Application of OsSMT1 gene in regulation and control of selenium stress tolerance of rice
By cloning and overexpressing the OsSMT1 gene, the tolerance of rice to selenium stress is enhanced, the problem of low cultivation efficiency of selenium stress tolerance in rice is solved, efficient endogenous regulation of selenium-rich rice is achieved, and the selenium stress tolerance and physiological response ability of rice is improved.
Patent Information
- Application Number
- CN202510744238.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-05
- Publication Date
- 2025-08-19
AI Technical Summary
The cultivation methods for selenium stress tolerance in the prior art are inefficient and lack effective molecular-level regulatory measures, resulting in the production of selenium-rich rice that depends on exogenous selenium application and lack of safe and efficient endogenous regulatory measures.
By cloning the OsSMT1 gene, recombinant vectors are constructed and overexpressed in rice, the tolerance of rice to selenium stress is enhanced, and the OsSMT1 gene is used to regulate the rice selenium metabolism pathway and improve the rice tolerant tolerance to selenium.
Transgenic plants overexpressing OsSMT1 gene grow well under high selenium stress, which improves the selenium stress tolerance of rice, enhances the antioxidant enzyme activity and malondialdehyde content in roots, stems, and leaves, and enhances the response ability to selenium stress. It is suitable for cultivating high-quality rice rich in selenium.
Smart Images

Figure CN120505293A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of plant molecular breeding, and particularly relates to application of the OsSMT1 gene in regulating selenium stress tolerance in rice. Background Art
[0002] Rice is the world's most important food crop. Eating selenium-enriched rice is a safe and effective way for the human body to absorb selenium. However, most selenium-enriched rice is produced by applying selenium exogenously. Therefore, cultivating selenium-enriched rice at the molecular level is an extremely effective method. Selenocysteine methyltransferase (SMT) is a key enzyme in the plant selenium metabolism pathway. SMT There are still very few research reports. Summary of the Invention
[0003] In view of the above-mentioned deficiencies in the prior art, the object of the present invention is to provide an application of the OsSMT1 gene in regulating selenium stress tolerance in rice.
[0004] The first object of the present invention is to provide OsSMT1 protein, the amino acid sequence of which is shown in SEQ ID NO.2.
[0005] The second object of the present invention is to provide an OsSMT1 gene encoding the OsSMT1 protein.
[0006] Preferably, the nucleotide sequence of the CDS of the OsSMT1 gene is shown in SEQ ID NO.1.
[0007] The third object of the present invention is to provide a recombinant vector containing the OsSMT1 gene.
[0008] The fourth object of the present invention is to provide a recombinant cell containing the OsSMT1 gene.
[0009] The fifth object of the present invention is to provide the use of the OsSMT1 gene in regulating selenium stress tolerance in rice.
[0010] Preferably, the application is the application of overexpressing the OsSMT1 gene in improving the selenium stress tolerance of rice.
[0011] The present invention increases our understanding of the molecular regulatory network of rice selenium, clarifies the physiological response mechanism of rice to excess selenium, and provides a basis for the targeted cultivation of high-quality selenium-rich rice.
[0012] The present invention clones the OsSMT1 gene and promoter fragment, performs bioinformatics analysis, constructs a transient expression vector and a GUS fusion expression vector, and then transforms the GUS fusion expression vector into rice. Finally, the expression pattern of the OsSMT1 gene is analyzed by subcellular localization, GUS histochemical staining, and real-time fluorescence quantitative PCR. It is found that transgenic plants overexpressing the OsSMT1 gene grow well under high selenium stress and respond to high selenium stress by increasing the activities of CAT, SOD, POD, and APX in roots, stems, and leaves, increasing the malondialdehyde content in roots, stems, and leaves, and increasing the proline content in roots, showing high selenium stress tolerance. Therefore, the OsSMT1 gene can be used to cultivate and produce high-quality rice varieties enriched with selenium. BRIEF DESCRIPTION OF THE DRAWINGS
[0013] Figure 1 yes OsSMT1 The gene structure of ; yellow lines represent exons; blue lines represent untranslated regions; and black horizontal lines represent introns.
