Application of rice OsARF22 gene in regulation and control of salt tolerance

Abstract

The invention aims to disclose an application of a rice OsARF22 gene in regulation and control of salt tolerance. The gene OsARF22 is a DNA molecule as shown in 1) or 2): 1) a DNA molecule with a genomic sequence as shown in SEQ ID NO.1; 2) a DNA molecule with a CDS sequence as shown in SEQ ID NO. 2. According to the genetic engineering application of the gene OsARF22 in regulation and control of the salt tolerance of the rice, specifically, the gene OsARF22 in the rice is knocked out, or the expression quantity of protein coded by the gene OsARF22 is reduced, or a knockout carrier of the gene OsARF22 is transferred into the rice, and the salt tolerance of the rice can be improved.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and particularly relates to the application of rice OsARF22 gene in regulating salt tolerance. Background Art

[0002] Salt stress is one of the main abiotic stresses that limits rice growth and yield. The total area of saline soil in the world is about 800 million hectares, which seriously threatens food security. Rice is sensitive to salt stress and will undergo a series of physiological, biochemical and morphological changes under salt stress. From a physiological and biochemical perspective, excessive salt ions will destroy the integrity of the rice cell plasma membrane, resulting in a decrease in the selective permeability of the cell plasma membrane and the increase of intracellular Ca2+. 2+ , K + Nutrient elements such as Na + 、Cl - Plasma accumulates in large quantities within cells, causing an imbalance in intracellular ion balance. Furthermore, salinity-alkali stress induces the production of reactive oxygen species, weakens the body's antioxidant enzyme defense system, exacerbates membrane lipid peroxidation, and triggers metabolic disorders. Morphologically, salt stress can delay rice seed germination, reduce germination rates, inhibit growth, hinder panicle differentiation, delay tillering, and reduce tiller number, ultimately leading to reduced yield and quality.

[0003] The physiological mechanism of rice salt tolerance mainly covers multiple aspects such as osmotic regulation, ion balance regulation, antioxidant system response and hormone signal transduction. First, when encountering salt stress, rice cells will produce a large amount of organic osmotic regulating substances such as proline, betaine, and trehalose. These substances can effectively reduce the osmotic pressure of cells while maintaining the stability of protein structure and the integrity of cell membranes. Secondly, maintaining the balance of ions in the body is the key link in rice salt tolerance, among which the regulation of Na + The precise regulation of Na is particularly important. + The absorption, transport and excretion process of Na + This complex process involves Na + / K + Antiporter, high affinity K +The synergistic effects of multiple protein families, including transporters and non-selective cation channels, are crucial. Furthermore, salt stress can lead to the massive accumulation of reactive oxygen species (ROS) in rice plants. These excessive ROS act like "biochemical bombs" within the cell, triggering a series of toxic reactions, including DNA mutations, protein degradation, and carbohydrate and lipid peroxidation. To mitigate this crisis, rice plants activate their antioxidant defense system. By regulating the synthesis and activity of antioxidant enzymes such as peroxidase, superoxide dismutase, and catalase, they effectively eliminate excess ROS, thereby maintaining intracellular redox balance and ensuring normal cellular physiological function. Furthermore, under high-salt conditions, the synthesis, metabolism, and signaling pathways of various hormones in rice plants undergo significant changes. Abscisic acid, a core hormone regulating plant salt tolerance, helps rice cope with salt stress by regulating stomatal closure to reduce water loss, promoting root growth, and enhancing water absorption. Plant hormones such as ethylene, jasmonic acid, and brassinolide also play an indispensable role in rice's salt tolerance. Together, they form a complex hormone regulatory network that synergistically regulates rice's adaptive response to salt tolerance.

[0004] Salt tolerance in rice is regulated by multiple genes and has a highly complex genetic mechanism. This makes traditional hybrid breeding for improving salt tolerance face challenges such as long breeding cycles and low efficiency. In contrast, molecular design breeding technology, with its advantage of precise control of target traits, can significantly shorten the breeding cycle and improve selection efficiency, making it a core technical path for breeding new salt-tolerant rice varieties. However, the effective implementation of this technology is highly dependent on the in-depth exploration and functional analysis of key salt-tolerant genes. Although research on rice salt-tolerance genes has made phased progress in recent years, and some functional genes have been cloned and identified, the genetic resources that can truly be applied industrially and successfully transformed into breeding practice are still relatively scarce. Therefore, there is an urgent need to further systematically explore and identify new rice salt-tolerance genes to provide more abundant genetic elements and more solid theoretical support for molecular design breeding, thereby promoting technological innovation and industrial upgrading in the selection and breeding of salt-tolerant rice varieties. Summary of the Invention

[0005] In order to overcome the above technical problems existing in the prior art, the present invention provides the genetic engineering application of rice OsARF22 gene in regulating rice salt tolerance.

