio can be converted according to international standards, for example, 1kg:(5L-10L), and so on. Alternatively, the mass-to-volume ratio can be 1g:6mL, 1g:7mL, 1g:8mL, or 1g:9mL, etc. Furthermore, the freeze-dried inoculum can be in various forms, such as unbroken blocks or crushed powder, with powder being the preferred form.

[0029] In some specific examples, the above-mentioned microbial agent can be a solid microbial agent. Solid microbial agents are prepared by loading Streptococcus salivarius thermophilus subspecies on a carrier. The carrier is a key medium for fixing the bacteria and maintaining activity. It must have high adsorption, air permeability, and chemical stability, which is well known in the art. Examples include natural organic carriers (corn cobs, bran, sawdust, peat, vermiculite, etc., which provide the carbon source and pore structure required for microbial growth), inorganic or composite carriers (ultra-high molecular weight materials (for slow-release antibacterial agents), corn flour and wheat mixtures to enhance mechanical strength or extend the life of the microbial agent), or functionalized carriers (adding malt koji (containing a natural enzyme system) or marigold extract (to synergistically degrade pollutants) to enhance the overall efficacy of the microbial agent).

[0030] In some specific examples, the bacterial agent can be a bacterial suspension. A bacterial suspension refers to a homogeneous suspension formed by dispersing microbial cells (live or inactivated) in a sterile liquid (such as saline, buffer, or culture medium) using physical or chemical methods. Those skilled in the art can prepare a Streptococcus salivarius subsp. thermophilus bacterial suspension using conventional preparation methods.

[0031] In some specific examples, the bacterial agent may be a fermentation broth. Fermentation broth refers to a mixed liquid containing microbial cells, metabolites, and culture medium components produced by propagating a specific microbial strain in a liquid culture medium. Its core value lies in the active substances (such as enzymes, antibiotics, hormones, etc.) secreted by the microorganisms during the fermentation process. Those skilled in the art can obtain such a broth by culturing it using conventional liquid culture media.

[0032] In a third aspect, an embodiment of the present invention provides a use of the above-mentioned Streptococcus salivarius thermophilus subspecies or the above-mentioned bacterial agent in the preparation of fermented dairy products.

[0033] It should be noted that the fermented dairy products in the embodiments of the present invention refer to products obtained by fermenting a milk source and can be liquid, solid, or paste-like products. For example, liquid products include yogurt drinks or liquid yogurt; solid products include yogurt tablets, yogurt powder, or yogurt balls; and paste-like products include cheese sticks and set spoonable yogurt.

[0034] In some specific examples, in the above applications, the Streptococcus salivarius subspecies thermophilic or the bacterial agent has one or more of the following functions: (i) Streptococcus salivarius subspecies thermophilic or the bacterial agent has the function of increasing the fermentation rate, and the pH of the fermented milk reaches 4.5-4.6 within 10 hours; (ii) Streptococcus salivarius subspecies thermophilic or bacterial agents have a weak post-acidification function; (iii) the fermented dairy product is fermented milk, and the Streptococcus salivarius subspecies thermophilic or bacterial agent has the function of improving the texture of the fermented milk, and the fermented milk prepared has a firm texture; (iv) The fermented milk product is fermented milk, and the Streptococcus salivarius subspecies thermophilic or the bacterial agent has the function of reducing whey precipitation in the fermented milk, and the fermented milk prepared does not have whey precipitation.

[0035] It should be noted that the thermophilic Streptococcus salivarius subspecies or the above-mentioned bacterial agent in the embodiments of the present invention has excellent fermentation performance, fast fermentation speed, weak after-acidity, and the fermented milk obtained by fermentation has a firm texture and no whey precipitation.

[0036] In a fourth aspect, an embodiment of the present invention provides a method for preparing fermented milk, the method comprising: fermenting a fermented milk base using the above-mentioned Streptococcus salivarius subspecies thermophilic or the above-mentioned bacterial agent to obtain the fermented milk.

[0037] It should be noted that the fermented milk base of the present invention includes at least a milk source, which can be raw milk, skim milk powder, or non-skim milk powder. It should be understood that the milk source can be any edible milk source known in the art, such as cow's milk, goat's milk, horse's milk, or camel's milk. Furthermore, the fermented milk base generally includes a sweetener, a thickener, and a flavoring agent. Sweeteners (such as white sugar) provide sweetness, thickeners provide thickness, and flavoring agents enhance the flavor of the fermented milk.

[0038] In a fifth aspect, an embodiment of the present invention provides a fermented milk prepared by the above preparation method.