[0014] Figure 2 It is a phylogenetic tree analysis; the species abbreviations correspond to: Os: Oryza sativa ;Me: Manihot esculenta ; Hb: Hevea brasiliensis ;Jc: Jatropha curcas ; Rc: Ricinus communis ;Pa: Populus alba ;Ss: Salix suchowensis ;Pe: Populus euphratica It: Ipomoea triloba ;In: Ipomoea nil ;Tc: Theobroma cacao ;Dz: Durio zibethinus ;Hs: Hibiscus syriacus ; Zj: Ziziphus jujuba ;Cs: Cannabis sativa ; Nn: Nelumbo nucifera ; Cn: Cocos nucifera ; Pd: Phoenix dactylifera ; Eg: Elaeis guineensis ;Ma: Musa acuminata ; Mt: Musa troglodytarum ;Ac: Ananas comosus ;Lr: Lolium rigidum ;.
[0015] Figure 3 It is the analysis of plant SMT conserved motifs; the conserved motifs of plant SMT proteins, among which 8 conserved motifs and their sequences were analyzed in 23 crop SMTs. ZmSMY2 as well as WsSMY2 No identical conserved motifs were detected in the .
[0016] Figure 4 yes OsSMT1 Secondary structure prediction diagram; the blue lines in the figure represent α-helices; the orange lines represent random coils; the green lines represent β-turns; and the red lines represent extended chains.
[0017] Figure 5 yes OsSMT1 Schematic diagram of the tertiary structure; the blue curve represents the α-helix; the orange-yellow curve represents the random coil; the green curve represents the β-turn; and the red curve represents the extended chain.
[0018] Figure 6 yes OsSMT1 Amplified fragment detection and recombinant plasmid pBWA(V)HS- OsSMT1 -GloSGFP colony PCR detection; A: amplification OsSMT1 Fragment, M: DL5000 DNA Marker; 1-2: PCR results of target fragment; B: Colony PCR detection of recombinant plasmid pBWA(V)HS-OsSMT1-Glosgfp, M: DL2000 DNA Marker; 1-5: Colony PCR results; 6: Water (blank control).
[0019] Figure 7 It is analysis OsSMT1 Subcellular localization of the recombinant plasmid pBWA(V)HS-OsSMT1-Glosgfp; A: Subcellular localization results of empty pBWA(V)HS-Glosgfp; B: Subcellular localization results of the recombinant plasmid pBWA(V)HS-OsSMT1-Glosgfp; (GFP) is the green fluorescent protein channel, (Merge) is the merged image of the two channels, and (BF) is the bright field channel; bars = 10 μm.
[0020] Figure 8 It is amplification OsSMT1 PCR detection of E. coli colonies transformed with promoter fragment and P-rDNAG1; A: amplification OsSMT1 Promoter fragment, M: DL6000 DNA Maker; 1: PCR result of target fragment; B: M: DL6000 DNAMarker; 3, 6, 7: PCR results of positive clone colonies.
[0021] Figure 9 yes OsSMT1 Gene fragment amplification and interference expression vector colony PCR; A: OsSMT1 Fragment amplification electrophoresis, M: DL 6000 DNA Maker; 1: OsSMT1 -F (201 bp), 2: catalase intron fragment loop (200 bp), 3: OsSMT1-R (201 bp); B: electrophoresis of colony PCR of overexpression vector, M: DL 6000 DNA Marker; 1-2: results of colony PCR, detecting a fragment of about 405 bp; 1: OsSMT1 F(+), loop(-); 2: OsSMT1 R(+), loop(-).
[0022] Figure 10 yes OsSMT1 Gene amplification and overexpression vector colony PCR; A: OsSMT1 Amplification electrophoresis, M: DL6000 DNA Maker; 1: PCR result of target fragment (1008 bp); B: PCR electrophoresis of overexpression vector colonies; M: DL6000 DNA Marker; 1-5: Results of colony PCR, detecting a fragment of approximately 472 bp.
[0023] Figure 11 This is the electrophoresis diagram of the PCR amplification results of the hygromycin fragment; M: DL2000 DNA Marker; 1-15: T3 generation OsSMT1 Transformation lines fused with the gene promoter and GUS reporter gene; 16: wild-type Haihong 11 rice plants (negative control).
