Application of OsNAT9 gene in regulation and control of vigor and drought tolerance of rice seeds

Abstract

The invention discloses application of an OsNAT9 gene in regulation and control of vigor and drought tolerance of rice seeds, and belongs to the technical field of rice gene engineering. The invention particularly relates to application of the OsNAT9 gene in regulation and control of germination rate, germination potential and germination index of rice seeds and drought tolerance of the rice seeds. The nucleotide sequence of the OsNAT9 gene is as shown in SEQ ID NO. 1. Experimental results show that endogenous AsA is closely related to rice seed germination and seedling drought resistance, and the OsNAT9 gene possibly participates in transportation and stress reaction of ascorbic acid in rice, so that the OsNAT9 gene plays an important role in maintaining rice seed vigor and drought resistance, and the discovery provides a new insight for analyzing the function of regulating and controlling AsA mechanism and seed vigor by OsNAT9.

Description

Technical Field

[0001] The present invention belongs to the technical field of rice genetic engineering, and in particular relates to the application of the OsNAT9 gene in regulating rice seed vigor and drought resistance. Background Art

[0002] The physiological functions of ascorbic acid are closely related to changes in its redox state and the activities of enzymes involved in biosynthesis, metabolism, regeneration, and transport. Base-ascorbate transporters (NATs) are also known as the nucleobase-cation cognate proteins (NCS) or AzgA family. This class of proteins is named for their ascorbate transport function in animals. In plants, NATs have previously been reported to play important roles in various developmental processes and in response to biotic and abiotic stresses. Specific NAT proteins, such as AtNAT3 and AtNAT12, are involved in the transport of adenine, guanine, uracil, and hypoxanthine. Although a large number of NATs family genes have been studied, the physiological functions of most NATs remain uncertain. Summary of the Invention

[0003] Our previous research has shown that the expression of NATs (nucleobase-ascorbate transporters) in rice is affected by drought, artificial aging, and salt stress. In particular, the expression of the base-ascorbate transporter Lpe1 (designated OsNAT9) decreased significantly after 15 days of artificial aging in rice seeds. This change in expression may be related to ROS scavenging capacity and regulation of ion homeostasis. Furthermore, the activities of APX and MDH decreased significantly with prolonged aging, suggesting that the OsNAT9 protein may be involved in the response to artificial aging. Therefore, OsNAT9 may serve as a potential candidate gene for plant seed vigor and drought and salt stress tolerance.

[0004] In this study, we constructed CRISPR / Cas9 knockout mutants and OsNAT9 overexpression mutants in the wild-type rice 'Tainong 67' (TNG67, southern japonica rice, with excellent yield and adaptability in South China and easy transformation). We compared the germination of wild-type and mutant seeds and analyzed changes in physiological and biochemical indices during seed storage to clarify the regulation of OsNAT9 on seed vigor and storability, and to explore the regulatory pathways of the OsNAT9 gene on seed vigor and aging.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] In a first aspect, the present invention provides an application of the OsNAT9 gene in regulating rice seed vigor and drought tolerance, regulating rice seed vigor and drought tolerance by gene knockout or gene overexpression; the nucleotide sequence of the OsNAT9 gene is shown in SEQ ID NO.1.

[0007] Furthermore, the regulating rice seed vigor is regulating the germination rate, germination potential and germination index of the rice seeds.

[0008] Furthermore, the gene knockout is carried out by using OsNAT9 as the target gene, using the CRISPR / Cas9 gene editing system to construct a knockout vector of the target gene, transforming it into rice, and cultivating the rice.

[0009] Furthermore, the method for constructing the knockout vector comprises the following steps:

[0010] Select a target and design gRNA, perform PCR amplification using the pCBC-MT1T2 plasmid as a template, and after recovery, use T4 ligase to ligate it with the pHUE411 vector to obtain a ligation product, which is then transformed into Escherichia coli, the plasmid is extracted, and then sequencing verification is performed.

[0011] Furthermore, the gRNA sequence is shown as SEQ ID NO.2.

[0012] Furthermore, the gene overexpression is to use OsNAT9 as the target gene, connect the target gene with a vector by seamless cloning and homologous recombination to construct an overexpression vector, transform it into rice, and cultivate the rice.

[0013] Furthermore, the method for constructing the gene overexpression vector comprises the following steps:

[0014] Upstream and downstream primers were designed for OsNAT9 gene for PCR amplification. The binary vector pRHVcGFP and the amplified product were digested with HindIII and KpnI as restriction sites. Then, the target fragment was connected with the linearized vector by homologous recombination to obtain a recombinant vector.

[0015] Furthermore, the upstream primer is shown as SEQ ID NO.7, and the downstream primer is shown as SEQ ID NO.8.

[0016] In a second aspect, the present invention provides the use of the OsNAT9 gene in breeding drought-resistant rice varieties. The nucleotide sequence of the OsNAT9 gene is shown in SEQ ID NO.1.