[0006] The technical solution of this patent is as follows

[0007] The invention relates to the genetic engineering application of the rice salt tolerance related gene OsARF22, or the protein encoded by the gene OsARF22, or the knockout vector of the gene OsARF22, or the primers for amplifying the gene OsARF22 in regulating the salt tolerance of rice.

[0008] Furthermore, knocking out the OsARF22 gene in rice, or reducing the expression level of the protein encoded by the OsARF22 gene, or transferring a knockout vector of the OsARF22 gene into rice can improve the salt tolerance of rice.

[0009] Furthermore, the rice salt tolerance-related gene OsARF22, the gene OsARF22 is the DNA molecule described in 1) or 2) below:

[0010] 1) A DNA molecule having a genomic sequence as shown in SEQ ID NO. 1;

[0011] 2) A DNA molecule whose CDS sequence is shown in SEQ ID NO.2.

[0012] Furthermore, the amino acid sequence of the protein encoded by the gene OsARF22 is shown in SEQ ID NO.3.

[0013] Furthermore, the knockout vector of the gene OsARF22 is a CRISPR-Cas9 vector targeting the target site shown in SEQ ID NO.6: GCACCACTGGATCCTCATTG.

[0014] Furthermore, the specific primers for amplifying the gene OsARF22 are selected from Primer 1 shown in SEQ ID NO. 4 and Primer 2 shown in SEQ ID NO. 5, or Primer 5 shown in SEQ ID NO. 9 and Primer 6 shown in SEQ ID NO. 10.

[0015] Beneficial effects:

[0016] The present invention discovers, for the first time, a new gene encoding a plant salt-tolerance-related protein, OsARF22. This plant salt-tolerance-related protein affects plant salt tolerance. Inhibiting the expression of the gene encoding this protein can improve plant salt tolerance, thereby enabling the cultivation of salt-tolerant transgenic plants. The protein, OsARF22, and its encoding gene can be used in plant genetic improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The mutation site of the OsARF22 gene and its flanking sequences in the OsARF22 gene mutants (osarf22-cr1 and osarf22-cr2) are shown.

[0018] Figure 2 The seedling phenotypes of wild-type Nipponbare (WT) and OsARF22 gene mutants (osarf22-cr1 and osarf22-cr2) under salt stress.

[0019] Figure 3Seedling survival rates of wild-type Nipponbare (WT) and OsARF22 gene mutants (osarf22-cr1 and osarf22-cr2) under salt stress. DETAILED DESCRIPTION

[0020] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention.

[0021] The experimental methods in the following examples are conventional methods unless otherwise specified. The reagents and kits used in the following examples are purchased from conventional biological reagent companies unless otherwise specified.

[0022] Example 1 Cloning of the coding region sequence (CDS) of the rice OsARF22 gene

[0023] Three-week-old rice seedlings of Nipponbare were collected and ground. RNA was extracted using the Trizol method and reverse transcribed into cDNA using the HiScript II 1st Strand cDNA Synthesis Kit (+gDNAwiper) from Nanjing Novozymes Biotechnology Co., Ltd. The CDS sequence of OsARF22 was amplified by PCR using Primer1 and Primer2.

[0024] Primer1:5'-ATGAAGGAGGTGGGGGAGGTGGAG-3' (SEQ ID NO.4);

[0025] Primer2: 5'-TCACGCCTGCTCAACTAAGCATTCG-3' (SEQ ID NO. 5).

[0026] The PCR reaction system (50 μl) is:

[0027]

[0028] After preparing the PCR reaction system, PCR amplification was performed in a Bio-Rad T100 PCR instrument.

[0029] The PCR reaction program is:

[0030]

[0031] After the PCR process was completed, the correct band size was confirmed by agarose gel electrophoresis, and then the DNA was recovered and purified using the DNA gel recovery kit of Nanjing Kangwei Biotechnology Co., Ltd. and ligated to the pEASY-Blunt expression vector (Beijing Quanshijin Biotechnology Co., Ltd.). The ligation product was transformed into Escherichia coli DH5α competent cells (Beijing Qingke Biotechnology Co., Ltd.), and positive clones were selected for sequencing (Beijing Qingke Biotechnology Co., Ltd.).

[0032] Sequencing results showed that the CDS fragment of the OsARF22 gene obtained by PCR amplification had a nucleotide sequence shown in SEQ ID NO.2, encoding a protein consisting of 698 amino acid residues shown in SEQ ID NO.3.

[0033] Example 2 Construction of Rice OsARF22 Gene Mutant Transgenic Plants

[0034] 1. Construction of OsARF22 gene knockout vector

[0035] Based on the genomic sequence of OsARF22 (SEQ ID NO. 1), the CRISPR-Cas9 sgRNA target for the OsARF22 gene was designed using the CRISPR-P V2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ). The target sequence selected for constructing the OsARF22 gene editing vector was: GCACCACTGGATCCTCATTG (SEQ ID NO. 6).