[0039] It should be noted that, as described above, the fermentation product prepared by the Streptococcus salivarius subspecies thermophilus or the bacterial agent in the embodiments of the present invention has the excellent performance of firm texture and no whey precipitation.

[0040] In a sixth aspect, an embodiment of the present invention provides a method for culturing the thermophilic subspecies of Streptococcus salivarius, the culturing method comprising: inoculating the thermophilic subspecies of Streptococcus salivarius into M17 broth culture medium and culturing for 4-8 hours.

[0041] It should be noted that the present invention optimizes the culture method of Streptococcus salivarius thermophilic subspecies, especially the incubation time, based on the M17 broth culture medium. It has been found through experiments that the Streptococcus salivarius thermophilic subspecies in the present invention is in its logarithmic phase between 0-4 hours, enters the stable phase at about 4 hours, and the viable count begins to decline at about 8 hours, with the highest viable count at 5.5 hours. Therefore, the incubation time can be 4h-8h, and a large amount of viable Streptococcus salivarius thermophilic subspecies can be cultivated. In addition, the culture temperature is a problem well known in the art that is applicable to strain growth, i.e., 37°C-45°C, preferably 42°C.

[0042] In order to better understand the present invention, the content of the present invention is further explained below with reference to specific examples, but the content of the present invention is not limited to the following examples.

[0043] In the following examples, M17 broth medium and agar powder were provided by Beijing Solebow Technology Co., Ltd., and skim milk powder was provided by Ningxia Yimei Biotechnology Co., Ltd.

[0044] Example 1 The present invention provides the Streptococcus salivarius thermophilus subspecies ( Streptococcus salivarius subsp. thermophilus ) The origin, isolation, purification and identification process of TY-ST24.

[0045] (1) Experimental materials Collect yak yogurt (home-brewed yak yogurt from villagers in Amuhu Village, Youganning Town, Henan Mongolian Autonomous County, Huangnan Tibetan Autonomous Prefecture, Qinghai Province) in a sampling tube and tighten the lid.

[0046] (2) Isolation and purification of TY-ST24 Pipette 1 mL of sample into 9 mL of sterile saline to obtain 10 -1 diluent, then draw 1mL 10 -1 The dilution was added to 9 mL of sterile saline to obtain 10 -2 Dilution, follow this operation to obtain 10 -3 , 10 -4 , 10 -5 and 10 -6 Dilution. Take 200 μL of samples with different dilutions (10 -3 , 10 -4 , 10 -5 and 10 -6 ), were spread on M17 solid culture medium (M17 solid culture medium was obtained by adding 2 g of agar powder to 100 mL of M17 broth medium), and incubated anaerobically at 42°C for 24 h. The morphology of the colonies on the plates was observed, and single colonies with different morphologies were selected to isolate the strains by the plate streak method. Then, another single colony was picked from the streaked plate for further streak purification. This streak operation was repeated until a purified strain, named TY-ST24, was obtained. Morphological observation was performed by Gram staining.

[0047] The colony morphology of the strain Figure 1 As shown, after purification, the strain formed single colonies in solid culture medium. The colonies had a uniform morphology, were hemispherical, white and opaque, with a smooth and moist surface and flat edges.

[0048] Gram staining results Figure 2 As shown, purple cell morphology was observed under a microscope after Gram staining ( Figure 2 The original image is purple and has a spherical shape, which is determined to be Gram-positive bacteria (G + ).

[0049] (3) Identification of TY-ST24 PCR amplification was performed using a 25 µL reaction system: 1 µL template, 1 µL upstream primer (SEQ ID NO. 2 (agagtttgatcctggctcag)) (10 µM), 1 µL downstream primer (SEQ ID NO. 3 (tacgacttaaccccaatcgc)) (10 µM), 12.5 µL 2× Taq PCR Master Mix, and the volume was made up to 25 µL with sterile ultrapure water; PCR amplification procedure: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min, for a total of 35 cycles; and end extension at 72°C for 10 min.

[0050] After sequence amplification, the qualified PCR amplification products were sequenced by Sangon Biotech (Shanghai) Co., Ltd., and the sequence was shown as SEQ ID NO.1. After obtaining the sequence, BLAST was used to search and perform similarity comparison and homology analysis in GenBank. The results of 16S rDNA homology analysis showed that TY-ST24 was Streptococcus salivarius thermophilus subsp. Streptococcus salivarius subsp. thermophilus ).

[0051] Example 2 The present invention tests the fermentation performance of TY-ST24, specifically including a fermentation speed test, a fermentation quality test, and a post-acidification test.