[0017] In a third aspect, the present invention provides a method for breeding drought-resistant rice varieties, comprising transforming an expression vector containing the OsNAT9 gene into a target plant for overexpression to obtain the drought-resistant rice; the nucleotide sequence of the OsNAT9 gene is shown in SEQ ID NO.1.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention cloned the OsNAT9 gene (LOC4333795) from rice, and mainly studied its role in rice seed vigor, seed storage and seedling resistance to drought stress caused by PEG6000.

[0020] (1) Compared with wild-type and OsNAT9-overexpressing seeds, seeds in which OsNAT9 was knocked out by CRISPR / Cas9 showed significantly decreased seed vigor and shortened seed lifespan. After artificial and natural aging treatments, the germination potential, germination rate, and germination index of the OsNAT9 knockout mutant were significantly lower than those of TNG67. This suggests that the OsNAT9 gene plays an important role in regulating rice seed vigor.

[0021] (2) qRT-PCR analysis showed that compared with TNG67, the transcription levels of genes related to AsA biosynthesis and catabolism in the OsNAT9 knockout mutant were significantly downregulated, indicating that OsNAT9 gene knockout affected the biosynthesis and catabolism of AsA. UPLC analysis found that the AsA content of the OsNAT9 knockout mutant was positively correlated with seed vigor, among which the AsA content of the embryo of the OsNAT9-1 mutant was significantly reduced by 44.84% compared with the wild type. In addition, the exogenous addition of 0.3 mM AsA significantly increased the germination rate of OsNAT9-1 and OsNAT9-2 seeds. In summary, the loss of seed viability in the OsNAT9 knockout mutant is related to the reduced AsA content in the embryo and the lack of AsA synthesis stimulation. Therefore, OsNAT9 regulates AsA homeostasis and AsA signaling during seed germination.

[0022] (3) In addition, we found that transgenic seedlings overexpressing OsNAT9 were more tolerant to drought stress than wild-type and OsNAT9 knockout mutant lines. The ascorbic acid concentration in the leaves of OsNAT9 overexpressing transgenic plants increased during drought stress, while the phenotype of OsNAT9 knockout plants was the opposite. The survival rates of OsNAT9-1 and OsNAT9-2 plants were only 29.37% and 25%, respectively. The AsA content of OsNAT9-1 and OsNAT9-2 plants was also significantly reduced, indicating that knocking out OsNAT9 may disrupt the balance of endogenous AsA levels, leading to a decrease in rice seed vigor and seedling drought resistance.

[0023] These results indicate that endogenous AsA is closely related to rice seed germination and seedling drought resistance, and OsNAT9 may be involved in the transport and stress response of ascorbic acid in rice, thereby playing an important role in maintaining rice seed vigor and drought resistance. These findings provide new insights into the function of NAT9 in regulating AsA and seed vigor. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 These are the results of knocking out and overexpressing the OsNAT9 gene in the Tainong 67 background material in Example 4 (Figure A is a schematic diagram of the OsNAT9 genome; Figure B is a diagram of base mutation sites and sequencing peaks of mutation sites; Figure C is a photograph of TNG67, OsNAT9 knockout mutants, and OsNAT9 overexpression strains; Figure D is a relative expression analysis of the OsNAT9 gene in the OsNAT9 overexpression strain).

[0025] Figure 2 Comparison of seed viability after knockout or overexpression of OsNAT9 in Example 6 (Figure A is a photograph of seeds of TNG67, OsNAT9 knockout mutant and OsNAT9 overexpression line 4d and 10d after germination; Figures BD are a comparison of GPs, SPs and GIs of seeds of TNG67, OsNAT9 knockout mutant and OsNAT9 overexpression line; Figure E is a photograph of seeds of TNG67, OsNAT9 knockout mutant and OsNAT9 overexpression line 7d after breaking dormancy; Figures FH are a comparison of GPs, SPs and GIs of seeds of TNG67, OsNAT9 mutant and OsNAT9 overexpression line after breaking dormancy).

[0026] Figure 3 Comparison of rice seed viability after 6 months of natural aging in Example 6 (Figure A shows germination of seeds of TNG67, OsNAT9 knockout mutant, and OsNAT9 overexpression line at 3d, 5d, and 10d; Figures BD compare germination GPs, SPs, and GIs of seeds of TNG67, OsNAT9 knockout mutant, and OsNAT9 overexpression line).

[0027] Figure 4 Comparison of rice seed viability after artificial aging in Example 6 (Figure A shows the germination of seeds of TNG67, OsNAT9 knockout mutants, and OsNAT9 overexpression lines at 10 days after artificial aging for 7, 14, and 21 days; Figure B shows the comparison of GPs, SPs, and GIs in germination of seeds of TNG67, Osnat9 knockout mutants, and OsNAT9 overexpression lines at 7, 14, and 21 days after artificial aging; Figure C shows the appearance of rice grains of TNG67, OsNAT9 knockout mutants, and OE lines after 21 days of artificial aging. Bar = 100 μm; Figure D shows scanning electron microscope images of cross-sections of rice grains of TNG67, OsNAT9 knockout mutants, and OE lines after 21 days of artificial aging. Bar = 10 μm).

