Interference sequence for improving drought tolerance of brassica napus and application of interference sequence

Abstract

The invention discloses an interference sequence for improving brassica napus drought tolerance and application thereof, the interference sequence targets a BnaA7.ARF17 gene in brassica napus, the interference sequence can reduce the expression level of the gene, and the interference sequence is an antisense sequence of SEQ ID NO: 1 or an RNA interference hairpin structure. The BnaA7.ARF17 gene in the brassica napus is targeted, and an antisense sequence or RNA interference hairpin structure of the BnaA7.ARF17 gene is utilized, so that the expression level of the gene can be accurately and efficiently reduced, the drought tolerance of the brassica napus is remarkably enhanced, an effective gene regulation strategy is provided for coping with drought stress, and the application prospect is broad. The yield and the quality of the brassica napus under the drought condition can be improved, and meanwhile, the biotechnological means for improving the drought tolerance of the brassica brassicae plants of the cruciferae is expanded.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and genetic engineering, and specifically relates to a method for BnaA7.ARF17 Gene interference sequences, methods for constructing RNA interference vectors, methods for improving drought tolerance of Brassica napus, and related applications. Background Art

[0002] Brassica napus ( Brassica napus ) is one of the world's important oil crops. Its seeds have a high oil content and are widely used in the production of edible oil and biofuels. According to statistics, the annual planting area of Brassica napus in my country exceeds 7 million hectares, accounting for one-third of the world's total planting area, and its rapeseed oil production accounts for about 47% of the total domestic vegetable oil. However, Brassica napus is extremely susceptible to drought stress during its growth process. Due to its high water demand during the growth period and poor drought resistance, drought will lead to a decrease in plant seedling rate, slow growth, and wilting of leaves, ultimately resulting in a significant decrease in yield and quality. As global climate change intensifies, the frequency and intensity of droughts are increasing year by year, further threatening the stable and high yield of Brassica napus.

[0003] Currently, improving drought resistance in Brassica napus relies primarily on traditional breeding and marker-assisted selection (MAS). However, traditional breeding is time-consuming, inefficient, and difficult to precisely control specific genes. MAS, on the other hand, relies heavily on natural variation and limited genetic resources. In recent years, gene editing technologies (such as CRISPR-Cas9) and transgenic technology have provided new avenues for improving crop stress tolerance. However, these studies have primarily focused on model plants (such as Arabidopsis thaliana) or a few key genes (such as DREB and NAC transcription factors), leaving insufficient exploration of specific regulatory networks in Brassica napus.

[0004] Auxin response factors (ARFs) are key transcription factors that regulate plant growth, development, and responses to stress. Among them, the ARF17 gene has been shown to negatively regulate drought tolerance in plants by inhibiting antioxidant enzyme activity and promoting the accumulation of reactive oxygen species (ROS). For example, overexpression of MdARF17 in apple trees causes drought sensitivity, while knocking out this gene significantly improves drought tolerance. However, the function of ARF17 in Brassica napus remains unclear, and the application of targeted regulatory techniques (such as RNA interference) to improve drought tolerance remains a mystery. Summary of the Invention

[0005] To solve the above problems, the present invention proposes for the first time to target the BnaA7.ARF17 gene to reduce its expression level, thereby enhancing the drought tolerance of the plant.

[0006] The inventors have made continuous innovations through long-term exploration and attempts, as well as multiple experiments and efforts. To solve the above technical problems, the present invention provides an interference sequence for improving the drought tolerance of Brassica napus. The interference sequence targets the BnaA7.ARF17 gene, the BnaA7.ARF17 The nucleotide sequence of the gene is shown in SEQ ID NO: 1. The interfering sequence can reduce the expression level of the gene and comprises any of the following sequences or functionally equivalent variants thereof: (a) an antisense sequence of the nucleotide sequence shown in SEQ ID NO: 1; (b) RNA interference hairpin structure formed by connecting SEQ ID NO: 1 and its antisense sequence through a spacer region.

[0007] Compared with the prior art, the present invention has the following beneficial effects: By targeting the BnaA7.ARF17 The gene, using its antisense sequence or RNA interference hairpin structure, can accurately and efficiently reduce the expression level of the gene, thereby significantly enhancing the drought tolerance of Brassica napus. It provides an effective gene regulation strategy for coping with drought stress, helps to improve the yield and quality of Brassica napus under drought conditions, and at the same time expands the biotechnology means of improving the drought tolerance of Brassica plants in the Cruciferae family.

[0008] Further: the functionally equivalent variant has at least 80% homology with the nucleotide sequence of SEQ ID NO: 1 or its antisense sequence, and is capable of BnaA7.ARF17 A sequence in which the expression level of a gene is reduced to less than 50% of the wild-type level.

[0009] Furthermore: the interfering sequence is inserted into the pFGC5941M vector by homologous recombination, the promoter of the vector is 35S promoter, and the interfering sequence is located after the promoter and before the spacer, or after the spacer and before the terminator.

[0010] The present invention also provides a method for constructing an RNA interference vector of the interference sequence, comprising the following steps: (1) Designing a primer pair for specifically amplifying the sense sequence and antisense sequence of SEQ ID NO: 1, wherein the primers contain BamHI and XbaI restriction sites; (2) Using Brassica napus cDNA as a template, the sense and antisense sequences were obtained by PCR amplification; (3) Using the BamHI and XbaI restriction sites, the sense sequence and antisense sequence were inserted into the pFGC5941M vector to form an RNA interference vector containing a 35S promoter; (4) Transforming the RNA interference vector into Agrobacterium tumefaciens GV3101 strain.

[0011] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides an efficient method for constructing an RNA interference vector. By designing a primer pair containing specific restriction sites (BamHI and XbaI), PCR amplification is performed using Brassica napus cDNA as a template to obtain sense and antisense sequences. These sequences are then inserted into the pFGC5941M vector to form an RNA interference vector containing the 35S promoter, which is then transformed into the Agrobacterium tumefaciens GV3101 strain. Compared with existing technologies, this method has the following significant advantages: First, the accuracy of the amplified fragment and the efficiency of directional cloning are ensured by careful primer design and selection of appropriate restriction sites, thereby improving the success rate and stability of vector construction. Second, the Agrobacterium tumefaciens-mediated transformation method achieves efficient transformation and stable integration of the RNA interference vector in Brassica napus, providing a reliable tool for gene function research and crop genetic improvement. Finally, this method is simple to operate, low-cost, and easily repeatable, making it suitable for large-scale gene function verification and plant genetic transformation research, and is of great significance for promoting the improvement of drought tolerance in Brassica napus and related biotechnology fields.