[0052] (1) Accurate raw materials Culture and treatment of strains: Take the strains preserved in glycerol at -80℃, inoculate them into M17 broth culture medium at a 2% inoculum, culture them at 42℃ for 18h, and activate the strains for 3 generations.

[0053] Preparation of milk powder culture medium: Weigh 120 g skim milk powder and 70 g white sugar and dissolve them in 1 L of water. Sterilize at 95℃ for 10 min to obtain the milk powder culture medium used in the experiment.

[0054] (2) Fermentation speed test The activated strains in step (1) were inoculated into the milk powder medium prepared in step (1) at a 2% inoculation rate, and fermented at 42°C. The pH value of the milk powder medium was monitored using an acidity tester (AMS Alliance iCINAC, the same below). The pH value was measured once every minute, and the fermentation time corresponding to the pH reaching 4.5 was recorded, and the pH change was monitored.

[0055] The results showed that the fermentation time of TY-ST24 strain to pH 4.5 was 413 min (6.88 h); the pH value changes were as follows Figure 3 As shown, the results showed that TY-ST24 had a short lag period in the early stage and a delayed pH decrease in the later stage, indicating that TY-ST24 had a fast fermentation speed and weak post-acidification.

[0056] (3) Fermentation quality test The activated TY-ST24 strain in (1) was inoculated into the milk powder medium in (1) at a rate of 2%, and fermented at 42°C for 10 h. The fermented milk was as follows: Figure 4 As shown, the results showed that the fermented milk obtained by TY-ST24 had no whey precipitation and had a relatively firm texture.

[0057] (4) Post-acidification test The pH value of the fermented milk prepared by TY-ST24 fermentation in (3) was tested using an acidity tester, and the pH was measured again after being stored in a 4°C environment for 7 days. The results are shown in Table 1.

[0058] Table 1 Changes in pH value of yogurt fermented by strain TY-ST24 It can be seen from Table 1 above that the pH value of the fermented milk obtained by fermentation with TY-ST24 changes the least, indicating that the strain TY-ST24 of the present invention has weak acidity after fermentation.

[0059] From the above, it can be seen that the fermentation performance of the strain TY-ST24 of the present invention is excellent and better than that of other strains.

[0060] Example 3 The embodiment of the present invention provides a growth medium, culture temperature and culture time suitable for strain TY-ST24 in M17 broth culture medium.

[0061] (1) Strain activation The strains stored in glycerol at -80°C were inoculated into M17 broth at a 2% inoculum volume and cultured at 42°C for 18 h to activate the strains for two generations.

[0062] (2) Cultivation at different temperatures The activated strain in (1) was inoculated into M17 broth at a 2% inoculum volume and cultured at 37°C, 40°C, 42°C and 45°C for 6 h. The number of viable bacteria was counted by the plate pouring method. The results were as follows: Figure 5 The results showed that the growth of TY-ST24 was similar at all temperatures, with no significant difference, and the number of viable bacteria was slightly higher at 42℃.

[0063] (3) Cultivation at different times The activated strain in (1) was inoculated into M17 broth at a 2% inoculum volume and cultured at 42°C for 0 h, 3 h, 4 h, 4.5 h, 5 h, 5.5 h, 6 h, 6.5 h, 7 h and 8 h, respectively. The number of viable bacteria was counted by the plate pouring method. The results are as follows: Figure 6 The results showed that TY-ST24 was in its logarithmic phase between 0 and 4 hours, entered the stable phase at about 4 hours, and the number of viable bacteria began to decrease at about 8 hours, with the highest number of viable bacteria at 5.5 hours.

[0064] Example 4 The embodiments of the present invention provide different freeze-dried bacterial powders prepared from strain TY-ST24 and different freeze-dried protective agents, and provide corresponding preparation methods and viable bacterial count measurements. (1) Culture and treatment of strains Take the strain preserved in glycerol at -80℃, inoculate it into M17 broth culture medium at a 2% inoculation rate, and culture it at 42℃ for 18h. After the strain is activated for 3 generations, inoculate TY-ST24 into M17 broth culture medium at a 2% inoculation rate and culture it at 42℃ for 5.5h.

[0065] (2) Preparation of different freeze-drying protective agents Lyoprotectant A: ① Dissolve whey protein concentrate in water to make a 5% solution (mass fraction); ② Dissolve sodium alginate in water to make a 2% solution (mass fraction); ③ Dissolve trehalose in water to make a 10% solution (mass fraction). Sterilize each of these three solutions at 110°C for 10 minutes, then mix them in a 1:1:1 volume ratio and use immediately.