[0028] Figure 5Figure 7 shows the changes in AsA during seed germination after knockout or overexpression of the OsNAT9 gene in Example 7 (Figure A shows the AsA content in different tissues of wild-type, OsNAT9 mutant, and OsNAT9-overexpressing rice; Figures BC show the AsA content in embryos and endosperms of germinating seeds of wild-type, OsNAT9 mutant, and OE lines.

[0029] Figure 6 The effect of exogenous AsA on the AsA content and seed germination of the OsNAT9 knockout mutant seeds in Example 8 (Figure A is the germination phenotype of the wild type and OsNAT9 knockout mutant under 1 / 2MS AsA treatment for 6 days; Figures BD are comparisons of the germination potential, germination index and germination rate of TNG67 and OsNAT9 knockout mutant seeds).

[0030] Figure 7 This is an analysis of drought resistance of plants with knockout and overexpression of OsNAT9 at the seedling stage in Example 9 (wherein, Figure A shows the phenotypic characteristics of the OsNAT9 knockout mutant, OsNAT9 overexpression, and TNG67 plants before and after 3 weeks of treatment with 25% PEG6000 and then rehydration for 3 days; Figure B shows the survival rate analysis of the OsNAT9 knockout mutant, OsNAT9 overexpression, and TNG67 plants after 25% PEG6000 treatment and rehydration; Figures C and D show DAB and NBT staining analysis of the OsNAT9 knockout line, OE line, and TNG67 after 7 days of 25% PEG6000 treatment; Figures E and J show the antioxidant activity analysis and comparison of H2O2, MDA, and AsA contents of the OsNAT9 knockout mutant, OsNAT9 overexpression, and TNG67 before and after 25% PEG treatment). DETAILED DESCRIPTION

[0031] To better illustrate the present invention, the following embodiments are listed. Obviously, the embodiments described are only part of the present invention, not all of the embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without making any creative efforts are also within the scope of protection of the present invention.

[0032] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0033] The nucleotide sequence of the rice OsNAT9 gene is shown in SEQ ID NO.1:

[0034]

[0035] Example 1 Knockout of rice OsNAT9 gene based on CRISPR / Cas9 technology

[0036] To create clustered regularly interspaced short palindromic repeat (CRISPR)-OsNAT9 transgenic plants with knockout of the OsNAT9 gene, we designed OsNAT9 CRISPR / Cas9-specific targeting sites using the CRISPR-PLANT online website. Based on target prediction, we selected a gRNA target site (GTCCCCAAGGAGCAGTACGA (SEQ ID NO. 2)) in the fourth exon of the OsNAT9 gene. Off-target analysis of the selected target was performed using the CRISPRRGEN Tools website. Knockout primers were designed: NAT9-Cas9-F1: AATAATGGTCTCAGGCGTCCCCAAGGAGCAGTACGAGTTTTAGAGCTAGAAATAGC (SEQ ID NO. 3); NAT9-Cas9-R1: ATTATGGTCTCTAAACTCGTACTGCTCCTTGGGGACGCTTCTTGGTGCC (SEQ ID NO. 4).

[0037] PCR amplify the target fragment using a 100-fold dilution of the pCBC-MT1T2 plasmid (laboratory-preserved, sourced from the following article: https: / / link.springer.com / article / 10.1186 / s12870-014-0327-y) as a template. Use 2× Primer Star Max high-fidelity enzyme with primers containing a BsaI restriction site to amplify the desired fragments. After determining the fragment size, the fragments were recovered from the gel. The PCR reaction system and procedure are shown in Tables 1 and 2 below:

[0038] Table 1 PCR reaction system

[0039]

[0040] Table 2 PCR reaction procedure

[0041]

[0042] The amplified fragment was recovered and ligated into the cloning vector.

[0043] The pHUE411 vector was used to establish an enzyme digestion-ligation system to obtain the ligation product. The enzyme digestion and ligation reaction system and reaction procedures are shown in Tables 3 and 4 below:

[0044] Table 3 Enzyme digestion and ligation reaction system

[0045]

[0046] Table 4 Enzyme digestion and ligation reaction procedures

[0047]

[0048] The ligation product was transformed into Escherichia coli competent cells and selected for sequencing. The sequencing primers were universal primers for the pHUE411 vector. The specific sequencing primer sequence information was OsU3-FD3: GACAGGCGTCTTCTAC TGGTGCTAC (SEQ ID NO. 5); TaU3-RD: CTCACAAATTATCAGCACGCTAGTC (SEQ ID NO. 6).

[0049] Extraction of recombinant plasmid: The correctly sequenced colonies were picked into 5 mL of LB liquid medium containing Kan antibiotics and cultured overnight. The recombinant plasmid was extracted using a plasmid extraction kit and then transformed into Agrobacterium competent cells EHA105.