[0012] The present invention also provides a method for improving the drought resistance of Brassica napus, comprising the following steps: (1) The constructed RNA interference vector was introduced into the hypocotyls of Brassica napus through Agrobacterium tumefaciens-mediated method; (2) Co-culture the infected hypocotyls in M1 medium without resistance, then transfer them to M2 and M3 medium for selection, induce callus, dedifferentiate and redifferentiate, and transfer them to M4 medium for rooting induction; (3) Detection of transgenic plants by qRT-PCR BnaA7.ARF17 Gene expression level, screening strains with expression levels less than 50% of the wild type; (4) The selected strains were subjected to drought stress treatment, and drought-resistant strains with a survival rate at least 30% higher than that of the wild type J9709 were selected.

[0013] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a method for improving drought tolerance of Brassica napus, which comprises introducing a constructed RNA interference vector into the hypocotyl of Brassica napus and using a complete set of screening and identification processes, including hygromycin screening, callus induction, bud regeneration and rooting culture, as well as qRT-PCR detection and drought stress experiments, to accurately screen out BnaA7.ARF17The transgenic lines showed significantly reduced gene expression and improved drought tolerance. Compared with existing technologies, this method is not only efficient and stable, but also highly operational and reproducible. It significantly improves the drought tolerance of Brassica napus, providing strong technical support for the cultivation of new Brassica napus varieties adapted to drought environments, helping to improve the yield and quality of rapeseed in arid areas, and is of great significance to ensuring the safety of edible oil and the sustainable development of agriculture in my country.

[0014] Furthermore, the specific steps of the Agrobacterium tumefaciens-mediated method include: The hypocotyls of Brassica napus were cut into 0.8-1 cm segments and immersed in Agrobacterium solution with an OD600 of 0.8 for 7 minutes. The infected hypocotyls were cultured in M1 medium in the dark for 24 hours. The hypocotyls were then transferred to M2 medium for callus induction, M3 medium for bud regeneration, and M4 medium for root induction.

[0015] Furthermore: the primers used in the qRT-PCR detection are: BnaA7.ARF17-qPCR-F: 5'-AAGATGGCTATGGAGACTGA-3'; BnaA7.ARF17-qPCR-R: 5'-GTTTTGCAGAATTCTCAGGTTC-3'.

[0016] Furthermore, the drought stress treatment is to stop watering for 4-6 days at the seedling stage, calculate the survival rate after rehydration, and screen the interference strains with a survival rate higher than that of the wild type J9709.

[0017] The present invention also provides an application of the interfering sequence in improving the drought resistance of Brassica plants in the Cruciferae family, wherein the application comprises introducing the interfering sequence into plant cells to inhibit the expression of ARF17 homologous genes.

[0018] Preferably, the Brassica plant of the family Cruciferae includes Brassica napus.

[0019] Compared with the prior art, the present invention has the following beneficial effects: The application of the interference sequence provided by the present invention in improving the drought resistance of Brassica plants in the Cruciferae family, by introducing the interference sequence into plant cells to inhibit the expression of ARF17 homologous genes, effectively enhances the drought resistance of the plants, and provides new gene resources and efficient technical means for drought-resistant breeding of Brassica plants in the Cruciferae family.

[0020] The present invention also provides a plant cell, wherein the interference sequence is integrated into the cell, and the cell BnaA7.ARF17 The gene expression level was lower than that in wild-type cells.

[0021] Compared with the existing technology, the beneficial effects of this technical solution are: The plant cell containing the interfering sequence provided by the present invention realizes the BnaA7.ARF17 The precise inhibition of gene expression makes its expression level significantly lower than that of wild-type cells, thus providing a key cell material basis for cultivating cruciferous Brassica plants with excellent drought tolerance, and helping to promote the efficient development of drought-resistant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0023] Figure 1 yes BnaA7.ARF17 Gene visualization of the sequence. Figure 1 In the figure, the yellow marked sequences are promoters and terminators, the red marked sequences are 5'UTR, the green marked sequences are 3'UTR, the grey marked sequences are introns, and the other sequences are exons.

[0024] Figure 2 Arabidopsis thaliana, rapeseed BnaA7.ARF17 Schematic diagram of the overexpression and interference vector structure. Figure 2 In A. thaliana, rapeseed BnaA7.ARF17 Schematic diagram of the overexpression vector structure; B. rapeseed BnaA7.ARF17 Schematic diagram of the interference vector structure.

[0025] Figure 3 Arabidopsis thaliana pro BnaA7.ARF17 : Schematic diagram of the GUS expression vector structure.

[0026] Figure 4 yes BnaA7.ARF17 Subcellular localization map of transiently expressed proteins in tobacco.

[0027] Figure 5 yes BnaA7.ARF17 Tissue-specific expression analysis diagram.

[0028] Figure 6 Arabidopsis overexpression strains and rapeseed overexpression and interference strains BnaA7.ARF17 expression level. Figure 6 Middle, A. thaliana BnaA7.ARF17 Overexpression lines BnaA7.ARF17 Relative expression level; B. rapeseed BnaA7.ARF17 Overexpression lines BnaA7.ARF17Relative expression level; C. rapeseed BnaA7.ARF17 Each interference strain BnaA7.ARF17 Relative expression levels.

[0029] Figure 7 Overexpression, interference BnaA7.ARF17 Response of transgenic rapeseed to soil drought stress and statistical chart of survival rate. Figure 7 A. Phenotypic diagram of rapeseed overexpression and interference lines in response to soil drought stress; B. Statistical diagram of the survival rate of rapeseed Bna.A7.ARF17 overexpression and interference lines after drought.