[0066] Lyoprotectant B: trehalose, histidine, arginine, and lysine were dissolved in water to a concentration of 15%, 0.2%, 0.2%, and 0.2% (mass fraction), respectively. Sterilize at 110°C for 10 min and use immediately after sterilization.

[0067] Lyoprotectant C: ① Dissolve skim milk powder in water to make a 16% solution (mass ratio); ② Dissolve maltodextrin in water to make a 3% solution (mass ratio). Sterilize each solution at 110°C for 10 minutes, then mix in a 1:1 volume ratio. Use immediately after mixing.

[0068] (3) Preparation of different freeze-dried bacterial powders and measurement of viable bacterial counts The bacterial solution obtained in (1) was centrifuged at 4200 r / min for 20 min to obtain bacterial sludge, which was then weighed. 1 g of bacterial sludge was added with 5 mL and 10 mL of freeze-dried protective agents A, B, and C, respectively. After mixing, the number of viable bacteria in the protective agents was counted by the plate pouring method.

[0069] Each lyophilized protective agent containing TY-ST24 was pre-frozen at -80°C and then freeze-dried under vacuum. The lyophilized powder was collected and pulverized to a lump-free powder, and the viable count of the powder was calculated using the plate pouring method. The lyophilized powder obtained after lyophilization of protective agent B was too viscous to be completely pulverized into a powder, so viable counts were not performed on the lyophilized powder prepared with protective agent B.

[0070] The viable bacterial count results of different freeze-dried bacterial powders prepared with different ratios of freeze-dried protectant A and freeze-dried protectant C are shown in Table 2.

[0071] Table 2 Number of viable bacteria of TY-ST24 bacterial powder obtained with different freeze-drying protective agents As shown in Table 2 above, the viable bacterial count of the bacterial powder obtained after freeze-drying with Protectant C was significantly higher when the ratio of bacterial sludge to protective agent was 1:10 or 1:5, indicating that Protectant C has a better freeze-drying protection effect. In Protectant C, the viable bacterial count of the bacterial powder obtained after freeze-drying was not much different when the ratio of bacterial sludge to protective agent was 1:10 or 1:5.

[0072] In addition, the present invention also provides a comparison of the fermentation broth of strain TY-ST24 and its freeze-dried bacterial powder with existing commercial fermentation strains in terms of growth rate, fermentation time when pH reaches 4.5 and number of viable bacteria.

[0073] (1) Isolation of thermophilic Streptococcus salivarius subspecies from commercial starter cultures Take 1g of commercial starter culture (commercial starter culture number is S4.01T, from Zelenye Linii LLC, Russia, the same below) and add it to 9mL of sterile saline to obtain 10 -1 diluent, then draw 1mL 10 -1 The dilution was added to 9 mL of sterile saline to obtain 10 -2 Dilution, follow this operation to obtain 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , 10 -8 , 10 -9 Dilution. Take 200 μL of samples with different dilutions (10 -6 , 10 -7 , 10 -8 and 10 -9 ), were spread on M17 solid medium (M17 solid medium was obtained by adding 2 g of agar powder to 100 mL of M17 broth medium), and cultured at 42°C for 24 h. The morphology of the colonies on the plates was observed, and single colonies with different morphologies were selected to isolate the strains by the plate streak method. Then, another single colony was picked from the streaked-purified plate and continued to be streaked and purified. This streak operation was repeated until a purified strain was obtained, which was Streptococcus salivarius subspecies thermophilicus isolated from a commercial starter culture.

[0074] (2) Comparison of strains isolated from TY-ST24 fermentation broth and commercial starter cultures TY-ST24 preserved in glycerol at -80°C and Streptococcus salivarius thermophilus subsp. salivarius isolated from a commercial starter were inoculated into the M17 broth culture medium in Example 3 at a 2% inoculum rate, respectively, and cultured at 42°C for 18 h to activate the strains for two generations.

[0075] The activated strains were inoculated into M17 broth at a 2% inoculum size and incubated at 42°C for 5.5 hours. After the incubation period, the viable bacterial count in the fermentation broth was measured by the plate pour method. Separately, the fermentation broth was inoculated into the milk powder medium described in Example 2 at a 2% inoculum size and fermented at 42°C. The pH of the milk powder medium was monitored using an acidity monitor.