[0050] Example 2 Overexpression of rice OsNAT9 gene based on CRISPR / Cas9 technology

[0051] To construct an OsNAT9 overexpression vector, primers NAT9-Pro-F: ACAGTGATCGGAAACGGCTAGAAGA (SEQ ID NO. 7); NAT9-Pro-R: GACG AGGTAGTGCTGGAACG (SEQ ID NO. 8) were designed according to the method of Example 1. The full-length coding sequence of OsNAT9 was amplified from the Nipponbare genome, the target fragment was purified and recovered, and cloned into the binary vector pRHVcGFP (WGL28) (from the following document: https: / / link.springer.com / article / 10.1186 / s12284-018-0220-7, originally named pRHVcGFP) by seamless cloning technology to obtain the recombinant pUBI:OsNAT9-GFP plasmid.

[0052] The pRHVcGFP (WGL28) vector was selected with HindIII and KpnI as restriction sites, and the vector plasmid was double-digested. The vector restriction enzyme digestion reaction system is shown in Table 5 below:

[0053] Table 5 Enzyme digestion reaction system

[0054]

[0055] The enzyme digestion conditions are 37° C. for 3.5 h or overnight, and the digestion products are subjected to 1% agarose gel electrophoresis and the gel is cut and recovered.

[0056] The target fragment was connected to the linearized vector by homologous recombination. The reaction system is shown in Table 6 below:

[0057] Table 6 Ligation reaction system

[0058]

[0059] Ligation conditions were 37°C for 30 minutes. Transformation and sequencing were performed according to the rice genetic transformation system and procedures described in Example 1, using the sequencing primers LEP1-ver-F: CCAGCGGAAAACCGATGCTA (SEQ ID NO. 9) and LEP1-ver-R: GGGTACAGACTAGTTCGTCGGTTC (SEQ ID NO. 10). After correct sequencing, the recombinant plasmid was extracted according to the kit instructions and transformed into Agrobacterium competent cells EHA105.

[0060] Example 3 Agrobacterium-mediated genetic transformation of rice

[0061] All transgenic rice plants were obtained through Agrobacterium-mediated transformation of rice callus.

[0062] (1) Callus induction and subculture

[0063] Preparation: Select approximately 100 freshly harvested, plump seeds (TNG67), carefully remove the shells, and place them in a sterilized flask, double-distilled water, and filter paper.

[0064] Disinfection: Transfer the prepared seeds to a sterilized Erlenmeyer flask. Rinse the seeds 4-5 times with sterile, single-distilled water until free of impurities. Disinfect the seed surface with sterile 75% ethanol for 2 minutes. Sterilize the seeds with 2.5% sodium hypochlorite in a shaker at room temperature for 20 minutes. Rinse with sterile water until no sodium hypochlorite remains. Transfer the seeds to a Petri dish containing filter paper and air dry.

[0065] Induction and subculture of callus tissue: Move the air-dried seeds to NEB induction medium, place them in a 28℃ light incubator to induce callus tissue for about 12 days, then remove the buds and subculture. Thereafter, subculture once every 14 days (the time can be adjusted according to the state of the callus tissue). At the late stage of the second generation, bright yellow calli can be selected for Agrobacterium infection.

[0066] (2) Agrobacterium transformation of rice callus

[0067] Strain activation: aspirate an appropriate amount of the strain stored at -80°C and streak it onto a solid culture medium containing Rif and Kan antibiotics, and culture it in the dark at 28°C for 2 days.

[0068] Callus pre-culture: Select rice callus with bright yellow color and good condition and culture it in NEB medium at 28℃ for 4 days.

[0069] Agrobacterium infection: Rinse the bacteria with sterile AAM, transfer the washed bacteria to a sterile 50 mL centrifuge tube, measure the OD of the bacterial solution using a spectrophotometer, and adjust the OD of the bacterial solution with AAM. 600 The concentration of the culture medium was 0.3, and the cells were incubated in the dark at 28°C for 1 hour. The callus tissue, which had been pre-cultured for 4 days, was transferred to an Agrobacterium culture medium containing the overexpression / knockout plasmid. The infection time was 5-10 minutes, with gentle shaking several times. After infection, the infected callus tissue was transferred to a Petri dish containing several sheets of filter paper. After absorbing the excess culture medium, the callus tissue was transferred to a Petri dish lined with one or two sheets of filter paper. After the callus tissue surface was air-dried, the callus tissue was transferred to the co-culture medium and incubated in the dark at 28°C for 1 day.

[0070] Screening and differentiation of resistant callus into seedlings: Callus cultured in the dark for one day is transferred to the first-generation screening medium containing Car and Hyg, with each generation screened every 14 days. New callus will emerge during the screening process. Once grown, it is transferred to a pre-differentiation medium and cultured in the light at 28°C until seedlings emerge. When the seedlings reach 3-4 cm and have roots, they are transferred from the pre-differentiation medium to a rooting medium and cultured in the light for a period of time.

