Pseudomonas aeruginosa KS1-2 and application thereof

By using bacteria agents made of Pseudomonas aeruginosa KS1-2 isolated from rice fields, the problems of pathogenic bacteria resistance and ecological imbalance caused by chemical agents are solved, and effective biological control of rice diseases is achieved.

CN120505253APending Publication Date: 2025-08-19YANGZHOU UNIV
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510777457.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-11
Publication Date
2025-08-19

AI Technical Summary

Technical Problem

In the prevention and control of rice diseases, the long-term use of chemical agents leads to imbalance in pathogenic bacteria resistance and rice field ecosystems, and lacks effective biological control methods, especially for bacterial streak disease and streak blight.

Method used

Pseudomonas aeruginosa KS1-2 isolated from rice fields is used to prepare bacterial agents to inhibit a variety of plant pathogens, including bacteria and fungi, and is used to prevent and control rice diseases through culture fluid and filtrate.

Benefits of technology

Pseudomonas aeruginosa KS1-2 significantly inhibits a variety of rice pathogens, has broad-spectrum antibacterial properties, is green and environmentally friendly, reduces diseases, and lays the foundation for biological pesticides.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120505253A_ABST
    Figure CN120505253A_ABST
Patent Text Reader

Abstract

The invention discloses Pseudomonas aeruginosa KS1-2 and application thereof, the strain is separated from a soil sample in a rice field and is preserved in the China General Microbiological Culture Collection Center (CGMCC), and the preservation number is CGMCC NO.33996. The invention further discloses a method for preparing the Pseudomonas aeruginosa KS1-2. The Pseudomonas aeruginosa KS1-2 has the advantages that the Pseudomonas aeruginosa KS1-2 can be used for preparing the Pseudomonas aeruginosa. The pseudomonas aeruginosa KS1-2 has a remarkable inhibition effect on a plurality of rice pathogenic bacteria; the growth of various plant pathogenic fungi can be effectively inhibited, and the broad-spectrum antibacterial property is achieved; the strain and the microbial inoculum can be prepared into a biocontrol agent for preventing and treating plant pathogens, can reduce plant diseases, are green and environment-friendly, have good application potential, and lay a foundation for research and development of multifunctional biocontrol microbial inoculum and biopesticide.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to Pseudomonas aeruginosa, in particular to Pseudomonas aeruginosa KS1-2 and application thereof. Background Art

[0002] Rice is a globally important food crop, yet it is often threatened by diseases during its growth, resulting in annual yield losses of up to 10-15%. Rice diseases can be categorized into two main types: bacterial and fungal. Bacterial leaf blight and bacterial leaf streak are representative examples of bacterial diseases. The former invades through water pores on the leaf margins, forming grayish-white spots; the latter forms water-soaked streaks on the leaves, leading to a decrease in photosynthetic capacity. Among fungal diseases, rice blast and sheath blight are the most serious. Blast can cause a "burned stalk"-like death, while sheath blight causes leaf sheath rot and lodging.

[0003] Currently, disease control relies primarily on breeding resistant varieties and chemical pesticides. While significant success has been achieved in developing varieties resistant to blast and bacterial blight through the discovery of disease-resistance genes, effective germplasm resources for bacterial leaf streak and sheath blight remain scarce. This has led to the predominance of chemical control. Long-term and extensive use of chemical control has, on the one hand, led to the development of resistance in pathogens; in some rice-growing areas, resistance to triazole pesticides has exceeded 60%. Furthermore, it has led to the accumulation of heavy metals in the soil and imbalanced rice paddy ecosystems, creating a conflict with the goal of green agricultural development. Summary of the Invention

[0004] Purpose of the invention: The purpose of the present invention is to provide a Pseudomonas aeruginosa KS1-2 isolated from rice field soil samples with broad-spectrum anti-plant pathogen activity; the second purpose is to provide the application of the Pseudomonas aeruginosa KS1-2.