[0030] Figure 8 This is a phenotypic diagram and survival rate statistics of the Arabidopsis overexpression strain in response to soil drought stress. Figure 8 In the figure, A. Phenotype of Arabidopsis overexpression lines in response to soil drought stress; B. Statistical graph of the survival rate of Arabidopsis overexpression lines after drought. DETAILED DESCRIPTION

[0031] The following describes the details in conjunction with specific embodiments.

[0032] In the present invention, unless otherwise specified, all equipment and raw materials can be purchased from the market or are commonly used in the industry. The methods in the following embodiments, unless otherwise specified, are all conventional methods in the art.

[0033] Example 1 Brassica napus is an oil crop, and drought stress seriously affects the growth and yield of Brassica napus. BnaA7.ARF17 The interference sequence of the gene enhances the drought tolerance of Brassica napus by reducing the expression level of the gene. BnaA7.ARF17 The gene structure of the sequence Figure 1 According to the research results of this research group, BnaA7.ARF17 Overexpression of the gene will reduce the drought tolerance of Brassica napus, so this gene was selected as the target gene and the interference sequence was designed to reduce its expression level.

[0034] The construction of interference sequences includes: (1) Antisense sequence design: BnaA7.ARF17 The antisense sequence is designed based on the nucleotide sequence of the gene (shown in SEQ ID NO: 1). BnaA7.ARF17 The complementary binding of the gene's mRNA prevents its translation process, thereby reducing the gene's expression level.

[0035] (2) Construction of RNA interference hairpin structure: The sense sequence and antisense sequence of SEQ ID NO: 1 are connected through the spacer to form an RNA interference hairpin structure. This hairpin structure can be recognized and processed into small interfering RNA (siRNA) in plant cells, specifically targeting BnaA7.ARF17 The mRNA of the gene is degraded, thereby reducing the expression of the gene.

[0036] according to BnaA7.ARF17 Gene sequence-specific primers were designed, and the primer sequences were as follows: BnaA7.ARF17 -F7: GCCACTAGTATGTCCGCCGCCGCCGT (SpeI); BnaA7.ARF17 -R7: CTGGCGCGCCCATGCCTTGAGCA (Sgrl / AscI).

[0037] PCR amplification: Using the cDNA of Brassica napus as template, PCR amplification was performed using the above primers to obtain BnaA7.ARF17 Gene fragment.

[0038] In vitro transcription reaction: After PCR product purification, use an in vitro transcription kit (such as T7 RiboMAX™ Express RNAi System, Promega) to perform in vitro transcription to synthesize RNA with interference sequence.

[0039] By designing BnaA7.ARF17 The researchers successfully obtained an interfering sequence for the gene, including its antisense sequence and an RNA interference hairpin structure, and performed in vitro transcription and verification, successfully obtaining an interfering sequence that effectively reduces the expression level of the gene. This laid the foundation for the subsequent use of this interfering sequence to improve drought tolerance in Brassica napus. In subsequent examples, the interfering sequence was inserted into an RNA interference vector and further introduced into Brassica napus plants through genetic transformation methods to achieve the goal of improving their drought tolerance.

[0040] Example 2 This embodiment aims to construct a target comprising the design in Example 1 BnaA7.ARF17 The RNA interference vector containing the gene interference sequence will be used in subsequent research on improving the drought tolerance of Brassica napus. By inserting the interference sequence into a suitable plant expression vector, the stable expression of the interference sequence in plant cells is achieved, thereby reducing BnaA7.ARF17 The expression level of the gene can enhance the drought tolerance of Brassica napus.

[0041] (1) Vector selection and preparation The pFGC5941M vector was selected because it has a 35S promoter that drives efficient expression of the inserted sequence in plants. Furthermore, the vector contains a kanamycin resistance gene, facilitating subsequent screening of successfully transformed plants.

[0042] (II) Primer design and synthesis according to BnaA7.ARF17 Gene sequence, design primer pairs that specifically amplify the sense and antisense sequences. The primers contain BamHI and XbaI restriction sites for inserting the amplified product into the pFGC5941M vector. The primer sequences are as follows: Sense primer: BnaA7.ARF17 -RNAi-F1; Antisense primers: BnaA7.ARF17 -RNAi-R1.

[0043] (III) PCR amplification Template preparation: Brassica napus cDNA was used as template.

[0044] PCR reaction system: A 50 μL system was used, including 1 μL template cDNA, 10 μL 5× Buffer, 5 μL dNTPs (2.5 mM), 1 μL forward primer, 1 μL reverse primer, 1 μL Taq enzyme, and the rest was ddH2O.

[0045] Reaction conditions: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min, for a total of 30 cycles; and final extension at 72°C for 10 min.

[0046] (IV) Enzyme digestion and ligation Enzyme digestion reaction: The PCR product and pFGC5941M vector were digested with BamHI and XbaI, respectively, and reacted at 37°C for 2 h.

[0047] Ligation reaction: ligate the sense sequence, antisense sequence and vector after enzyme digestion, add T4 DNA ligase, and ligate at 16℃ for 2 h.

[0048] (V) Transformation and screening E. coli transformation: Transform the ligation product into competent E. coli cells, spread on LB plates containing kanamycin, and culture at 37°C for 12-16 hours.

[0049] Positive clone screening: Pick a single colony for PCR identification and sequencing to confirm that the interference sequence is correctly inserted into the vector.

[0050] This example successfully builds BnaA7.ARF17 The RNA interference vector containing the interfering sequence was named pFGC5941M- BnaA7.ARF17 -RNAi. Double enzyme digestion and sequencing confirmed that the interference sequence was correctly inserted into the vector after the 35S promoter and before the spacer, or after the spacer and before the terminator (see Figure 2 for the specific structure).

[0051] Arabidopsis transformation Transformation method: pFGC5941M- BnaA7.ARF17 -RNAi vectors were transformed into wild-type Arabidopsis thaliana.

[0052] Screening process: The transformed Arabidopsis seeds were sown on MS medium containing hygromycin and positive seedlings were screened.