[0071] Hardening off the seedlings: After the root systems of the seedlings are well developed, remove them and place them in nutrient solution for hardening.

[0072] Example 4 Transgenic seedling screening

[0073] When the transgenic plants reached five leaves, DNA was extracted from leaves using the CTAB method. PCR amplification with specific primers was performed and the DNA was sent to the company for sequencing. Plants that tested positive were transplanted to peat soil and incubated in the greenhouse for three and a half months to harvest T0-generation transgenic rice seeds. These T0-generation transgenic rice seeds were then cultivated in field soil to produce the T1 generation. Genomic DNA was again extracted from leaves at the same location across all T1-generation lines.

[0074] OsNAT9 knockout mutants were detected and analyzed by PCR using specific primers NAT9-seq-F: CCTCCCCTTTCCTCTC TTCCTCAT (SEQ ID NO. 11) and NAT9-seq-R: CTGCACCACGATCGCCTTCTCC AC (SEQ ID NO. 12). Sequencing results were aligned with the original sequences using SnapGene software to identify positive transformed materials. Rice lines harboring mutations or deletions in the target gene loci were selected for subsequent experiments.

[0075] Transgenic plants expressing the overexpressing vector were analyzed using primers LEP1-ver-F: CCAGCGGAAAACCGATGCTA (SEQ ID NO. 13) and LEP1-ver-R: GGGTACAGACTAGTTCGTCGGTTC (SEQ ID NO. 14). T1 leaves were analyzed for copy number by qRT-PCR using primers conum-sfu2af-F / conum-sfu2af-R and conum-HYG-F / conum-HYG-R. The sequence information required for T1 leaves is shown in Table 7.

[0076] Table 7 Primer sequences

[0077]

[0078] Experimental results:

[0079] The OsNAT9 knockout transgenic line was constructed using CRISPR / Cas9. DNA from the transgenic plants was extracted and amplified using gene-specific primers for PCR and electrophoresis. Sixteen positive transgenic plants were identified. The positive plants were then selected for PCR amplification and sent to the company for sequencing to confirm the gene knockout site. The knockout-positive plants were screened again. Sequencing of the target site on the genomic DNA of the transgenic plants revealed that two OsNAT9 knockout mutants, OsNAT9-1 and OsNAT9-2, were obtained. The mutation site was located on the fourth exon of OsNAT9 ( Figure 1 A). In the mutant OsNAT9-1, a 1 bp insertion occurred in the sequence of the target site, namely "A" ( Figure 1 B), resulting in an amino acid sequence frameshift. In the mutant OsNAT9-2, a 2-bp deletion occurred in the sequence of the target site, namely "CG" ( Figure 1 B), also resulting in a frameshift mutation in the amino acid sequence of the wild-type OsNAT9 protein. The above results indicate that the OsNAT9 gene has been successfully knocked out in the two knockout transgenic lines.

[0080] Compared with TNG67, the mRNA expression levels of OsNAT9 in the stems of OsNAT9-OE1 (OE-1) and OsNAT9-OE2 (OE-2) overexpression lines increased by 40.61-fold and 44.96-fold, respectively ( Figure 1 D) The progeny of these homozygous mutants were used in subsequent experiments.

[0081] Example 6 Evaluation of Vitality of OsNAT9 Transgenic Rice Seeds

[0082] The seeds of TNG67, OsNAT9 knockout mutants and overexpression lines were germinated at room temperature under natural conditions, germinated after artificial aging treatment for 0 days, 7 days, 14 days and 21 days, and germinated after natural storage for half a year. The storability and vigor of the seeds were analyzed, and seed germination indicators such as germination percentage (SP), germination potential (GP) and germination index (GI) were evaluated.

[0083] To investigate changes in seed structure before and after aging in transgenic seeds expressing or knocking out OsNAT9, cross-sections of seeds were observed using a scanning electron microscope. Specifically, samples were fixed in 2.5% (w / v) glutaraldehyde in 0.1 M PBS for 2 hours and then washed three times with 0.1 M PBS. After dehydration with a gradient of ethanol at 4°C, the samples were critical point dried, coated with palladium gold using a sputter coater, and observed under a scanning electron microscope (JSM-6390LV, JEOL).