[0005] Technical solution: The Pseudomonas aeruginosa KS1-2 described in the present invention has a deposit number of CGMCC NO.33996.

[0006] The strain Pseudomonas aeruginosa KS1-2 of the present invention is deposited in the General Microbiology Center of the China Culture Collection Administration of Microorganisms (CGMCC) with a deposit number of CGMCC NO.33996 and a deposit date of March 27, 2025. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China, Postal Code 100101.

[0007] The bacterial agent of the present invention contains any one of Pseudomonas aeruginosa KS1-2, its live bacteria culture solution, its culture solution filtrate, and its live bacteria freeze-dried powder.

[0008] Preferably, the live bacteria culture fluid is a bacteria-containing culture fluid obtained by inoculating a single colony of Pseudomonas aeruginosa KS1-2 into KB liquid culture medium and culturing the culture fluid.

[0009] Preferably, the culture filtrate is a sterile culture fluid obtained by inoculating a single colony of Pseudomonas aeruginosa KS1-2 in KB liquid culture medium and culturing it at 26-30° C. and 180-220 r / min for 70-74 hours, followed by centrifugation and filtration.

[0010] Preferably, the KB liquid culture medium contains 20.0 g / L of peptone, 1.5 g / L of magnesium sulfate heptahydrate, 1.5 g / L of potassium hydrogen phosphate and 1% glycerol by volume.

[0011] The invention relates to the use of the Pseudomonas aeruginosa KS1-2 or bacterial agent in preventing and treating agricultural plant infectious diseases.

[0012] Preferably, the plant infectious diseases include rice bacterial leaf streak, rice sheath blight, rice bacterial leaf blight, cabbage black rot, tomato gray mold, and wheat fusarium head blight.

[0013] Preferably, the application is the application of inhibiting the growth of plant pathogens.

[0014] Preferably, the plant pathogens include fungi and bacteria, wherein the fungi include Rhizoctonia solani, Botrytis cinerea, and Fusarium graminearum; and the bacteria include Xanthomonas oryzae pv.oryzicola, Xanthomonas campestris pv.campestris, and Xanthomonas oryzae pv.oryzae.

[0015] Beneficial effects: Compared with the existing technology, the present invention has the following significant advantages: 1. The Pseudomonas aeruginosa KS1-2 is isolated from the rice field and has a significant inhibitory effect on a variety of rice pathogenic bacteria; 2. The strain can also effectively inhibit the growth of a variety of plant pathogenic fungi and has a broad-spectrum antibacterial property; 3. The strain or bacterial agent can be made into a biocontrol agent for preventing and controlling plant pathogens, reducing plant diseases, being green and environmentally friendly, and having good application potential, laying the foundation for the research and development of multifunctional biocontrol agents and biological pesticides. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a preliminary screening diagram of antagonistic bacteria against rice bacterial leaf streak pathogen;

[0017] Figure 2Figure 2 is an antagonistic effect diagram of Pseudomonas aeruginosa KS1-2, wherein A is an inhibitory effect diagram against rice bacterial leaf streak pathogen, and B is an inhibitory effect diagram against rice sheath blight pathogen;

[0018] Figure 3 This is the colony morphology of Pseudomonas aeruginosa KS1-2;

[0019] Figure 4 This is the 16S rDNA phylogenetic tree of Pseudomonas aeruginosa KS1-2;

[0020] Figure 5 Figure 1 is an antibacterial effect diagram of the sterile filtrate of Pseudomonas aeruginosa KS1-2 fermentation, wherein A is an inhibitory effect diagram against rice bacterial leaf streak fungus, and B is an inhibitory effect diagram against rice sheath blight fungus;

[0021] Figure 6 Figure 1 is the result of the inhibition spectrum test of Pseudomonas aeruginosa KS1-2, where A is the inhibition effect diagram against tomato gray mold, B is the inhibition effect diagram against wheat fusarium, C is the inhibition effect diagram against rice bacterial blight, and D is the inhibition effect diagram against cabbage black rot.

