AtCEPD2 gene for reducing cadmium absorption of plants and application of AtCEPD2 gene

Abstract

The invention relates to an AtCEPD2 gene for reducing cadmium absorption of a plant and application of the AtCEPD2 gene. The invention discloses an AtCEPD2 gene for reducing plant cadmium absorption and application thereof. A nucleotide sequence of the AtCEPD2 gene is shown as SEQ ID NO. 1. The invention also provides application of the gene in enhancing cadmium resistance of plants. According to the invention, the AtCEPD2 gene is subjected to overexpression through a gene engineering technology, then an overexpression vector is obtained, the vector is transformed into a strain, and an AtCEPD2 gene overexpression homozygous strain is obtained through screening, so that the cadmium resistance of the plant is obviously improved. Experiments confirm that the arabidopsis AtCEPD2 gene can improve the cadmium resistance of plants for the first time, and in view of the function verification result of the AtCEPD2 gene, it can be considered that the gene has potential application value for reducing the cadmium absorption of the plants and enhancing the cadmium resistance of the plants. Meanwhile, the invention also lays a good theoretical and application foundation for cultivating cadmium-resistant and high-yield crop varieties by using the AtCEPD2 gene.

Description

Technical Field

[0001] The invention relates to an AtCEPD2 gene for reducing plant cadmium absorption and application thereof, belonging to the technical field of biological gene engineering. Background Art

[0002] In recent decades, due to increasing industrial pollution and the irrational use of pesticides and fertilizers in agricultural production, the accumulation of heavy metal pollutants in the soil has steadily increased, posing a serious threat to green agricultural production and public health. Cadmium is one of the most representative heavy metal elements. Cadmium is also a major element of heavy metal pollution in soil, with a national exceedance rate of 7.0%, far exceeding that of other measured inorganic pollutants (National Soil Pollution Survey Bulletin, 2014). In nature, cadmium primarily exists in an ionic state. Most cadmium compounds are soluble in water and easily absorbed by plants, potentially affecting animal and human health through the food chain.

[0003] Using molecular biological methods to improve plants is an effective way to address their response to cadmium pollution. Over the past decade, botanists and crop scientists have screened numerous cadmium transporters in various plants and applied them to plant and crop improvement. However, most of these proteins transport cadmium ions to the plant's vacuole or other parts of the plant, isolating them. This poses a risk of cadmium contamination in the food chain. While knocking out these proteins reduces the plant's absorption of cadmium ions, it also affects the plant's absorption of other nutrients, impacting its growth and development.

[0004] Therefore, it is very important to explore and study genes that can reduce plant cadmium absorption and enhance plant cadmium resistance, which will be of great use in plant improvement. Summary of the Invention

[0005] In view of the deficiencies of the prior art, the present invention provides an AtCEPD2 gene for reducing cadmium absorption in plants and applications thereof.

[0006] The technical solutions of the present invention are as follows:

[0007] An AtCEPD2 gene for reducing cadmium absorption in plants, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] The above-mentioned AtCEPD2 gene is used to reduce plant cadmium absorption and enhance plant cadmium resistance. The nucleotide sequence of the AtCEPD2 gene is shown in SEQ ID NO.1.

[0009] Preferably, according to the present invention, the application means that overexpression of the AtCEPD2 gene can enhance plant cadmium resistance and reduce plant absorption and accumulation of cadmium.

[0010] Preferably according to the present invention, the plant is Arabidopsis thaliana.

[0011] Preferably, according to the present invention, the application includes: inserting the AtCEPD2 gene into a plasmid vector to construct an overexpression vector of the AtCEPD2 gene, then introducing the overexpression vector of the AtCEPD2 gene into a recipient plant, and screening to obtain functional transgenic plants.

[0012] Further preferably, in the AtCEPD2 gene overexpression vector, the plasmid vector used is pMD20-T, and the promoter is pPYK10.

[0013] Beneficial effects of the present invention:

[0014] 1. The present invention overexpresses the AtCEPD2 gene through genetic engineering technology, then obtains an overexpression vector, transforms the vector into a strain, and obtains a homozygous strain overexpressing the AtCEPD2 gene through screening, thereby significantly improving the plant's cadmium resistance. The present invention experimentally confirms for the first time that the Arabidopsis thaliana AtCEPD2 gene can reduce plant cadmium absorption and enhance plant cadmium resistance. In view of the functional verification results of the AtCEPD2 gene, it can be considered that this gene has potential application value in reducing plant cadmium absorption and enhancing plant cadmium resistance. At the same time, the present invention also lays a good theoretical and application foundation for using the AtCEPD2 gene to cultivate cadmium-tolerant and high-yield crop varieties.