[0084] Experimental results: Seed vigor is a key factor affecting seed germination and longevity. Mature seeds of two homozygous knockout mutants of OsNAT9 and two OsNAT9 overexpression lines were selected to evaluate seed germination indicators such as germination percentage (SP), germination potential (GP) and germination index (GI). Compared with TNG67, the GP of seeds of OsNAT9 knockout mutants was significantly reduced after germination for 4 days, with OsNAT9-1 and OsNAT9-2 decreasing by 84.60% and 64.99%, respectively, while the GP of OE-2 was significantly increased, and there was no significant difference in the GP of OE-1 seeds ( Figure 2 AB). Compared with TNG67, the SP of seeds of OsNAT9 knockout mutants decreased significantly after germination for 10 days, with decreases of 59.46% and 23.65% for OsNAT9-1 and OsNAT9-2, respectively. However, no significant difference in SP was observed in OsNAT9 overexpression lines at 10 days ( Figure 2 C). In addition, the GI of OsNAT9 knockout mutant seeds was significantly lower than that of TNG67, while the GI of OE-1 and OE-2 were not significantly different from that of TNG67 ( Figure 2 D). Seven days after seed dormancy breaking, TNG67, OsNAT9 knockout mutants, and overexpression lines showed phenotypes similar to those of seeds germinating under natural conditions. The SP of OsNAT9-1 and OsNAT9-2 knockout mutants was reduced by 8.52% and 14.36%, respectively, compared with the wild type. Figure 2 EH). These results indicate that knockout of the OsNAT9 gene slows seed germination and reduces seed vigor in rice.

[0085] Seed longevity was measured by GP, SP, and GI after natural aging or artificial aging treatment (high temperature and high humidity to accelerate the aging process). After 6 months of storage under natural conditions, TNG67 germinated significantly faster than OsNAT9-1 and OsNAT9-2 knockout mutant seeds, with a germination rate still as high as 96%. Compared with TNG67, the GP, SP, and GI of OsNAT9 knockout mutant and OsNAT9 overexpression rice seeds were significantly reduced (P < 0.01 or P < 0.001). The germination potential of OsNAT9-1 and OsNAT9-2 knockout mutant seeds was reduced by 88.71% and 83.87%, the germination rate was reduced by 72.34% and 45.39%, and the GI was reduced by 94.36% and 62.84%, respectively. Figure 3 ).

[0086] After artificial aging for 7, 14, and 21 days, the GP, SP, and GI of seeds from OsNAT9-1 and OsNAT9-2 knockout mutants and OsNAT9 overexpression lines were significantly lower than those of seeds from TNG67 ( Figure 4 AB). Among them, after 21 days of artificial aging, the SP of seeds of OsNAT9-1 and OsNAT9-2 decreased the most, and the seed viability was almost completely lost. The appearance of polished rice from TNG67, OsNAT9 knockout mutant and OsNAT9 overexpression seeds after 14 days of artificial aging showed that OE-1 rice and TNG67 had a translucent dark endosperm phenotype, while OsNAT9-1 was completely opaque milky white ( Figure 4 C). Scanning electron microscopic analysis of polished rice cross sections showed that before artificial aging, starch granules in the endosperm of TNG67 and OsNAT9 overexpressing seeds were regular polyhedrons with uniform size and close arrangement. Compared with TNG67 seeds, the shape and size of starch granules in the endosperm of OsNAT9-1 knockout mutant seeds were not as uniform as those in wild-type seeds, and their arrangement was also looser. After 14 days of artificial aging, the structure of starch granules in the endosperm of OsNAT9-1 and OE-1 seeds changed, and their shape and size were no longer uniform. Compared with TNG67, the structural changes in starch granules in the OsNAT9-1 knockout mutant were more obvious, with more irregular shape and size and looser arrangement ( Figure 4 CD), suggesting that knocking out the OsNAT9 gene may affect starch metabolism and structure.

[0087] The above results showed that the changes in seed vigor of OsNAT9 knockout mutant, OsNAT9 overexpression line and TNG67 showed similar trends under natural aging and artificial aging conditions, indicating that OsNAT9 plays an important role in regulating seed vigor and lifespan.

[0088] Example 7 Detection of ascorbic acid content in rice samples by ultra-high performance liquid chromatography

[0089] Seeds, seedlings, and tissues from different developmental stages of TNG67, OsNAT9 knockout mutants, and overexpression lines were frozen at -20°C for 24 h, then freeze-dried and ground into powder. Two grams of dry powder from each sample was weighed and placed in a 50-mL centrifuge tube. 10 mL of 3% trichloroacetic acid extractant was added, vortexed, and ultrasonically extracted at 37°C for 30 min. Centrifuged at 4000 rpm for 10 min, the supernatant was diluted to 10 mL with the extractant, filtered through a 0.22 μm filter, and the ascorbic acid content of each sample was determined by ultra-performance liquid chromatography (UPLC). The assay method was based on that of Wang et al. (Wang, M., He, J., Li, S., Cai, Q., Zhang, K. & She, J. (2023c) Structural basis of vitamin C recognition and transport by mammalian SVCT1 transporter. Nature Communications, 14, 1361.). Three replicates were performed for each sample.

[0090] Experimental results: To explore the mechanism of OsNAT9 in ascorbic acid transport in rice, this study analyzed the AsA content in different tissues of Osnat9 knockout mutant and OsNAT9 overexpressing transgenic rice ( Figure 5 AC). The results showed that compared with the wild type, the AsA content in mature seeds, embryos, old leaves and old stems of OsNAT9-1 and OsNAT9-2 was significantly reduced, while there was no significant difference between OE-1 and OE-2 and the wild type ( Figure 5 A). Within the first 48 h of seed germination, we found that the AsA content in the embryos of the OsNAT9 knockout mutant increased rapidly at 6 h, then decreased, and then increased again, reaching a peak at 48 h ( Figure 5 B). However, the AsA level in the endosperm of the OsNAT9 knockout mutant was consistently lower than that in the wild type and OE-1 and OE-2 ( Figure 5 C) These results indicate that a large amount of AsA is required for seed germination, and knocking out OsNAT9 interferes with the metabolism or transport of AsA during seed germination, leading to a large accumulation of AsA in the embryo.