[0024] Figure 12 GUS staining of transgenic rice seeds 10 days after germination; A: staining of transgenic rice seeds on the 10th day after germination (bars = 1 cm); B, C: coleus and its magnified image (bars = 1 mm); D, E: stem and its magnified image (bars = 1 mm); F, G: leaf and its magnified image (bars = 1 mm).
[0025] Figure 13 The phenotypes of rice treated with different selenium concentrations; 7-day-old rice seedlings were treated with (A) 0 and (B) 80 μM sodium selenite for 20 days (bar = 5 cm); from left to right are Haihong 11, OsSMT1 Gene overexpression transgenic plants OsSMT1 Gene interference expression transgenic plants, OsSMT1 Transgenic plants with GUS fused to the gene promoter.
[0026] Figure 14 Figure 3: Plant lengths of transgenic plants 20 days after high-selenium treatment. A: Aboveground lengths of four lines under high-selenium treatment. B: Belowground lengths of four lines under high-selenium treatment. Data are the mean and standard deviation (SD) of three experimental replicates. Multiple comparisons and significance analysis were performed using the Duncan method. Different letters represent significant differences, p ≤ 0.05.
[0027] Figure 15 The results were obtained from the roots, stems and leaves of transgenic rice treated with 0 and 80 μM selenium. OsSMT1 Relative expression level; A: wild-type rice Haihong 11; B: overexpression OsSMT1 Rice; C: interference expression OsSMT1 Rice; D: GUS-expressing rice.
[0028] Figure 16 It is a physiological response index in roots, stems and leaves of overexpressed transgenic rice under selenium stress; the selenium toxicity concentration is 80 μM Se, and the control group is 0 μM Se. OsSMT1 Eight physiological parameters of rice are shown: (A) catalase (CAT), (B) superoxide dismutase (SOD), (C) peroxidase (POD), and (D) ascorbate peroxidase (APX) activities; (E) malondialdehyde (MDA), (F) proline, (G) soluble sugar, and (H) soluble protein content. The experiment was repeated three times, and the results are presented as mean and standard deviation. Duncan's multiple comparison method was used to compare differences in Se toxicity between groups. Different lowercase letters in the bar graph indicate significant differences (p < 0.05). DETAILED DESCRIPTION
[0029] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention.
[0030] Example 1 1. Methods 1. OsSMT1 Bioinformatics analysis (1) OsSMT1 It is a member of the SMT gene family. OsSMT1 Nucleic acid sequence analysis: The genomic sequence and transcript sequence were obtained through the Phytozome (http: / / www.phytozome.net) database and analyzed using the online analysis website GSDS (https: / / gsds.gao-lab.org). OsSMT1 The program was set to BLASTP-protein query to protein db, the expected threshold was -1, the comparison matrix was BLOSUM62, and the word length was the default value; the most homologous OsSMT1 Sea rice protein.
[0031] (2) OsSMT1 Protein secondary and tertiary structure analysis: SOPMA (https: / / npsaprabi.ibcp.fr) was used to analyze the protein secondary and tertiary structures. OsSMT1 The secondary structure of the succinylcholine was analyzed and predicted using the online website SWISS-MODEL (https: / / swissmodel.expasy.org / ) OsSMT1 The tertiary structure.
[0032] (3) OsSMT1 Protein transmembrane structure analysis: Analyze using the online website GSDS (http: / / gsds.cbi.pku.edu.cn / ) OsSMT1 The basic structure of the , using online prediction software TMHMM (https: / / services.healthtech dtu dk / services / TMHMM-2.0 / ) prediction OsSMT1 transmembrane region.
[0033] (4) OsSMT1 Protein phylogenetic tree analysis: MEGA12 software was used to OsSMT1 Phylogenetic tree analysis was performed with 25 SMT proteins from other species (Table 1), and the phylogenetic tree was beautified using the Evolview website (https: / / evolgenius info / / evolview).
[0034] Table 1 Species and protein names used to construct the phylogenetic tree (5) OsSMTl Protein conserved motif prediction: analysis using the online website MEME (https: / / memesuite.org / meme / ) OsSMT1 The conserved motifs of the protein and SMTs of other species.