[0022] Figure 7 This is the field control efficacy test of Pseudomonas aeruginosa KS1-2, where A is the representative photos and statistical results of the control of rice bacterial leaf streak fungus, and B is the representative photos and statistical results of the control of rice sheath blight fungus. DETAILED DESCRIPTION

[0023] The technical solution of the present invention is further described below.

[0024] Example 1: Isolation, purification and identification of Pseudomonas aeruginosa KS1-2

[0025] 1. Isolation and purification of KS1-2

[0026] (1) Soil samples were collected from rice fields in a certain city and brought back to the laboratory. The soil samples were diluted with sterile water continuously, with each dilution being 10 times, and 10 -1 -10 -7 After the suspension is allowed to stand, 10 -3 -10 -7 100 μL of each suspension supernatant of different concentrations was evenly spread on solid LB medium using a plate spreader;

[0027] (2) Place the plate in a 28°C incubator for 24 hours, and pick a single colony for preliminary antagonistic screening.

[0028] (3) Antagonistic bacterial activity detection:

[0029] Xanthomonas oryzae pv.oryzicola was streaked on NA plates for activation, and a single colony was transferred to NB medium at 28°C and shaken at 200 rpm until the OD 600 =1.0, take 600 μL of bacterial suspension and add it to 100 mL of NA medium cooled to 40°C, mix thoroughly and pour into plates;

[0030] After the strain to be tested was activated by streaking on the LA plate, a single colony was picked and transferred to LB medium and cultured at 28°C with shaking at 200 r / min until the OD 600 =1.0, 2 μL of the bacterial solution was added dropwise to the above-mentioned NA plate mixed with Xanthomonas oryzae pv. oryzicola, and cultured in a 28°C incubator for 2 days before observing the inhibition zone.

[0031] (4) Antagonistic fungal activity detection:

[0032] Take a 5mm diameter bacterial cake of rice sheath blight pathogen cultured on PDA medium for 7 days and place it in the center of a fresh PDA plate using an inoculation needle;

[0033] After the strain to be tested was activated by streaking on the LA plate, a single colony was picked and transferred to LB medium and cultured at 28°C with shaking at 200 r / min until the OD 600 =1.0, take 2 μL of bacterial solution and drop it on the plate 3 cm away from the mycelial block, and culture it at 25℃ for 3 days.

[0034] (5) Select strains with obvious antibacterial effects, record and save them, and repeat each test three times.

[0035] Antagonistic bacteria screening Figure 1 As shown, KS1-2 has a more significant effect on antagonizing the rice bacterial leaf streak pathogen Xanthomonas oryzae pv. oryzicola.

[0036] The antibacterial effect of strain KS1-2 on rice bacterial leaf streak pathogen Xanthomonas oryzae pv.oryzicola and rice sheath blight pathogen Rhizoctonia solani is shown in the figure. Figure 2 As shown, it has significant inhibitory effects on both pathogens.

[0037] (6) Strain KS1-2 was inoculated into solid LB medium. After 48 h of culture, the colonies were as follows: Figure 3 As shown, it is round, with a rough surface and edges, yellow-green in color, and a metallic luster on the surface of the colony.

[0038] 2. Molecular identification of KS1-2

[0039] The genomic DNA of KS1-2 strain was extracted using a bacterial genome extraction kit and used as a template to amplify 16S rDNA by PCR.

[0040] The upstream primer was universal primer 27F at a concentration of 10 mM, and its sequence was AGAGTTTGATCCTGGCTCAG; the downstream primer was universal primer 1492R at a concentration of 10 mM, and its sequence was GGTTACCTTGTTACGACTT;

[0041] The 50 μL PCR amplification system includes: 25 μL of 2× Taq Master Mix, 2 μL of each of the upstream and downstream primers mentioned above, 1 μL of the genomic DNA of the KS1-2 strain obtained above, and 20 μL of ddH2O.