[0053] Result: Get multiple BnaA7.ARF17 The interference sequence of Arabidopsis thaliana provides materials for subsequent research on the effect of interference sequence on drought tolerance of Arabidopsis thaliana. Figure 3 , Figure 3 Arabidopsis thaliana pro BnaA7.ARF17 : Schematic diagram of the GUS expression vector structure: depicts the BnaA7.ARF17 The GUS reporter gene vector structure for gene promoter activity is shown in the figure. BnaA7.ARF17 The promoter sequence of the gene is connected to the GUS reporter gene and placed downstream of the 35S promoter for research BnaA7.ARF17 The expression pattern of the gene in different tissues and developmental stages of Arabidopsis provides an important basis for understanding the function and regulatory mechanism of the gene.

[0054] Rapeseed plants obtained Overexpression vector construction: according to BnaA7.ARF17 Specific amplification primers were designed based on the gene CDS sequence and inserted into the DsRed vector to construct an overexpression vector.

[0055] Interference vector construction: BnaA7.ARF17 The gene was inserted into the pFGC5941M vector to construct an interference vector.

[0056] Genetic transformation: Agrobacterium tumefaciens-mediated rapeseed hypocotyl genetic transformation method was used to transform the overexpression vector and interference vector into Brassica napus variety J9709, respectively.

[0057] Screening and identification: Through DNA molecular positive identification and qRT-PCR detection, high-expression overexpression strains and interference strains with better interference effects were obtained.

[0058] This example successfully constructed a BnaA7.ARF17An RNA interference vector with a gene interference sequence was developed, and stable transformation of the vector in Arabidopsis thaliana and Brassica napus was achieved, providing a key material basis for subsequent research on using the interference sequence to improve the drought tolerance of Brassica napus.

[0059] Example 3 This embodiment aims to utilize the targeting BnaA7.ARF17 The RNA interference vector of the gene interference sequence is introduced into the Brassica napus plant through the genetic transformation method to screen out the interference strain with improved drought resistance, thereby providing an effective technical means for improving the drought resistance of Brassica napus.

[0060] (1) Plant materials and culture conditions Plant material: Brassica napus cultivar J9709 was selected as the recipient material.

[0061] Culture conditions: After sterilization, rapeseed seeds were sown in MS medium at 22°C / 16 h light and 20°C / 8 h dark, with a light intensity of 3000 lx.

[0062] (II) Agrobacterium transformation Agrobacterium strain preparation: RNA interference vector pFGC5941M- BnaA7.ARF17 -RNAi was transformed into Agrobacterium tumefaciens GV3101 strain.

[0063] Agrobacterium culture: Pick a single colony and inoculate it into YEB liquid medium containing kanamycin. Culture it in a shaking incubator at 28°C until the OD600 reaches about 0.8.

[0064] 3. Preparation and infection of rapeseed hypocotyls Preparation of hypocotyls: Brassica napus J9709 seeds were cultured in MS medium for 7 days to obtain hypocotyls.

[0065] Cutting and infection of hypocotyls: Cut the hypocotyls into small segments of 0.8-1 cm, place them in a sterilized culture dish, add the above-cultured Agrobacterium solution, and gently shake for infection for 7 minutes.

[0066] (IV) Screening and identification Screening process: Infected hypocotyls were incubated in M1 medium in the dark for 24 hours, then transferred to M2, M3, and M4 medium to induce callus formation, shoot regeneration, and rooting, respectively. M1 and M4 media were non-resistant, while M2 and M3 media contained hygromycin.

[0067] Positive plant identification: qRT-PCR detection of transgenic plants BnaA7.ARF17 The expression level of the gene was measured, and strains with expression levels lower than 50% of the wild type were screened out.

[0068] (V) Drought stress treatment and drought tolerance assessment Drought stress treatment: The selected interference strains and wild-type rapeseed were subjected to drought stress treatment, that is, watering was stopped for 4-6 days during the seedling stage.

[0069] Drought tolerance assessment: Observe and record phenotypic changes of the plants, including leaf wilting and dryness. Statistically calculate the survival rate of the plants after rehydration to assess the drought tolerance of the disturbed strains.

[0070] 3. Results and Verification (I) Acquisition and identification of transgenic plants Positive plant screening: multiple positive plants were obtained through hygromycin screening and qRT-PCR detection. BnaA7.ARF17 Positive interference strains whose gene expression level is less than 50% of the wild type.

[0071] Gene expression level detection: qRT-PCR results showed that BnaA7.ARF17 The expression level of the gene was significantly reduced, indicating that the RNA interference vector successfully expressed the interference sequence in rapeseed plants and effectively inhibited the expression of the target gene.

[0072] (2) Drought tolerance assessment results Phenotypic observation: After drought treatment, the leaves of the interference strains wilted less, the dry area was smaller, and the overall growth condition was better than that of the wild-type plants.

[0073] Survival rate statistics: After rehydration, the survival rate of the interference strain increased by at least 30% compared with the wild type J9709, indicating that the interference BnaA7.ARF17 The expression of the gene can significantly enhance the drought tolerance of Brassica napus.

[0074] Figure 8 Overexpression, interference BnaA7.ARF17 Response of transgenic rapeseed to soil drought stress and statistical chart of survival rate. Figure 8 A is two overexpression rapeseed lines OE- BnaA7.ARF17 -2、OE- BnaA7.ARF17 -5, two interference rapeseed lines Ri- BnaA7.ARF17 -6, Ri- BnaA7.ARF17 Phenotypic diagram of -7 and wild-type rapeseed J9709 under drought and rewatering treatments. Figure 8 Middle B is a statistical graph of the survival rates of wild-type rapeseed, two overexpression rapeseed lines, and two interference rapeseed lines after drought stress and rehydration. BnaA7.ARF17 It will reduce the drought resistance of rapeseed; BnaA7.ARF17 Low expression of β-catenin will improve the drought resistance of rapeseed.

[0075] This example uses the RNA interference vector constructed in Example 2 to successfully obtain the BnaA7.ARF17 Rapeseed interference lines with reduced gene expression. The survival rate of these interference lines under drought stress was significantly improved, indicating that RNA interference technology can inhibit the BnaA7.ARF17 Gene expression is an effective method to improve the drought tolerance of Brassica napus. This achievement provides important genetic resources and technical support for improving the drought tolerance of Brassica napus.