[0015] 2. The AtCEPD2 gene disclosed in this invention is expressed exclusively in the root epidermis, effectively preventing cadmium ions from entering the plant. Furthermore, compared to the existing cadmium transporter PDR8 gene, the AtCEPD2 gene requires virtually no ATP consumption. Roots are the primary source of water absorption for plants and the primary pathway for heavy metal pollution. Therefore, the properties of the AtCEPD2 gene are applicable to nearly all plant species, offering broad potential for the development of low-cadmium plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the agarose gel electrophoresis diagram of the AtCEPD2 gene in Example 1.

[0017] Figure 2 These are optical photographs of the seedling phenotypes of Arabidopsis thaliana seeds transgenic for AtCEPD2 of the present invention, which were germinated on a normal 1 / 2 MS medium for 3 days and then transferred to a 1 / 2 MS medium containing 50 μM CdCl 2 and grown for 7 days.

[0018] In the figure: WT: control group; OE1: experimental group 1; OE2: experimental group 2.

[0019] Figure 3Root length statistics for AtCEPD2-transgenic Arabidopsis thaliana. Each root length value is the average root length of five randomly selected seedlings. Error bars represent the ±SD of three independent replicates. *P < 0.05.

[0020] In the figure: the horizontal axis represents the group, and the vertical axis represents the root length (cm); WT: control group; OE1: experimental group 1; OE2: experimental group 2.

[0021] Figure 4 The results show the effect of AtCEPD2 gene on the cadmium accumulation ability of Arabidopsis seedlings

[0022] In the figure: the horizontal axis is the group, the vertical axis is the cadmium content; WT: control group; OE1: experimental group 1; OE2: experimental group 2. DETAILED DESCRIPTION

[0023] The present invention will be further described below in conjunction with the examples. However, the scope of the present invention is not limited to the following examples. Those skilled in the art will appreciate that, without departing from the spirit and scope of the present invention, various changes and modifications may be made to the present invention. The present invention provides general and / or specific descriptions of the materials and test methods used in the test. Although many materials and operating methods employed for achieving the purpose of the present invention are well known in the art, the present invention is still described in as much detail as possible herein.

[0024] The example provides the coding nucleotide sequence (CDS sequence) of the Arabidopsis thaliana AtCEPD2 gene as shown in SEQ ID NO.1.

[0025] The sequence information is as follows:

[0026] ATGGACAAAGTGATGAGAATGTCTTCAGAGAAAGGAGTGGTGATCTTCACGAAGAGCTCATGTTGTCTCTGCTACCGCCGTTCAAATCCTGTTCCGTGACCTTAGGGTTCAACCAACCATCCACGAGATCGACAACGACCCGGACTGCCGTGAGAT CGAGAAGGCCTTCTCCGGCTCGGCTGTTCCACGGCGGTTCCAGCTGTCTTTGTCGGAGGCAAGCTTGTTGGCTCCACCAATGAAGTCATGTCCCTTCACCTTAGTGGCTCTCTTGTCCCATTGATCAAACCCTATCAGTCCATCCTTTACTAG.

[0027] Example 1. Cloning of the Arabidopsis thaliana AtCEPD2 gene

[0028] 1. Extraction of Arabidopsis genomic DNA by CTAB method

[0029] CTAB extraction solution: CTAB 4 g, NaCl 16.364 g, add 1 M Tris-HCl (pH 8.0) 20 mL, 0.5 M EDTA 8 mL, dilute to 200 mL with double distilled water and sterilize.

[0030] Take a small amount of Arabidopsis leaves, grind them, add CTAB extraction solution (0.2% mercaptoethanol); divide them into several 1.5 mL centrifuge tubes, and incubate at 65°C for 30 minutes; after centrifugation at 12000 rpm for 12 minutes, pour the supernatant into several other 1.5 mL centrifuge tubes; add an equal volume of chloroform, mix well, centrifuge at 12000 rpm for 5 minutes, and take the supernatant; add 2 times the volume of anhydrous ethanol, precipitate for 5-10 minutes, and centrifuge at 12000 rpm for 12 minutes; wash with 70% ethanol three times, air-dry for 5-10 minutes to obtain Arabidopsis genomic DNA; add 40 μL of TE buffer to the Arabidopsis DNA to dissolve the Arabidopsis DNA to obtain an Arabidopsis genomic DNA solution.

[0031] 2. Using Arabidopsis genomic DNA as a template, primers AtCEPD2-ORF-F / R were designed based on the nucleotide sequence of the AtCEPD2 gene for PCR amplification. The PCR amplification product was subjected to 1 wt% agarose gel electrophoresis, and the amplified DNA fragment was then recovered using the DNA recovery kit (Cat. No.: DP209) from Tiangen Biochemical Technology (Beijing) Co., Ltd. according to its instructions.

[0032] The sequence of primer AtCEPD2-ORF-F / R is as follows:

[0033] AtCEPD2-ORF-F: 5'-ATGGGAATCATTGGTAAGAGTG-3';

[0034] AtCEPD2-ORF-R: 5'-TCATTTGGGGCAGGTAGGT-3'.