[0091] Example 8 Germination Analysis of OsNAT9 Mutant Seeds Treated with Exogenous AsA

[0092] The seeds of TNG67 and OsNAT9 knockout mutants were disinfected and sterilized, and then the seed germination test was carried out on 1 / 2 MS medium containing 0 mM, 0.3 mM, 0.6 mM, 1.2 mM, and 2.4 mM ascorbic acid. Each treatment was repeated 3 times. All seeds were germinated in an incubator with a relative humidity of 80%, 28°C / 26°C (day / night), and a 14h / 10h light / dark cycle. The light intensity was set to 100 μmol·m -2 ·s -1 The seed germination was observed 3 and 6 days after treatment, and the seed germination potential, germination rate and germination index were calculated.

[0093] Experimental results: To further explore the relationship between ascorbic acid (AsA) content and seed vigor in OsNAT9 knockout strains, we studied the germination response of TNG67 and OsNAT9 knockout mutant seeds to exogenous AsA treatments at 1 / 2MS and 1 / 2MS+AsA (0, 0.3, 0.6, 1.2, and 2.4 mM). Figure 6 As shown. When AsA was added exogenously, the germination rate of OsNAT9 knockout mutant seeds was significantly higher than that of OsNAT9 mutant seeds without AsA addition ( Figure 6 A). Compared to TNG67 grown under the same conditions, treatment with 0.3 mM AsA increased the germination rates of OsNAT9-1 and OsNAT9-2 seeds by 18.51% and 14.83%, respectively, while treatment with this concentration of AsA did not significantly affect TNG67. A high concentration of ASA (2.4 mM) inhibited germination of OsNAT9-1 and OsNAT9-2 seeds but had no significant effect on TNG67. This suggests that exogenous AsA can, to some extent, alleviate the inhibitory effects of OsNAT9 knockout on seed germination.

[0094] In summary, endogenous AsA content is closely related to rice seed germination, and endogenous AsA and its transport system jointly participate in the regulation of rice seed germination, further confirming that OsNAT9 may be involved in the transport and stress response of rice AsA, thereby playing an important role in maintaining rice seed vigor and germination ability.

[0095] Example 9 Analysis of Drought Resistance of OsNAT9 Mutant Plants

[0096] To evaluate the drought stress tolerance of rice seedlings expressing TNG67 and OsNAT9 mutants and overexpressing lines, 21-day-old seedlings (20 plants per replicate, three replicates) were transplanted into Yoshida solution hydroponics containing 25% (w / v) PEG6000. After 7–21 days of growth under a photoperiod of 12 h light (28°C) / 12 h dark (26°C), all plants were transferred to Hoagland nutrient solution for 7 days of recovery. Each treatment was replicated three times, during which plant phenotypes were observed and photographed, and plant survival was calculated. Fresh stems and leaves of all plants treated with PEG6000 for 5 days were analyzed for antioxidant markers.

[0097] Diaminobenzidine (DAB) is the most sensitive and commonly used chromogenic substrate for horseradish peroxidase. Due to the presence of peroxidase in plant leaves, DAB can react with H2O2 to form a yellow-brown insoluble precipitate that accumulates on the leaf surface. The darker the color, the higher the H2O2 content. Nitro blue tetrazolium (NBT) staining is a commonly used histochemical method for detecting superoxide anions (O 2- In this experiment, DAB and NBT staining were used to detect H2O2 and O in the leaves of wild-type, Osnat9 knockout mutant and OsNAT9 overexpressing plants treated with 25% PEG6000 nutrient solution for 5 days to simulate drought. 2- content.

[0098] Experimental results: Since PEG6000 significantly induced the expression of OsNAT9 mRNA, we hypothesized that OsNAT9 might respond to drought stress. To verify the hypothesis, we tested the drought stress responses of OsNAT9 mutants and OsNAT9 overexpressing lines under 25% PEG6000 treatment. Figure 7 After 21 days of 25% PEG600 stress, the OsNAT9 mutant plants showed severe wilting phenotype and the survival rate of seedlings was significantly reduced, while the OsNAT9 overexpressing plants maintained a strong survival state ( Figure 7 A). After 25% PEG6000 stress treatment, the plants recovered in Hoagland nutrient solution for 7 days. Compared with the wild type, the survival rates of OsNAT9-1 and OsNAT9-1 mutants were 29.37% and 25.00%, respectively, while the survival rates of OsNAT9 overexpressing strains OE-1 and OE-2 were as high as 76.00% and 78.00%, respectively. Figure 7 D). The results indicate that OsNAT9 enhances drought resistance in rice seedlings.