[0076] Example 4 This embodiment describes in detail BnaA7.ARF17 Gene cloning, BnaA7.ARF17 Arabidopsis transformation with overexpression vectors, BnaA7.ARF17 The specific steps for obtaining rapeseed plants with overexpression and interference vectors are as follows.

[0077] 1. Gene cloning: (1) Trizol method for RNA extraction: Place the leaf into a 2ml centrifuge tube, add three steel balls, and snap-freeze in liquid nitrogen. Then, use a prototyping machine at 35 Hz for 45 seconds twice to fully disrupt the sample. Add 1ml of RNA isolater and shake until a brown emulsion forms. Centrifuge at 12,000 rpm for 5 minutes at 4°C. Transfer 900µl of supernatant to an RNase-free tube, add 180µl of chloroform, and shake until an emulsion forms. Let stand on ice for 5 minutes to separate the layers. Centrifuge at 12,000 rpm for 15 minutes at 4°C. Transfer 400µl of supernatant to an RNase-free centrifuge tube, add an equal volume of pre-chilled isopropanol, mix by inversion, and let stand on ice for 10 minutes. Centrifuge at 12,000 rpm for 10 minutes at 4°C. Discard the supernatant, add 1ml of 75% ethanol to wash by pipetting, and let stand on ice for 5 minutes. Centrifuge at 12,000 rpm for 5 minutes at 4°C and discard the supernatant. The precipitate was dried on ice for 2 minutes, and 50 μl of RNase-free ddH2O was added to dissolve the RNA. The concentration and purity of the extracted RNA were determined and the extracted RNA was stored at -80°C.

[0078] (2) RNA reverse transcription The reverse transcription kit of Beijing Qingke Company was used.

[0079] a) Remove gDNA: Add the corresponding components according to the table below; b) Place the sample in a PCR machine at 42°C for 2 minutes and place on ice. c) Reverse transcription reaction: Add components according to the table below; d) Place the sample in a PCR instrument and process it at 37°C for 15 minutes, then 85°C for 5 seconds. Place the sample on ice after completion. e) Check whether the cDNA is successfully reverse transcribed and store the successful cDNA in a -20℃ refrigerator.

[0080] (3) PCR amplification was performed using the cDNA from Brassica napus leaves as a template. The amplification system was as follows: FastPfu DNA Polymerase PCR Reaction System (4) Rubber recycling Run the amplified product on a gel and cut the desired band into a test tube. Add Buffer B2 and heat the gel in a waterbath. Transfer the gel to an adsorption column and centrifuge at 12,000 rpm for 1 minute. Discard the collection solution and repeat this step once. Discard the collection solution and centrifuge for 1 minute. Discard the collection solution and place the adsorption column in a centrifuge tube. Add 20-30 μL of ddH2O to the column and centrifuge for 1 minute. Save the gel and recover the product.

[0081] (5) Enzyme digestion and ligation The gel-recovered product was double-digested with BamHI and speI and then ligated with T4 ligase. The product was used for Escherichia coli transformation.

[0082] The double enzyme digestion reaction system is as follows: After adding the sample according to the above system, place it on a PCR instrument and digest it at 37℃ for 30 minutes. Then, perform agarose gel electrophoresis on the digested sample and recover the gel. The above products are connected on a PCR instrument at 25℃ for 2 hours according to the following system.

[0083] The connection system is as follows: (6) E. coli transformation The ligated product was mixed with the competent cell and incubated on ice for 30 minutes, then heat-shocked in a 42°C water bath. Following the heat shock, the cells were quickly incubated on ice for 2 minutes. Antibiotic-free LB was added and the cells were allowed to recover at 37°C for 1 hour. Centrifuged at 4000 rpm for 5 minutes, the supernatant discarded, the pellet evenly pipetted, and then plated on kanamycin-resistant LB medium and incubated at 37°C for 24 hours. After plaque formation, cells were transferred to kanamycin-resistant LB medium and shaken until turbid. Afterwards, the cells were tested and sequenced. After correct sequencing, the cells were shaken for plasmid extraction.

[0084] (7) Plasmid extraction Centrifuge the shaken bacterial solution several times, discard the supernatant and add P1, mix well and add P2, mix well and add P3, mix gently, centrifuge at 12000rpm for 10min, aspirate the supernatant into the adsorption column, centrifuge at 12000rpm for 1min, discard the collecting liquid, add PW and centrifuge and repeat this step once, discard the collecting liquid, centrifuge once and place the adsorption column into a new centrifuge tube, add 50ul ddH2O and centrifuge, measure the concentration and store the plasmid at -20℃.

[0085] (8) Agrobacterium transformation Add the plasmid to thawed Agrobacterium tumefaciens competent cells GV3101. Incubate on ice for 5 minutes, then chill in liquid nitrogen for 5 minutes, heat shock in a 37°C water bath for 5 minutes, and then incubate on ice for 5 minutes. Add antibiotic-free YEB and resuspend at 28°C for 3 hours. Spread the revived culture onto kanamycin-resistant YEB medium by centrifugation. Incubate inverted at 28°C for 48 hours, then pick and test for bacteria. Shake the culture, add glycerol, and store at -80°C.

[0086] two, BnaA7.ARF17 Arabidopsis transformation with overexpression vectors (1) Construction of overexpression vector: Will BnaA7.ARF17 The gene was inserted into the DsRed vector and digested with AscI + speI enzyme combination. BnaA7.ARF17 -F7 and BnaA7.ARF17 -R7 was PCR amplified and then obtained through the vector construction process BnaA7.ARF17 Gene overexpression vector.

[0087] (2) Add the bacterial solution after bacterial testing to 10 ml of Kanamycin LB medium and shake it overnight for activation. Pipette the bacterial solution and add it to Kanamycin LB medium and shake it twice overnight. Centrifuge at 4000 rpm for 15 minutes. Discard the supernatant and resuspend it in resuspension solution to adjust the OD value to about 0.8 for later use. The configuration of the resuspension solution is as follows: (3) Cut off the siliques and fully opened flowers of flowering wild-type Arabidopsis, infect them by floral immersion for 2 minutes, keep them in the dark for 24 hours, and then move them to light for cultivation. One week later, infect them a second time to increase the positive rate.