[0042] PCR reaction conditions were: 94°C for 3 min, followed by 34 cycles of 94°C for 30 s, 57°C for 30 s, and 72°C for 60 s, and finally 72°C for 5 min. Amplified products were sequenced by Shanghai Qingke Biotechnology Co., Ltd. The resulting gene sequences were assembled and analyzed for homology using NCBI (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi). Sequences of highly homologous strains were downloaded, and a phylogenetic tree was constructed using MEGA software (v11).

[0043] Phylogenetic tree Figure 4 As shown, the strain KS1-2 had the highest homology with Pseudomonas aeruginosa, which was 99%, and was identified as Pseudomonas aeruginosa and named Pseudomonas aeruginosa KS1-2.

[0044] Example 2: Determination of antibacterial effect of Pseudomonas aeruginosa KS1-2 fermentation sterile filtrate

[0045] After Pseudomonas aeruginosa KS1-2 was streaked and activated on an LA plate, a single colony was picked and transferred into 50 mL of KB medium containing 20.0 g / L peptone, 1.5 g / L magnesium sulfate heptahydrate, 1.5 g / L potassium hydrogen phosphate, and 1% glycerol by volume;

[0046] After fermentation and cultivation at 28°C and 200 r / min for 72 h, the KS1-2 fermentation broth was centrifuged at 5000 r / min for 10 min, and the supernatant was collected. The supernatant was preliminarily filtered using a 0.45 μm sterile PVDF filter membrane, and then filtered twice using a 0.22 μm sterile PES filter membrane to obtain the KS1-2 fermentation sterile filtrate.

[0047] The antibacterial activity of Xanthomonas oryzaepv.oryzicola in the sterile fermentation filtrate was detected by the Oxford cup method:

[0048] After the rice bacterial leaf streak pathogen Xanthomonas oryzae pv. oryzicola was streaked on NA plates for activation, a single colony was picked and inoculated into NB medium at 28°C and shaken at 200 rpm until the OD 600 =1.0, take 600 μL of the suspension of Xanthomonas oryzae pv.oryzicola, the bacterial leaf streak pathogen of rice, and add it to 100 mL of NA medium cooled to 40°C, mix thoroughly, and pour on the plate;

[0049] After the culture medium solidifies, place a sterilized Oxford cup on the surface of the culture medium, add 150 μL of KS1-2 fermentation sterile filtrate or an equal volume of KB culture medium into the Oxford cup, culture in a 28°C incubator for 2 days, and observe the inhibition zone.

[0050] The antibacterial activity against Rhizoctonia solani was tested by directly adding the fermentation sterile filtrate into the culture medium:

[0051] The fermentation sterile filtrate was mixed with PDA medium cooled to 40°C at a volume ratio of 1:10 and then poured into a plate. PDA medium with an equal volume of KB medium added was used as a control.

[0052] A 5 mm diameter bacterial cake of Rhizoctonia solani cultured on PDA medium for 7 days was taken and placed in the center of the PDA plate using an inoculating needle. The culture was kept at 25°C until the control group of Rhizoctonia solani grew all over the plate. The growth of Rhizoctonia solani on the PDA plate with the addition of fermentation sterile filtrate was observed.

[0053] The results are as follows Figure 5 As shown in Figure 2, the fermentation sterile filtrate of KS1-2 can inhibit the growth of Xanthomonas oryzae pv.oryzicola, a bacterial leaf streak pathogen of rice, and form a transparent circle ( Figure 5 A); Compared with the control group, the growth of rice sheath blight pathogen Rhizoctonia solani was significantly inhibited on PDA medium mixed with KS1-2 fermentation sterile filtrate ( Figure 5 B).

[0054] Example 3: Determination of the Inhibition Spectrum of Pseudomonas aeruginosa KS1-2

[0055] (1) Antagonistic fungal activity detection:

[0056] Take a 5 mm diameter bacterial cake of Botrytis cinerea or Fusarium graminearum cultured on PDA medium for 7 days and place it in the center of different fresh PDA plates using an inoculating needle.