[0035] 2. OsSMT1 Subcellular localization Referring to the reported method, primers P1 were designed: cagtGGTCTCacaacatgagtcaacaaggggagta and P2:cagtGGTCTCatacaaactccatgcagagccttcg clone OsSMT1The fragment (excluding the 3 bases of the stop codon) was separated and recovered, and the recovered product was labeled as rDNAG1. The rDNAG1 and the transient expression vector pBWA(V)HS-Glosgfp were digested separately with the restriction endonuclease Bsa I and the digestion products were recovered. The digestion products were ligated using T4 DNA ligase. The ligated products were transformed into DH5α Escherichia coli strains and screened for resistance on LB (Luria Bertani) nutrient agar plates (containing 50 μg / mL kanamycin). After incubation at 37°C for 12 hours, colony PCR was performed using primers P3: ttcatttggagagaacacgggggac and P4: aggacttgaagccttctcag. The plasmid of the recombinant vector with a positive test result was named pBWA(V)HS- OsSMT1 -Glosgfp.
[0036] Take the stems and leaves of rice seedlings grown in the dark at approximately 30°C for 7-15 days, remove the outermost leaf sheath, and mince (<0.5 mm), totaling approximately 5-10 g. Add 5-10 mL of enzymatic hydrolysis solution until the tissue is completely submerged. Then, perform enzymatic hydrolysis at 28°C with shaking (100 rpm) for 5-6 hours. Filter the protoplasts through a 40 μm filter and centrifuge for 10 minutes until a turbid precipitate is visible. Discard the supernatant and wash twice with 10 mL of pre-chilled W5 solution. Centrifuge at 25°C for 5 minutes until a turbid precipitate is visible at the bottom of the tube. Resuspend the protoplasts in 500 μL of MMG solution as needed.
[0037] Microscopic examination: Add 200 μL of protoplast suspension and 10 μL of DNA (≥500 ng of purified plasmid) to a volume of PEG solution equal to the combined volume of DNA and protoplasts. Gently mix thoroughly (for colocalization, add 10 μL of marker for cotransfection). Incubate at room temperature for 30 min. Dilute the protoplasts with 1 mL of W5. Mix thoroughly to terminate the reaction. Collect the protoplasts by centrifugation and wash one to two times with 1000 μL of W5. Finally, add 1 mL of W5 solution and transfer to a 2 mL EP tube. Incubate in the dark at 28°C for 24-48 h. Observe under a Nikon C2-ER laser confocal microscope (excitation wavelengths: 488 nm and 640 nm). Observe approximately 20-40 images per field of view at 40x magnification.
[0038] 3. OsSMT1 Excess and interference transformation The synthetic primers were as follows: F: cagtGGTCTCacaacatgagtcaacaaggggagta, R: cagtGGTCTCatacactaaactccatgcagagcct; a 1008 bp full-length fragment of the CDS of OsSMT1 was amplified and recovered, and then ligated into the pBWA(V)HS vector to construct the pBWA(V)HS- OsSMT1 The overexpression vector was expressed, and the ligation product was transformed into Escherichia coli. The transformed kanamycin (50 μg / mL) resistance plates were cultured at 7°C for 12 h. The positive clones were cultured and subjected to colony PCR and sequencing. The clones with complete and accurate sequencing were transformed into Agrobacterium and used for genetic transformation of rice.
[0039] Synthesize three pairs of primers: (1) OsSMT1 Forward fragment primer: OsSMT1 -F (F):cagtGGTCTCacaacgatggagtcaatgtagtaag, OsSMT1 -F (R): cgatGGTCTCacaggctttcttataggatcatagc; (2) loop primer: loop (F): cgatGGTCTCacctgcaggtctagtttttct, loop (R): cgatGGTCTCagcccgggctctgtaactatc; (3) OsSMT1 Reverse fragment primer: OsSMT1 -R (F): cagtGGTCTCagggcctttcttataggatcatagc, OsSMT1 -R (R): cagtGGTCTCatacagatggagtcaatgtagtaag. Primers were used to amplify 201 bp of OsSMT1 Forward segment ( OsSMT1 -F) with reverse fragment ( OsSMT1 -R), a 200bp catalase intron fragment (loop), which was recovered after electrophoresis detection and ligated into the pBWA(V)HS vector to construct pBWA(V)HS- OsSMT1 The interference expression vector was used, and the ligation product was transformed into Escherichia coli. The transformation was cultured on kanamycin (50 μg / mL) resistance plates at 7°C for 12 h. The positive clones were cultured and subjected to colony PCR and sequencing detection. The clones with complete and accurate sequencing were transformed into Agrobacterium and used for genetic transformation of rice.