[0088] (4) After the seeds mature, harvest them, perform routine disinfection, and sow them on MS solid medium with hygromycin resistance for screening. One week later, the Arabidopsis seedlings are transferred to soil for cultivation and DNA extraction is performed using gene primers. BnaA7.ARF17- F7 and BnaA7.ARF17- R7 and the universal primers on the expression vector were used for PCR amplification, and the PCR products were then identified as positive by agarose gel electrophoresis. The positive seedlings were then harvested and subcultured until they were pure for subsequent experiments.

[0089] three, BnaA7.ARF17 Obtaining rapeseed plants with overexpression and interference vectors (1) Construction of overexpression and interference vectors Construction of overexpression vector: Will BnaA7.ARF17 The gene was inserted into the DsRed vector and digested with AscI + speI enzyme combination. BnaA7.ARF17 -F7 and BnaA7.ARF17 -R7 was PCR amplified and then obtained through the vector construction process BnaA7.ARF17 Gene overexpression vector.

[0090] Construction of interference vector: According to BnaA7.ARF17 Design specific amplification primers based on the CDS sequence of the gene: BnaA7.ARF17 -RNAi-F1 and BnaA7.ARF17 -RNAi-R1.

[0091] Will BnaA7.ARF17 The gene was inserted into the pFGC5941M vector and digested with BamHI+XbaI enzyme combination and primers BnaA7.ARF17 -RNAi-F1 and BnaA7.ARF17 -RNAi-R1 was amplified by PCR, and the positive fragment was obtained through the vector construction process. BnaA7.ARF17 Gene interference expression vector. The vector was digested with NcoI and AatII, and the resulting linear vector was connected to the gene fragment digested with the same enzymes to obtain a linear vector containing both the sense and antisense fragments. BnaA7.ARF17 Gene interference expression vector.

[0092] (2) Overexpression and interference in genetic transformation of rapeseed a) Sowing: Pour an appropriate amount of sterilized M0 medium into a glass dish in a seeding box and allow it to solidify. Place an appropriate amount of J9709 seeds in a 5ml centrifuge tube. Add 75% alcohol and shake for 2 minutes in a clean hood. Discard the alcohol and add 1 / 2 of 84 disinfectant to disinfect the seeds. Shake vigorously for 3 minutes. Discard 1 / 2 of the 84 disinfectant and rinse the seeds 3-4 times with sterile ddH2O. Sow the cleaned seeds in the solidified M0 medium and incubate in the dark for 7 days.

[0093] b) Shake the bacteria: store at -80℃ BnaA7.ARF17 The gene overexpression and interference vector Agrobacterium solution was shaken overnight in liquid YEB medium containing antibiotics in an ultra-clean workbench. The next day, the bacterial solution was shaken again according to a gradient of 1:100, 1:500, and 1:1000 to an OD value of about 0.4.

[0094] c) Infection of rapeseed explants: Add 18ml of DM solution to a sterilized culture dish. Use sterile scissors to cut the rapeseed hypocotyls into 0.8-1cm segments and place them in the dish. Pipette 2ml of the shaken bacterial solution and centrifuge at 10,000rpm for 2 minutes. Discard the supernatant, resuspend in DM solution, and centrifuge again. Discard the supernatant, resuspend in DM solution again. Add the resuspended bacterial solution to the glass dish containing the hypocotyls and gently shake to infect for 7 minutes. Aspirate the bacterial solution and place the hypocotyls on filter paper to dry. Use sterilized, red-hot tweezers to clip the dried hypocotyls onto M1 medium and incubate in the dark for 24 hours. After 24 hours, transfer the hypocotyls from M1 medium to M2 medium and incubate in the light for 20 days.

[0095] d) M3 subculture: Transfer the hypocotyls from M2 medium to M3 medium and subculture every 14 days until true leaves grow.

[0096] e) M4 Culture: Hypocotyls that have grown true leaves from M3 medium are transferred to M4 medium to promote rooting. Once they reach an appropriate size and have developed roots, they are removed from the water culture and transplanted to soil for culture once roots have developed lushly.

[0097] 4. Drought phenotype observation The obtained Arabidopsis overexpression lines, rapeseed overexpression and interference lines were subjected to qRT-PCR quantitative analysis. The quantitative primers were BnaA7.ARF17 -qPCR-F and BnaA7.ARF17 -qPCR-R.

[0098] Select BnaA7.ARF17 Arabidopsis overexpression lines, rapeseed overexpression lines and BnaA7.ARF17 Drought phenotypes of rapeseed interference lines with low expression levels were observed.

[0099] Observation of drought phenotype of Arabidopsis: Mix nutrient soil and vermiculite evenly, add appropriate amount of water to soak, and divide into small pots, with the amount of soil in each pot being roughly the same. BnaA7.ARF17- 37. OE- BnaA7.ARF17 -67、OE- BnaA7.ARF17 -71 and WT were transplanted into small pots. They were cultured normally until bolting. Photos were taken to record the status before drought treatment. After 4-6 days of drought stress treatment, photos were taken to record the status after drought. After recording, the water was rehydrated and photos were taken 1-2 days later. Figure 7 shown.

[0100] Drought phenotype observation of rapeseed: Mix nutrient soil and vermiculite evenly, add appropriate amount of water to soak, put into the frame, divide the frame into five parts, and transplant J9709, OE- BnaA7.ARF17 -2、OE- BnaA7.ARF17-5、Ri- BnaA7.ARF17 -6, Ri- BnaA7.ARF17 -7 rapeseed. Cultivate normally until five true leaves appear, take photos to record the state before drought treatment. Treat with drought stress for 4-6 days, take photos to record the state after drought treatment. Rewater after recording, take photos and record after 1-2 days. Figure 8 shown.

[0101] Figure 7 and Figure 8 Overexpression and interference BnaA7.ARF17 Response and survival rate statistics of Arabidopsis and rapeseed lines with the same gene under drought stress.