[0057] After Pseudomonas aeruginosa KS1-2 was activated by streaking on LA plates, a single colony was picked and transferred to LB medium and cultured at 28°C with shaking at 200 rpm until OD 600 =1.0, take 2 μL of bacterial solution and drop it on the plate 3 cm away from the mycelial block, and culture it at 25℃ for 3 days.

[0058] (2) Antagonistic bacterial activity detection:

[0059] The cabbage black rot pathogen Xanthomonas campestris pv.campestris or rice bacterial blight pathogen Xanthomonas oryzae pv.oryzae were streaked on NA plates and activated. Single colonies were transferred to NB medium and cultured at 28°C with shaking at 200 rpm until OD 600 =1.0, take 600 μL of the suspension of cabbage black rot fungus Xanthomonas campestris pv. campestris or rice bacterial leaf blight fungus Xanthomonas oryzae pv. oryzae, add them to 100 mL of NA medium cooled to 40°C, mix thoroughly and pour into plates;

[0060] After Pseudomonas aeruginosa KS1-2 was activated by streaking on LA plates, a single colony was picked and transferred to LB medium and cultured at 28°C with shaking at 200 rpm until OD 600 =1.0, 2 μL of bacterial solution was added dropwise to the above NA plate mixed with cabbage black rot pathogen Xanthomonas campestris pv.campestris or rice bacterial leaf blight pathogen Xanthomonas oryzae pv.oryzae, and cultured in a 28°C incubator for 2 days before observing the inhibition zone.

[0061] The results are as follows Figure 6 As shown in the figure, the results of the inhibition spectrum test showed that the biological preparation of Pseudomonas aeruginosa KS1-2 had a strong antibacterial effect and a broad inhibition spectrum. It had a strong inhibition on the growth of the above four test pathogens. The hyphae at the edge of the colonies of the two pathogenic fungi in contact with Pseudomonas aeruginosa KS1-2 grew sparsely or stopped growing.

[0062] Example 4: Field control efficacy determination of Pseudomonas aeruginosa KS1-2

[0063] Zhonghua 11 rice was used as the experimental plant for field control efficacy determination.

[0064] 1. Field control efficacy test of pathogenic bacteria Pseudomonas aeruginosa KS1-2

[0065] The KS1-2 treatment group was treated as follows: 500 μL OD 600 = 1.0 KS1-2 bacterial suspension and 500 μL OD 600 =1.0, the bacterial suspension of Xanthomonas oryzae pv. oryzicola, the bacterial leaf streak pathogen of rice, was thoroughly mixed and inoculated into the leaves of Zhonghua 11 rice plants using the injection inoculation method. The specific method was as follows: before inoculation, the leaf surface was wiped with 75% ethanol for disinfection, a sterile syringe without a needle was used to draw up the mixed bacterial suspension, and the mixture was pressed on the back of the rice leaf for 2 seconds. After inoculation, the humidity was maintained above 90%, and the disease was observed regularly.

[0066] The control group was treated as follows: 500 μL LB medium and 500 μL OD 600 = 1.0 of the bacterial leaf streak pathogen Xanthomonas oryzae pv. oryzicola suspension, after thorough mixing, inoculated into the leaves of Zhonghua 11 rice plants using the above-mentioned injection inoculation method;

[0067] The KS1-2 treatment group and the control treatment group were treated with 10 rice leaves each. The environmental conditions were controlled at a daytime temperature of 26±2℃ and a nighttime temperature of 21±1℃. The light conditions simulated natural conditions with 14 hours of light and 10 hours of darkness. The disease was investigated and recorded 14 days after inoculation.