[0040] Take mature rice seeds, dehull and disinfect them, and then inoculate them into callus induction medium. Pick out rice callus that has grown to a certain size and place them in Agrobacterium suspension for infection; place the infected callus on a co-culture medium for co-cultivation, and then transfer it to a hygromycin selection medium for the first screening; transfer the initial callus with resistant callus to a new medium for the second screening, and pick out the resistant callus and transfer it to a culture dish containing differentiation medium; seal it with sealing film and place it in a constant temperature culture room to wait for differentiation into seedlings; when the seedlings grow to about 1 cm, transfer them to a rooting medium for seedling growth.
[0041] 4. OsSMT1 Genetic transformation of promoter-fused GUS reporter gene Amplification OsSMT1 The promoter sequence was recovered. The original promoter CAMV35S (35S) inserted into the multiple cloning site of the pBWA(V)HG-GUS plasmid was removed by enzyme digestion with Bsa I, and the target fragment was OsSMT1 The promoter was digested with the same enzymes, and then the digested promoter fragment and the vector were ligated. The ligation product was labeled P-rDNAG1. The ligation product was then transformed into Escherichia coli, transformed into kanamycin (50 μg / mL)-resistant plates, and cultured at 7°C for 12 h. Positive clones were cultured and tested by colony PCR and sequencing. The clones with complete and accurate sequencing were transformed into Agrobacterium and used for genetic transformation of rice.
[0042] 5. Transgenic Rice Screening Hygromycin resistance detection primers were designed: P7: 5'-ACGGTGTCGTCCATCACAGTTTGCC-3', P8: 5'-ttccGGAAGTGCTTGACATTGGGGA-3'. Fresh plant leaf samples were collected and PCR amplified using a rapid PCR detection kit (see the kit instructions for details). Amplified products were directly subjected to agarose gel electrophoresis. The PCR amplification program used was: 94°C for 5 min; 35 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 20 s; and 72°C for 10 min.
[0043] 6. GUS staining of transgenic rice Three-day-old and 10-day-old GUS-transgenic rice seedlings (wild-type rice plants served as controls) were immersed in GUS staining solution and incubated overnight at 37°C. The seedlings were then removed, rinsed and destained two to three times with 95% ethanol, and preserved in standard fixative (formalin-acetic acid-alcohol (FAA). The GUS staining solution consisted of 50 mmol / L Na₃PO₃ buffer, 0.5 mmol / L K₃[Fe(CN)₆], 0.5 mmol / L K₄[Fe(CN)₆], 10 mmol / L Na₂EDTA, 1 mL / L Triton X-100, 1.0 mg / mL X-gluc, and 200 mL / L methanol.
[0044] 7. Planting material processing Rice seeds with plump grains, intact seed coats, and uniform size were selected. The seeds were rinsed with tap water and sterilized with 10% sodium hypochlorite for 30 minutes. After being thoroughly rinsed five times with distilled water, the seeds were soaked in distilled water for one day and then germinated on damp filter paper in 13.5 cm Petri dishes at 30°C in the dark for 24 hours. Sixty germinated seeds were then transferred to 12 cm diameter plastic pots covered with nylon mesh. Seedlings were grown in a growth chamber at an ambient temperature of 27°C, a 12 / 12 h light / dark cycle, 70% relative humidity, and a light intensity of 2000 lux. Full-strength Kimura medium B nutrient solution was used, and the rice seedlings were treated with 0 and 80 μM sodium selenite (Na2SeO3) for 20 days.