[0035] The PCR amplification system (50 μL) was as follows: 0.5 μL of Pfu DNA polymerase, 10 μL of 5× Trans Start Fast Pfu buffer, 4 μL of dNTP mixture, 2 μL of primer AtCEPD2-ORF-F, 2 μL of primer AtCEPD2-ORF-R, 2 μL of genomic DNA, and 29.5 μL of sterile distilled water.

[0036] PCR amplification program: pre-denaturation at 98°C for 30 seconds; denaturation at 98°C for 10 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 1 minute (35 cycles); extension at 72°C for 5-10 minutes; and finally incubation at 4°C.

[0037] Take 10 μL of PCR product and perform 1% agarose gel electrophoresis analysis. Figure 1 shown.

[0038] Depend on Figure 1 It can be seen that the AtCEPD2 gene was successfully obtained by PCR amplification in this example. The PCR product was sent to Sangon for sequencing, and the sequencing result is shown as SEQ ID NO. 1, which is 309 bp in length, confirming that the cloned target fragment is the Arabidopsis thaliana AtCEPD2 gene.

[0039] Example 2: Construction of AtCEPD2 gene overexpression vector and preparation of transgenic plants

[0040] 1. Construction of AtCEPD2 gene overexpression vector

[0041] The first 2000 bp of the CDS sequence of the myrosinase (PYK10) gene was obtained from the Arabidopsis thaliana Information Resource Database (TAIR), and the nucleotide sequence is shown in SEQ ID NO.2.

[0042] Using the Arabidopsis genomic DNA extracted in Example 1 as a template, primers pPYK10-F / R were designed based on the first 2000 bp nucleotide sequence of the myrosinase (PYK10) gene, and PCR amplification was performed. The PCR amplification product was subjected to 1 wt% agarose gel electrophoresis. The amplified DNA fragment was then recovered using the DNA recovery kit (Cat. No. DP209) from Tiangen Biochemical Technology (Beijing) Co., Ltd. according to its instructions and sequenced to confirm that the amplified product was the promoter of the AtCEPD2 gene.

[0043] The primer sequences are as follows:

[0044] pPYK10-F: 5'-GTGCGAGTTCCACATCAG-3';

[0045] pPYK10-R: 5'-GGGCAACAGGTCCATCT-3'.

[0046] The PCR amplification system and PCR amplification procedure were the same as in Example 1.

[0047] The AtCEPD2 gene obtained in Example 1 and the promoter pPYK10 obtained in step (2) were ligated to a pMD20-T vector (purchased from TAKALA) using DNA ligase. After the ligation product was transformed into Escherichia coli, the transformed bacterial solution was spread on a solid LB medium containing kanamycin resistance. Colonies were picked and shaken in a medium solution containing the corresponding antibiotic. After confirmation, the plasmid of the positive clone was extracted, enzyme digested, and electrophoresed to recover the target band. The recovered product was transformed into Escherichia coli, plated, positive clones were screened, and the plasmid was extracted to obtain the AtCEPD2 gene overexpression vector, which was used for experiments such as Agrobacterium transformation.

[0048] 2. Transformation of Agrobacterium by electroporation

[0049] Remove the Agrobacterium tumefaciens GV3101 competent cells and freeze-thaw them on ice, add 2 μL of the AtCEPD2 gene overexpression vector obtained in step 1 to 100 μL of Agrobacterium tumefaciens GV3101 competent cells, and gently stir evenly with a pipette tip; remove the mixture of cells and plasmids and transfer it to an electric shock cup, pre-cool it, and then electroporate it at 2500 V high voltage; remove the electric shock cup, add 800 μL of pre-cooled LB liquid culture medium, gently blow to mix, aspirate the bacterial solution and transfer it to a 1.5 mL centrifuge tube, and culture it at 28°C and 200 rpm for 5 hours; remove 35 μL of the bacterial solution and spread it on LB solid culture medium containing the corresponding antibiotics, culture it upside down at 28°C for 2 days, then screen Agrobacterium resistant to rifampicin and kanamycin for colony PCR, select positive colonies, shake the bacteria, and expand the culture.

[0050] 3. Cultivation of transgenic plants

[0051] Arabidopsis seeds were sterilized twice with 1:13 sodium hypochlorite for a total of 8 minutes, then washed six times with sterile water for a total of 6 minutes, and sown on 1 / 2 MS culture medium. The 1 / 2 MS culture medium containing the seeds was placed in a 4°C refrigerator for 3 days, then incubated in a light incubator with a photoperiod of 16 hours (light) / 20°C, 8 hours (dark). After 10 days of incubation, the seedlings were transferred to plastic boxes containing a 4:3:3 ratio of nutrient soil: vermiculite:perlite and incubated regularly with water. The Agrobacterium cultured in step 2 was then inoculated into the Arabidopsis using the inoculation method.