[0099] In this study, DAB and NBT staining were used to detect H2O2 and O in the leaves of wild-type, OsNAT9 knockout mutant and OsNAT9 overexpressing plants treated with 25% PEG6000 nutrient solution for 5 days to simulate drought. 2- The DAB staining results showed that there was little difference in the staining of their leaves before PEG6000 treatment, but after treatment, the wild type and OE-1 and OE-2 plants were lighter in color, while the leaves of OsNAT9-1 and OsNAT9-1 plants were the darkest in color ( Figure 7 B). Quantitative determination of H2O2 content also showed that after PEG6000 treatment, the H2O2 content of OsNAT9-1 and OsNAT9-1 plants was significantly higher than that of the wild type (P < 0.05), while the H2O2 content of OE-1 and OE-2 plants was not significantly different from that of the wild type (P > 0.05), which was consistent with the results of DAB staining ( Figure 7 E) NBT histochemical staining showed that the NBT staining of OsNAT9-1 and OsNAT9-2 plants was more intense than that of the wild type after 5 days of PEG6000 treatment, indicating that there were more O 2- accumulation, while the NBT coloration of OE-1 and OE-2 plants was close to that of the wild type ( Figure 7 C).

[0100] This study also analyzed the changes in antioxidant enzyme activities in OsNAT9 knockout mutant and OsNAT9 overexpressing rice seedlings under drought stress. The results showed that compared with before PEG6000 treatment, the SOD, POD, and CAT activities of wild-type, OsNAT9 knockout mutant, and OsNAT9 overexpressing seedlings after PEG6000 treatment increased, indicating that the antioxidant system of rice was activated. Compared with the wild-type under the same treatment, the MDA content of OsNAT9 knockout mutant seedlings increased significantly (P < 0.05), and the SOD, POD, and CAT activities decreased significantly (P < 0.05). Among them, the MDA content of OsNAT9-1 leaves increased by 66.59%, and the SOD, POD, and CAT activities decreased by 42.2%, 52.37%, and 45.58%, respectively. However, the MDA content and SOD, POD, and CAT activities of OsNAT9 overexpressing plants were similar to those of the wild-type ( Figure 7 FI).

[0101] In summary, PEG6000 treatment resulted in H2O2 and O 2- The knockout mutant seedlings of OsNAT9 were more significantly affected by drought stress. Overexpression of OsNAT9 may increase the AsA content and antioxidant activity of rice seedlings, thereby scavenging H2O2 and O 2- , thereby eliminating H2O2 and O 2-to enhance drought resistance by oxidative stress damage.

[0102] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Application of the OsNAT9 gene in regulating rice seed vigor and drought tolerance, characterized in that: Rice seed vigor and drought tolerance are regulated by gene knockout or gene overexpression; the nucleotide sequence of the OsNAT9 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The regulating the rice seed vitality is regulating the germination rate, germination potential and germination index of the rice seeds.

3. The use according to claim 1, characterized in that The gene knockout is carried out by using OsNAT9 as the target gene, using the CRISPR / Cas9 gene editing system to construct a knockout vector of the target gene, transforming it into rice, and cultivating the rice.

4. The use according to claim 3, characterized in that The method for constructing the knockout vector comprises the following steps: Select a target and design gRNA, perform PCR amplification using the pCBC-MT1T2 plasmid as a template, and after recovery, use T4 ligase to ligate it with the pHUE411 vector to obtain a ligation product, which is then transformed into Escherichia coli, the plasmid is extracted, and then sequencing verification is performed.

5. The use according to claim 4, characterized in that The gRNA sequence is shown in SEQ ID NO.

2.

6. The use according to claim 1, characterized in that The gene overexpression is carried out by taking OsNAT9 as the target gene, connecting the target gene with a vector by seamless cloning and homologous recombination to construct an overexpression vector, transforming the vector into rice, and cultivating the rice.

7. The use according to claim 6, characterized in that The method for constructing the gene overexpression vector comprises the following steps: Upstream and downstream primers were designed for OsNAT9 gene for PCR amplification. The binary vector pRHVcGFP and the amplified product were digested with HindIII and KpnI as restriction sites. Then, the target fragment was connected with the linearized vector by homologous recombination to obtain a recombinant vector.

8. The use according to claim 7, characterized in that The upstream primer is shown as SEQ ID NO.7, and the downstream primer is shown as SEQ ID NO.

8.

9. The application of OsNAT9 gene in breeding drought-resistant rice varieties is characterized by: The nucleotide sequence of the OsNAT9 gene is shown in SEQ ID NO.

1.

10. A method for cultivating drought-resistant rice varieties, characterized in that: The expression vector containing the OsNAT9 gene is transformed into the target plant for overexpression to obtain the drought-resistant rice; the nucleotide sequence of the OsNAT9 gene is shown in SEQ ID NO.1.

Images