[0045] 2. Results 1. OsSMT1 The genetic structure Through the research methods of the predecessors: Based on the amino acid sequence of the reported SMT of hairy potato, BLAST comparison was performed on Phytozome (http: / / www.phytozome.net) to obtain the rice SMT family sequence, one of which is OsSMT1 The genomic and protein sequences of the gene were obtained through the Phytozome online database, and the structure of the gene was obtained using the online analysis software GSDS ( Figure 1Results showed that the genomic sequence of this gene is 3112 bp, containing 6 introns and 7 exons, with an untranslated region at both the 5' and 3' ends. The open reading frame is 1008 bp long (nucleotide sequence shown in SEQ ID NO. 1), encoding 335 amino acids (amino acid sequence shown in SEQ ID NO. 2), with a molecular weight of 36.51 kDa, a theoretical isoelectric point of 4.85, and a hydrophilicity of -0.102. The protein encoded by this gene lacks a transmembrane domain, and its secondary structure contains a high proportion of α-helices and random coils: random coils (36.93%), α-helices (43.16%), β-turns (7.57%), and extended strands (12.34%).
[0046] 2. Phylogenetic tree analysis OsSMT1 The protein sequences were downloaded from the Phytozome database and compared with the NCBI database by BLAST analysis. The NCBI accession number of each protein sequence used is listed in Table 1. OsSMT1 23 SMTs from other species were used for phylogenetic tree analysis. Multiple alignments of protein sequences were generated using Clustal W. The following species were arranged into a phylogenetic tree using the neighbor-joining method with 1000 bootstrap replicates. MEGA12 software and Evolview website were used to analyze the phylogenetic tree. OsSMT1 The 23 SMT proteins from other species were used for phylogenetic tree analysis. The results showed that these 24 proteins were clearly divided into three major branches in phylogeny, represented by Group I, II, and III ( Figure 2 ). Further analysis revealed that OsSMT1 The SMT proteins with higher phylogenetic similarity include: Cocos nucifera (CnSMT2), Lolium rigidum (LrSMT2), Phoenix dactylifera (PdSMT2), Elaeis guineensis (EgSMT2), Ananas comosus (AcSMT2), Musa acuminata (MaSMT2), and Musa troglodytaru (MtSMT), which belong to Group Ⅰ; NnSMT2 belongs to Group Ⅱ, and the SMT proteins of the remaining 16 species all belong to Group Ⅲ.
[0047] 3. OsSMT1 Conserved motif analysis Using online website MEME analysis OsSMT1 The results showed that the conserved motifs of SMT in other species OsSMT1 The conserved motifs of SMT proteins from other species are relatively consistent ( Figure 3), and have at least eight conserved motifs. These conserved motifs indicate that the SMT family members of plants are highly conserved in their amino acid sequences.
[0048] 4. OsSMT1 Secondary structure and tertiary structure Through the SOPMA online website OsSMT1 The secondary structure of . Figure 4 The results show OsSMT1 The secondary structure contains 36.93% random coil, 43.16% α-helix, 7.57% β-turn and 12.34% extended chain. OsSMT1 The tertiary structure of the protein was predicted and modeled. ` The results show that: Figure 5 The tertiary structure prediction has a great similarity with the secondary structure. There are the most blue lines in the tertiary structure, indicating that α helices occupy the majority of them, and multiple random coils ultimately constitute OsSMT1 The tertiary structure.
[0049] 5. Cloning OsSMT1 The cDNA of the leaves of the sea rice variety Haihong 11 (HH11) was used as a template and the upstream primer P1: (5'-cagtGGTCTCacaacatgagtcaacaaggggagta -3') and the downstream primer P2: (5'-cagtGGTCTCatacactaaactccatgcagagcct -3') were used to amplify the gene. OsSMT1 Coding region sequence ( OsSMT1 A), which is 1005 bp in size (excluding the 3 bases of the stop codon). After sequencing and analysis, it was confirmed to be completely consistent with the gene sequence in the database. Figure 6 The fragment was connected to the pBWA(V)HS-Glosgfp vector, and the recombinant pBWA(V)HS-OsSMT1-GLosgfp was transformed into Escherichia coli (DH5α) for preservation ( OsSMT1 B).