[0068] 2. Field control efficacy test of pathogenic fungi of Pseudomonas aeruginosa KS1-2

[0069] The rice sheath blight pathogen Rhizoctonia solani was cultured on PDA medium for 5 days, and a 5 mm diameter bacterial cake was taken. Rice leaves with the same growth status were selected, and leaves with a length of 10 to 15 cm were cut and transferred to an inoculation box for moisture preservation. The detached leaves were then inoculated with the rice sheath blight pathogen Rhizoctonia solani bacterial cake.

[0070] The KS1-2 treatment group was treated as follows: 20 μL OD 600= 1.0 KS1-2 bacterial suspension, then inoculate the rice sheath blight pathogen Rhizoctonia solani bacterial cake, place it in a 240×240mm inoculation box, seal it to keep it moist, transfer it to suitable temperature and light conditions for cultivation, and observe the disease regularly;

[0071] The control group was treated as follows: 20 μL of LB medium was dripped onto the inoculation site of rice leaves, and then inoculated with the rice sheath blight pathogen Rhizoctonia solani cake using the above-mentioned rice leaf in vitro inoculation method;

[0072] Five rice leaves were treated in each of the KS1-2 treatment group and the control treatment group, and the leaves were transferred to a 25°C incubator and cultured under 14 h of light and 10 h of darkness. The disease condition of the leaves was observed after 5 days.

[0073] The results are as follows Figure 7 As shown in Figure 2, the control effect of Pseudomonas aeruginosa KS1-2 on rice bacterial leaf streak is as follows: Figure 7 A. The lesion length of the control group was significantly higher than that of the KS1-2 treatment group. The control effect of Pseudomonas aeruginosa KS1-2 on rice sheath blight was as follows: Figure 7 B, The lesion area in the control group was significantly higher than that in the KS1-2 treatment group.

Claims

1. A Pseudomonas aeruginosa KS1-2, whose deposit number is CGMCC NO.33996.

2. A bacterial agent, characterized in that The bacterial agent contains any one of Pseudomonas aeruginosa KS1-2, its live bacteria culture solution, its culture solution filtrate, and its live bacteria freeze-dried powder.

3. The microbial agent according to claim 2, characterized in that The live bacteria culture fluid is a bacteria-containing culture fluid obtained by inoculating a single colony of Pseudomonas aeruginosa KS1-2 into a KB liquid culture medium and culturing the culture fluid.

4. The microbial agent according to claim 2, characterized in that The culture filtrate is a sterile culture fluid obtained by inoculating a single colony of Pseudomonas aeruginosa KS1-2 into a KB liquid culture medium and culturing the culture medium, followed by centrifugation and filtration.

5. The bacterial agent according to claim 3 or 4, characterized in that The culture conditions are 26-30° C., 180-220 r / min, and 70-74 h.

6. Use of the Pseudomonas aeruginosa KS1-2 according to claim 1 or the bacterial agent according to any one of claims 2 to 4 in preventing and treating plant infectious diseases.

7. The use according to claim 6, characterized in that The plant infectious diseases include rice bacterial leaf streak, rice sheath blight, rice bacterial leaf blight, cabbage black rot, tomato gray mold, and wheat fusarium head blight.

8. The use according to claim 6, characterized in that The application is the application of inhibiting the growth of plant pathogens.

9. The use according to claim 8, characterized in that The plant pathogens include fungi and bacteria.

10. The use according to claim 9, characterized in that The fungi include rice sheath blight fungus (Rhizoctonia solani), tomato gray mold fungus (Botrytis cinerea), and wheat head blight fungus (Fusarium graminearum); the bacteria include rice bacterial leaf streak fungus (Xanthomonas oryzae pv. oryzicola), cabbage black rot fungus (Xanthomonas campestris pv. campestris), and rice bacterial leaf blight fungus (Xanthomonas oryzae pv. oryzae).

Citation Information

Cited By

  • Pseudomonas chlororaphis S7-24 for antagonizing xanthomonas oryzae and application of pseudomonas chlororaphis S7-24

    CN121736985A