[0102] Figure 7 Overexpression BnaA7.ARF17 Response of transgenic Arabidopsis to soil drought stress and survival rate statistics. Figure 7 A is the three Arabidopsis lines overexpressing OE- BnaA7.ARF17 -37、OE- BnaA7.ARF17 -67、OE- BnaA7.ARF17 Phenotypes of -71 and wild type WT under drought and rehydration treatments. Figure 7 B is respectively WT and OE- BnaA7.ARF17 -37, OE- BnaA7.ARF17 -67、OE- BnaA7.ARF17 The statistical chart of the survival rate of three overexpression strains of Arabidopsis thaliana after drought stress treatment and rehydration treatment. The results further showed that overexpression BnaA7.ARF17 It will reduce the drought resistance of Arabidopsis thaliana.

[0103] five, BnaA7.ARF17 Subcellular localization of transiently expressed proteins in tobacco according to BnaA7.ARF17 Design specific amplification primers based on the CDS sequence of the gene BnaA7.ARF17 -PEGAD-HR-F and BnaA7.ARF17 -PEGAD-HR-R.

[0104] Will BnaA7.ARF17 The coding region of the protein was inserted into the pEGAD expression vector and digested with EcoRI+HindⅢ. BnaA7.ARF17 -PEGAD-HR-F and BnaA7.ARF17 -PEGAD-HR-R was amplified by PCR, and then 35S was constructed according to the vector construction process: BnaA7.ARF17-YFP fusion expression vector. The constructed vector plasmid was transferred into Agrobacterium, and after the plaque test was correct, the bacteria were shaken overnight and cultured. At the same time, the empty control Agrobacterium solution and the nuclear marker control Agrobacterium solution were shaken once. After overnight culture, a second shake culture was performed according to the concentration of the bacterial solution. The bacterial solution was added to 50 mL YEB liquid culture medium in a certain proportion and shaken at 28°C for 6-8 hours. After shaking until the bacterial solution turned orange-yellow, centrifuged at 5000rpm for 10 minutes, the supernatant was discarded, and the resuspension solution was added to adjust the OD to 0.8-1.0 and allowed to stand for 3 hours. The nuclear marker and the empty load were mixed as the control group, and the nuclear marker and BnaA7.ARF17 The gene subcellular localization vector was mixed and used as the experimental group. The bacterial solution was injected into tobacco with a syringe, cultured in the dark for 24 hours and then cultured in the light for 1 day. The lower epidermis of the tobacco leaves where the bacterial solution was injected was torn off and fluorescence observation and photography were performed using a laser confocal microscope. The protein localization was determined based on the fluorescence localization results of the fusion protein. Figure 4 shown.

[0105] Figure 4 yes BnaA7.ARF17 Subcellular localization map of transient expression in tobacco. BnaA7.ARF17 The subcellular localization recombinant vector was transformed into Agrobacterium tumefaciens GV3101 strain by chemical transformation, and then Agrobacterium was injected into tobacco mesophyll epidermal cells for transient expression. BnaA7.ARF17 The protein localization of the protein coincides with the fluorescence signal of the nuclear localization maker protein, that is, BnaA7.ARF17 The protein is localized in the cell nucleus. Subcellular localization results show that BnaA7.ARF17 The protein localization of the protein coincides with the fluorescence signal of the nuclear localization maker protein, that is, BnaA7.ARF17 The protein is localized in the cell nucleus.

[0106] six, BnaA7.ARF17 Promoter activity and expression characteristics according to BnaA7.ARF17 The specific amplification primers BnaA7.ARF17proHR-F1 and BnaA7.ARF17proHR-R1 were designed to amplify the promoter sequence of the gene.

[0107] Will BnaA7.ARF17 The gene was inserted into the upstream of the GUS reporter gene of the pCAMBIA1305.1 vector and digested with EcoRI+NcoI. PCR amplification was performed using the designed primers, and then pro BnaA7.ARF17: GUS expression vector. Transform into Arabidopsis thaliana by floral invasion method and harvest. Sow seeds on MS solid medium with hygromycin resistance and screen positive plants. Transplant positive seedlings to soil, extract DNA to identify positives, and harvest positive seedlings. Stain positive seedlings with Gus, incubate in dark at 37℃ with tin foil for 24 hours, decolorize with anhydrous ethanol, and observe. BnaA7.ARF17 In the seedling stage and the staining of different tissue parts, to determine BnaA7.ARF17 Promoter activity and expression characteristics. Figure 5 shown.

[0108] Figure 5 yes BnaA7.ARF17 Tissue-specific expression analysis diagram. a: pro BnaA7.ARF17 : Gus staining of Arabidopsis thaliana seedlings transformed with GUS expression vector (7 days). Gus staining shows that BnaA7.ARF17 bh: Gus staining results showed that pro BnaA7.ARF17 : The leaves, roots, siliques, and silique peels of Arabidopsis transformed with the GUS expression vector can all be stained, but the seeds cannot. BnaA7.ARF17 It is expressed in the leaves, roots, siliques, and silique skins of Arabidopsis, but not in seeds. The staining results show that the staining color of Arabidopsis root primordium is darker than that of other parts, indicating that BnaA7.ARF17 It is more expressed in Arabidopsis root primordia.

[0109] Gus staining results showed that BnaA7.ARF17 It is expressed in all parts of Arabidopsis seedlings; it is expressed in Arabidopsis leaves, roots, siliques, and silique peels; especially in the root primordium with high expression levels.

[0110] Overexpression BnaA7.ARF17 Analysis of negative regulation of drought tolerance in Arabidopsis thaliana lines: BnaA7.ARF17 Phenotypic observation of overexpression Arabidopsis strains after drought stress treatment at the seedling stage revealed that both overexpression Arabidopsis and wild-type strains showed wilting, but the degree of wilting of overexpression Arabidopsis strains was significantly lower than that of wild-type. After rehydration, WT could resume normal growth, while overexpression strains recovered more slowly after rehydration, and even some plants died. BnaA7.ARF17 The survival rate of Arabidopsis and wild-type Arabidopsis strains under drought treatment was found to be significantly higher than that of Arabidopsis BnaA7.ARF17 Overexpression strains, i.e. overexpression BnaA7.ARF17 The Arabidopsis lines were less drought tolerant than the wild-type Arabidopsis lines.

[0111] Figure 6 Arabidopsis overexpression strains and rapeseed overexpression and interference strains BnaA7.ARF17The overexpression lines with high expression levels and the interference lines with low expression levels were selected for subsequent drought stress experiments.