[0050] 6. Figure 6 Subcellular localization Will OsSMT1 The recombinant plasmid pBWA(V)HS- OsSMT1-Glosgfp was transferred into protoplast recipient cells for expression. The fluorescence signal was observed by laser scanning confocal microscope (5 uLSCM), where OsSMT1 The green fluorescence of the promoter-driven GFP fusion expression is distributed in the cytoplasm, and there is also a small amount of green fluorescence signal on the cell membrane ( OsSMT1 A), and as a control, after the empty pBWA(V)HS-Glosgfp was transferred into leaf protoplasts, green fluorescence signals were seen in all parts ( Figure 7 B), it can be seen that Figure 7 Proteins are mainly located in the cell matrix and cell membrane OsSMT1 The OsSMT1 gene promoter amplification primers P5: (5'-cagtGGTCTCatagagacagcgatggcagctccat-3') and P6: (5'-cagtGGTCTCagttgtttctccggcgatgtcggcg-3') were designed to amplify the OsSMT1 promoter sequence for recovery. The original promoter CAMV35S (35S) inserted into the multiple cloning site of the pBWA(V)HG-GUS plasmid was removed by enzyme digestion with BsaI, and the target fragment POsSMT1 was digested with the same enzyme. The promoter fragment after enzyme digestion and the vector were then ligated, and the ligation product was labeled as vector P-rDNAG1. The ligation product was then transformed into Escherichia coli and cultured on a kanamycin (50 μg / mL)-resistant plate at 7°C for 12 hours. The positive clones were cultured and colony PCR was performed using primers P7: (5'-GCCACTCCTACAGTCCTACC-3') and P8: (5'-ATAAAAAGAGAAAAGGGTCCTAACC-3') to detect the promoter fragment of about 661 bp ( OsSMT1 The positive clones were further sequenced and the results showed that the pBWA(V)HG-POsSMT1-GUS vector had been successfully constructed.
[0051] 8. Figure 8 Interference and overexpression vector construction Amplify 201 bp OsSMT1 Forward segment ( OsSMT1 -F) with reverse fragment ( OsSMT1 -R), a 200 bp catalase intron fragment (loop) was recovered and ligated into the pBWA(V)HS vector to construct pBWA(V)HS- OsSMT1 Interference expression vector ( OsSMT1A), the ligation product was transformed into Escherichia coli, and after screening on a kanamycin (50 μg / mL) resistance plate, the positive clones were cultured and subjected to colony PCR ( Figure 9 B) Sequence the positive clones, and the clones with complete and accurate sequencing are transformed into Agrobacterium and used for genetic transformation of rice.
[0052] Amplification of 1008 bp Figure 9 The full-length fragment was recovered and ligated into the pBWA(V)HS vector to construct pBWA(V)HS- OsSMT1 Overexpression vector ( OsSMT1 A), the ligation product was transformed into Escherichia coli, and after screening on a kanamycin (50 μg / mL) resistance plate, the positive clones were cultured and subjected to colony PCR ( Figure 10 B) Sequence the positive clones, and the clones with complete and accurate sequencing are transformed into Agrobacterium and used for genetic transformation of rice.
[0053] 9. Resistance screening of transgenic rice plants For research Figure 10 The expression pattern of the promoter will be constructed OsSMT1 A promoter-driven GUS fusion expression vector (pBWA(V)HG-POsSMT1-GUS) was used to transform rice plants via Agrobacterium infection, and T0 seeds were harvested. Hygromycin resistance was selected for successive generations until the T3 generation, using the hygromycin resistance gene as a marker gene. Direct PCR detection of the hygromycin fragment in leaves of T3 plants revealed that the band size was consistent with the expected hygromycin fragment size (280 bp) by electrophoresis. OsSMT1 ).
[0054] 10. GUS Staining of Transgenic Rice Plants GUS histochemical staining was performed on T3 transgenic rice plants germinated for 10 days. Figure 11 Figure 12 ). The staining results showed that OsSMT1 The promoter was expressed in the entire aerial part of 10-day-old rice seedlings, but almost no expression was observed in the roots ( Figure 12 A). After zooming in, we can see that OsSMT1 In the coleus ( Figure 12 BC), vascular bundles in the stem ( Figure 12 DE) and occipital ( Figure 12 FG) were expressed.
[0055] 11. Phenotypic Observation of Transgenic Plants Figure 13The rice phenotypes treated with different selenium concentrations showed that the growth phenotypes of the transgenic plants were reduced to varying degrees compared with the Haihong 11 plants. Among the three transgenic plants, the OsSMT1 gene overexpression transgenic plants grew better than the OsSMT1 gene interference expression transgenic plants and the OsSMT1 gene promoter fused with GUS under high selenium stress.