[0052] 4. Transgenic plant screening

[0053] T0 seeds were screened on 1 / 2 MS medium containing 100 μg / mL of the herbicide (PPT). T0 transgenic and wild-type Arabidopsis plants were harvested, and DNA was extracted from leaves. PCR was performed with wild-type and transgenic Arabidopsis plants to identify positive plants. Approximately ten T1 plants were obtained from each transgenic Arabidopsis line. Three of these T1 transgenic Arabidopsis plants were randomly selected for further cultivation. RNA was extracted from the transgenic and wild-type plants, and RT-PCR was performed with wild-type plants as controls. T2 seeds from RT-PCR-positive plants were used as experimental materials, resulting in T2-generation AtCEPD2-transgenic Arabidopsis plants.

[0054] Example 3: Effect of the Arabidopsis ATCEPD2 gene on the growth phenotype of Arabidopsis seedlings under cadmium stress

[0055] Eight T2-generation AtCEPD2-transfected Arabidopsis seeds prepared in Example 2 were equally divided into experimental group 1 (OE-1) and experimental group 2 (OE-2); four wild-type Arabidopsis seeds collected from the same batch as the T2-generation AtCEPD2-transfected Arabidopsis seeds were used as a control group (WT).

[0056] The above three groups of Arabidopsis seeds were germinated on 1 / 2 culture medium for 3 days, and then transferred to 1 / 2 MS medium containing 50μM CdCl2 and continued to grow for 7 days until they grew into Arabidopsis seedlings. Their growth was observed and the root length was measured and statistically analyzed. The results are as follows Figure 2 and Figure 3 shown.

[0057] Depend on Figure 2 and Figure 3 It can be seen that the root length of the AtCEPD2 gene-transfected Arabidopsis seeds in experimental group 1 (OE-1) after growing under cadmium stress reached 1.467 cm, and the root length of the AtCEPD2 gene-transfected Arabidopsis seeds in experimental group 2 (OE-2) after growing under cadmium stress reached 1.332 cm, while the root length of the wild-type Arabidopsis seeds in the control group (WT) after growing under cadmium stress was only 1.048 cm, indicating that the growth of the AtCEPD2 gene-transfected Arabidopsis seeds under cadmium stress was significantly better than that of the wild-type Arabidopsis seeds.

[0058] Example 4: Effect of the AtCEPD2 gene on cadmium accumulation in Arabidopsis seedlings under cadmium stress

[0059] Ten T2-generation AtCEPD2-transfected Arabidopsis seeds prepared in Example 2 were equally divided into experimental group 1 (OE-1) and experimental group 2 (OE-2); five wild-type Arabidopsis seeds collected from the same batch as the T2-generation AtCEPD2-transfected Arabidopsis seeds were used as a control group (WT).

[0060] The above three groups of Arabidopsis seeds were grown on 1 / 2MS medium containing 50 μM CdCl2 for 10 days until they grew into Arabidopsis seedlings. After being washed with clean water several times, they were dried at room temperature and weighed. After being digested with nitric acid, their cadmium content was detected using inductively coupled plasma mass spectrometry (ICP-MS).

[0061] Depend on Figure 4 It can be seen that the cadmium content of AtCEPD2-transgenic Arabidopsis is significantly lower than that of wild-type Arabidopsis, indicating that under Cd stress, the transgenic Arabidopsis effluxes or blocks Cd 2+ The ability of ATCEPD2 gene was significantly enhanced, indicating that it has the ability to reduce the absorption and accumulation of cadmium in Arabidopsis and enhance the cadmium resistance of plants.

Claims

1. An AtCEPD2 gene that reduces cadmium absorption in plants, characterized in that: The nucleotide sequence is shown in SEQ ID NO.

1.

2. Use of the AtCEPD2 gene according to claim 1 in reducing plant cadmium absorption and enhancing plant cadmium resistance, characterized in that: The nucleotide sequence of the AtCEPD2 gene is shown in SEQ ID NO.

1.

3. The use according to claim 2, characterized in that The application means that overexpression of the AtCEPD2 gene can enhance plant cadmium resistance and reduce plant absorption and accumulation of cadmium.

4. The use according to claim 2, characterized in that The plant is Arabidopsis thaliana.

5. The use according to claim 2, characterized in that The application includes: inserting the AtCEPD2 gene into a plasmid vector to construct an overexpression vector of the AtCEPD2 gene, then introducing the overexpression vector of the AtCEPD2 gene into a recipient plant, and screening to obtain functional transgenic plants.

6. The use according to claim 5, characterized in that In the AtCEPD2 gene overexpression vector, the plasmid vector used is pMD20-T and the promoter is pPYK10.

Images