[0112] right BnaA7.ARF17 The drought stress phenotypes of overexpression and interference rapeseed were observed at the seedling stage, and it was found that before drought, the growth status of rapeseed overexpression lines, interference lines and wild type J9709 were consistent, with no significant differences. After drought treatment, the overexpression lines, interference lines and wild type J9709 all wilted to varying degrees. The overexpression lines wilted the most severely, with leaves losing water, curling and drying up, and the overall state of extreme drought. The wild type J9709 wilted more severely, with most leaves drying up, but its overall survival status was better than that of the overexpression lines. Interference lines: wilting was the lightest, with overall wilting and a small number of leaves drying up. After rehydration, most of the overexpression rapeseed still wilted until death. After rehydration, most of the wild type J9709 wilted, but a small number of leaves still survived. After rehydration, most of the interference rapeseed resumed normal growth. Statistics of overexpression BnaA7.ARF17 Rapeseed strains, interference BnaA7.ARF17 The survival rate of rapeseed lines and wild type rapeseed J9709 was found to be BnaA7.ARF17 The survival rate of rapeseed lines was much higher than that of wild-type rapeseed J9709 and overexpression BnaA7.ARF17 strains; the survival rate of wild-type rapeseed J9709 was higher than that of overexpression BnaA7.ARF17 rapeseed lines. This indicates that overexpression BnaA7.ARF17 Rapeseed lines are less drought tolerant than wild-type rapeseed. BnaA7.ARF17 The drought tolerance of rapeseed lines is stronger than that of wild-type rapeseed.

[0113] In the description of the present invention, it should be understood that "-" and "~" represent a range between two values, and the range includes the endpoints. For example, "AB" represents a range greater than or equal to A and less than or equal to B. "A~B" represents a range greater than or equal to A and less than or equal to B.

[0114] In the description of the present invention, the term "and / or" is merely a description of the association relationship of associated objects, indicating that three relationships may exist. For example, A and / or B may represent three situations: A exists alone, A and B exist at the same time, and B exists alone.

[0115] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be construed as limiting the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. Persons skilled in the art will appreciate that improvements and modifications may be made without departing from the spirit and scope of the present invention, and such improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. An interference sequence for improving drought tolerance of Brassica napus, characterized in that The interfering sequence targets the BnaA7.ARF17 gene in Brassica napus, the nucleotide sequence of which is shown in SEQ ID NO:

1. The interfering sequence can reduce the expression level of the gene and comprises any one of the following sequences or functionally equivalent variants thereof: (a) an antisense sequence of the nucleotide sequence shown in SEQ ID NO: 1; (b) RNA interference hairpin structure formed by connecting SEQ ID NO: 1 and its antisense sequence through a spacer region.

2. The interference sequence according to claim 1, characterized in that The functionally equivalent variant is a sequence that has at least 80% homology with the nucleotide sequence of SEQ ID NO: 1 or its antisense sequence and is capable of reducing the expression level of the BnaA7.ARF17 gene to less than 50% of the wild type.

3. The interference sequence according to claim 1, characterized in that The interfering sequence is inserted into the pFGC5941M vector by homologous recombination. The promoter of the vector is 35S promoter, and the interfering sequence is located after the promoter and before the spacer, or after the spacer and before the terminator.

4. A method for constructing an RNA interference vector containing an interference sequence according to any one of claims 1 to 3, characterized in that: The following steps are involved: (1) Designing a primer pair for specifically amplifying the sense sequence and antisense sequence of SEQ ID NO: 1, wherein the primers contain BamHI and XbaI restriction sites; (2) Using Brassica napus cDNA as a template, the sense and antisense sequences were obtained by PCR amplification; (3) Using the BamHI and XbaI restriction sites, the sense sequence and antisense sequence were inserted into the pFGC5941M vector to form an RNA interference vector containing a 35S promoter; (4) Transforming the RNA interference vector into Agrobacterium tumefaciens GV3101 strain.

5. A method for improving drought tolerance of Brassica napus, characterized in that: The following steps are involved: (1) introducing the RNA interference vector constructed in claim 4 into the hypocotyl of Brassica napus through Agrobacterium tumefaciens-mediated method; (2) Co-culture the infected hypocotyls in M1 medium without resistance, then transfer them to M2 and M3 medium for selection, induce callus, dedifferentiate and redifferentiate, and transfer them to M4 medium for rooting induction; (3) Detect the expression level of the BnaA7.ARF17 gene in transgenic plants by qRT-PCR, and screen for lines with expression levels lower than 50% of the wild type; (4) The selected strains were subjected to drought stress treatment, and drought-resistant strains with a survival rate at least 30% higher than that of the wild type J9709 were selected.

6. The method according to claim 5, characterized in that The specific steps of the Agrobacterium tumefaciens-mediated method include: The hypocotyls of Brassica napus were cut into 0.8-1 cm segments and immersed in Agrobacterium solution with an OD600 of 0.8 for 7 minutes. The infected hypocotyls were cultured in M1 medium in the dark for 24 hours. The hypocotyls were then transferred to M2 medium for callus induction, M3 medium for bud regeneration, and M4 medium for root induction.

7. The method according to claim 5, characterized in that The primers used in the qRT-PCR assay are: BnaA7.ARF17-qPCR-F: 5'-AAGATGGCTATGGAGACTGA-3'; BnaA7.ARF17-qPCR-R: 5'-GTTTTGCAGAATTCTCAGGTTC-3'.

8. The method according to claim 5, characterized in that The drought stress treatment is to stop watering for 4-6 days at the seedling stage, calculate the survival rate after rehydration, and screen the interference strains with a survival rate higher than that of the wild type J9709.

9. Use of the interfering sequence according to any one of claims 1 to 3 in improving drought tolerance of Brassica plants of the family Cruciferae, characterized in that: The application includes introducing the interference sequence into plant cells to inhibit the expression of ARF17 homologous genes.

10. A plant cell, characterized in that The interfering sequence according to any one of claims 1 to 3 is integrated into the cell, and the expression level of the BnaA7.ARF17 gene in the cell is lower than that in the wild-type cell.

Images