[0076] The changes in the number of viable bacteria in the fermentation broth and the pH value of the milk powder culture medium are as follows: Figure 7 The results showed that there was no significant difference in the number of viable bacteria of Streptococcus salivarius thermophilus subspecies obtained in TY-ST24 and commercial starter cultures under the same culture conditions. The number of viable bacteria in TY-ST24 was 3.47×10 8 , Streptococcus salivarius subsp. thermophilus in commercial starter cultures was 3.40×10 8 The fermentation curves of Streptococcus salivarius subsp. thermophilus in TY-ST24 and commercial starter cultures were basically the same, and the fermentation rates of the two strains were similar, with the time to pH 4.5 being 4.86 h and 4.78 h, respectively.

[0077] (3) Comparison of TY-ST24 freeze-dried bacterial powder and commercial starter culture isolated strains The TY-ST24 bacterial powder prepared in Example 4 (freeze-drying protectant C was selected, and the ratio of bacterial mud to freeze-drying protectant (g:mL) was 1:5) was mixed with a commercial starter (containing only Streptococcus salivarius thermophilic subsp. salivarius) at 10 8 The solution was added to the milk powder culture medium prepared in Example 2 at an addition rate of 100 CFU / mL and fermented at 42°C. The pH of the milk powder culture medium was monitored using an acidity tester. In addition, the number of viable bacteria in the fermented milk was measured by the plate pouring method after 7 hours of fermentation.

[0078] The changes in pH value of milk powder culture medium and the number of viable bacteria in fermented milk after 7 hours are as follows: Figure 8 As shown in the figure, the fermentation curves of TY-ST24 freeze-dried bacterial powder and commercial starter isolates were basically the same, and the fermentation rates of the two strains were comparable. Although the number of viable bacteria in the yogurt obtained by fermenting TY-ST24 for 7 h was slightly lower than that obtained by fermenting the commercial starter isolate for 7 h, the number of viable bacteria in the yogurt obtained by fermenting TY-ST24 for 7 h was 6.5×10 8 CFU / g, which is still higher than the lactic acid bacteria count ≥1×10 in the National Food Safety Standard: Fermented Milk 6 requirements.

[0079] In summary, the thermophilic Streptococcus salivarius subspecies TY-ST24 of the present invention and the starter prepared therefrom have good fermentation ability.

[0080] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions of the present invention, which should all be covered by the scope of the claims of the present invention.

Claims

1. A strain of Streptococcus salivarius subsp. thermophilus, whose deposit number is CGMCC No. 31385.

2. A microbial agent, characterized in that The bacterial agent includes the thermophilic subspecies of Streptococcus salivarius according to claim 1, and the bacterial agent includes a freeze-dried bacterial agent, a solid bacterial agent, a bacterial suspension or a fermentation liquid.

3. The microbial agent according to claim 2, characterized in that The bacterial agent is a freeze-dried bacterial agent, and the raw materials for preparing the freeze-dried bacterial agent include bacterial mud and freeze-drying protective agent, and the freeze-drying protective agent includes skim milk powder and maltodextrin.

4. The microbial agent according to claim 3, characterized in that The mass volume ratio of bacterial sludge and freeze-drying protective agent is 1g: (5mL-10mL).

5. Use of the Streptococcus salivarius subspecies thermophilic according to claim 1 or the bacterial agent according to any one of claims 2 to 4 in the preparation of fermented dairy products.

6. The use according to claim 5, characterized in that Streptococcus salivarius subspecies thermophilic or the agent has one or more of the following functions: (i) Streptococcus salivarius subspecies thermophilic or the bacterial agent has the function of increasing the fermentation rate, and the pH of the fermented milk reaches 4.5-4.6 within 10 hours; (ii) Streptococcus salivarius subspecies thermophilic or bacterial agents have a weak post-acidification function; (iii) the fermented dairy product is fermented milk, and the Streptococcus salivarius subspecies thermophilic or the bacterial agent has the function of improving the texture of the fermented milk, and the prepared fermented milk has a firm texture; (iv) The fermented dairy product is fermented milk, and the Streptococcus salivarius subspecies thermophilic or the bacterial agent has the function of reducing whey precipitation in the fermented milk, so that the prepared fermented milk does not have whey precipitation.

7. A method for preparing fermented milk, characterized in that: The preparation method comprises: fermenting a fermented milk base using the thermophilic Streptococcus salivarius subspecies described in claim 1 or the bacterial agent described in any one of claims 2 to 4 to obtain the fermented milk.

8. Fermented milk prepared by the preparation method according to claim 7.

9. A method for culturing Streptococcus salivarius subspecies thermophilic according to claim 1, characterized in that: The culture method comprises: inoculating Streptococcus salivarius thermophilic subspecies into M17 broth culture medium and culturing for 4 hours to 8 hours.

10. The culture method according to claim 9, characterized in that The incubation time is 5.5h.

Images