[0056] 12. Changes in transgenic plant length under selenium stress To evaluate the effects of selenium toxicity on the growth of transgenic rice seedlings, we measured the differences in aboveground and belowground lengths of rice plants under normal and selenium-stress conditions. Rice seedlings were treated with 0 and 80 µM sodium selenite for 20 days. The results showed that compared to wild-type plants, the aboveground and belowground lengths of transgenic plants were reduced ( Figure 14 Among the transgenic plants, the overexpressing strain had the longest shoot length, while the interference-expressing and GUS-transgenic strains were similar in shoot length. Under selenium stress, the length of both wild-type and transgenic plants decreased significantly.
[0057] 13. Effect of selenium stress on transgenic plants OsSMT1 Effect of relative expression In order to explore the effects of transgenic plants on selenium stress OsSMT1 The effects of 0 and 80 μM selenium treatment on the relative expression of β-catenin in rice roots, stems and leaves were analyzed by real-time fluorescence quantitative PCR. OsSMT1 The expression level ( Figure 15 ). The results showed that in the wild type, OsSMT1 The expression levels of all genes increased significantly under selenium stress, with the highest increase in leaves. Compared with the wild type, the expression levels of the overexpression plants increased in roots, stems, and leaves, with the growth rates from high to low being leaves > roots > stems. The interference expression plants and GUS transgenic plants showed similar trends to the overexpression plants. Compared with the wild type plants under 0 treatment, the expression levels of the overexpression plants in roots, stems, and leaves increased significantly. OsSMT1 The expression level increased significantly, and the increase was significantly greater than that of the interference expression plants and GUS-transfected plants.
[0058] 14. Physiological response indicators in roots, stems and leaves of transgenic rice overexpressing selenium under selenium stress Through quantitative experiments, the transgenic plants were compared OsSMT1 The effect of relative expression levels was found. The expression levels of overexpressing plants were significantly higher in roots, stems and leaves than in other plants. Therefore, the overexpressing plants were used as research objects to continue the experiment. Eight physiological response indicators were measured. The experimental results are as follows.
[0059] Compared with the CK group, the CAT activities in roots, stems and leaves under Se stress increased by 15.13%, 15.31% and 16.39%, respectively ( Figure 16 A). Similarly, under high selenium stress, superoxide dismutase (SOD) activity increased by 102.16%, 103.23% and 38.89% in roots, stems and leaves, respectively ( Figure 16 B). Under Se stress, POD activities in roots, stems, and leaves increased significantly by 142.42%, 151.15%, and 156.71%, respectively ( Figure 16 C). APX activity also increased significantly in roots, stems, and leaves by 131.46%, 84.73%, and 132.74%, respectively, under stress treatment ( Figure 16 D). The malondialdehyde contents in roots, stems and leaves increased significantly by 31.25%, 35.56% and 48.08% respectively under Se treatment ( Figure 16 E). Compared with the CK group, the proline content in stems and leaves did not change significantly under Se stress, increasing by 16.84% and 7.14%, respectively, but the proline content in roots increased significantly by 113.33% ( Figure 16 F). Compared with the CK group, the soluble sugar content in leaves, roots and stems showed an overall downward trend under high selenium stress, but no significant changes occurred ( Figure 16 G). The soluble protein content in leaves and roots decreased slightly under selenium stress, but not significantly. The soluble protein content in stems decreased significantly by 16.22% ( Figure 16 H).
Claims
1. OsSMT1 protein, characterized in that The amino acid sequence is shown in SEQ ID NO.
2.
2. OsSMT1 gene, characterized in that Encodes the OsSMT1 protein according to claim 1.
3. The OsSMT1 gene according to claim 2, wherein The nucleotide sequence of CDS is shown in SEQ ID NO.
1.
4. A recombinant vector containing the OsSMT1 gene according to claim 2. A recombinant cell comprising the OsSMT1 gene according to claim 2. Use of the OsSMT1 gene according to claim 2 in regulating selenium stress tolerance in rice.
7. The use according to claim 6, characterized in that The application of overexpression of OsSMT1 gene in improving selenium stress tolerance of rice.