[0036] According to the designed target sequence, Primer3 and Primer4 were synthesized at Sangon Biotechnology Co., Ltd., and the primers were mixed in a 1:1 ratio and annealed to obtain a double-stranded DNA molecule with sticky ends; the pOs-sgRNA was linearized using Bsa I restriction endonuclease. The double-stranded DNA molecule obtained by annealing was mixed with the pOs-sgRNA linearized vector in a 1:1 ratio, and T4 ligase was added for overnight ligation at 16°C (the vector construction method is described in the literature "Targeted mutagenesis in rice using CRISPR-Cas system"). The ligation product was transformed into DH5α Escherichia coli; positive clones were identified by colony PCR, plasmids were extracted, and sequencing was performed. Sequencing results showed that a recombinant vector containing the sequence shown in SEQ ID NO.6 was obtained and named pOs-sgRNA-OsARF22.

[0037] Primer3:5'-ggcaCAATGAGGATCCAGTGGTGC-3' (SEQ ID NO.7);

[0038] Primer4:5'-aaacGCACCACTGGATCCTCATTG-3'(SEQ ID NO.8)

[0039] The pOs-sgRNA-OsARF22 plasmid and the pH-Ubi-cas9-7 vector (the vector construction method is described in the literature "Targeted mutagenesis in rice using CRISPR-Cas system") plasmid were mixed 1:1, and then LR reaction was performed using the Gateway kit (Invirogen) and transformed into Escherichia coli DH5α; positive clones were identified by colony PCR, and the plasmid was extracted and sequenced to obtain the plasmid pH-Ubi-cas9-7-OsARF22 containing the target sequence shown in SEQ ID NO.6.

[0040] 2. Obtaining recombinant Agrobacterium

[0041] pH-Ubi-cas9-7-OsARF22 was mixed with Agrobacterium GV3101 competent cells and placed on ice for 10 minutes. Then, pH-Ubi-cas9-7-OsARF22 was transformed into Agrobacterium GV3101 competent cells by heat shock method to obtain a recombinant strain. The recombinant strain identified correctly by colony PCR was named GV3101-pH-Ubi-cas9-7-OsARF22.

[0042] 3. Obtaining genetically modified plants

[0043] The above recombinant Agrobacterium strain was transformed into the rice variety Nipponbare by the following method:

[0044] (1) Cultivation of embryogenic callus of mature embryos of Nipponbare;

[0045] (2) In a 50 ml conical flask, culture the GV3101-pH-Ubi-cas9-7-OsARF22 strain overnight at 28°C and 200 rpm;

[0046] (3) The bacterial solution was inoculated into 200 ml of new YEP liquid medium at a ratio of 1:100 and cultured in suspension at 28°C and 200 rpm until the OD 600 =0.6-0.8, collect the bacteria; gently mix 30mL AAM liquid medium with the bacteria, and add 30μL 1000×AS (acetosyringone) to adjust the bacteria OD 600 =0.05-0.1;

[0047] (4) Mix the Nipponbare callus with the bacterial solution from step (3) and infect for 90 seconds. Use filter paper to absorb the bacterial solution on the callus and transfer it to 2N6-AS solid medium. Incubate in a dark incubator at 28°C for 48 hours.

[0048] (5) After dark culture, the callus tissue was removed and placed in a 200 mL wide-mouth bottle. The callus tissue was washed 10 times with sterile water and shaken continuously until the residual bacterial liquid in the callus tissue was cleaned. The callus tissue was washed twice with sterile water containing 500 mg / L carbenicillin disodium, each time for 15 minutes. The callus tissue was then poured onto sterile filter paper and drained for 1.5 hours.

[0049] (6) The callus tissue was inoculated on N6D-S solid medium containing 50 mg / L Hyg (hygromycin B) and 250 mg / L Car and cultured at 28°C for one month;

[0050] (7) The selected callus containing resistance was transferred to MS-NK solid medium and cultured in a 28°C incubator for one month until the callus produced adventitious buds;

[0051] (8) When the adventitious buds grow to about 3 cm, they are transferred to MS-HF rooting medium and grown at 28°C for 1 week;

[0052] (9) The differentiated rice seedlings are hardened and transferred to the field for growth, and the T0 generation transgenic plants are obtained.

[0053] Example 3 Molecular Identification of Rice OsARF22 Gene Mutant Transgenic Plants

[0054] The transgenic T0 generation plants constructed in Example 2 were sampled, and genomic DNA was extracted using the CTAB method as a template. The primer pair consisting of Primer5 and Primer6 was used to PCR amplify the editing target site shown in SEQ ID NO. 6 and the DNA fragments on both sides thereof.

[0055] Primer5:5'-GATGGAGTGCATGTCGGGGT-3' (SEQ ID NO.9);

[0056] Primer6: 5'-CATAACTGATAATATATGAA-3' (SEQ ID NO. 10).

[0057] The obtained PCR products were detected by 1.2% agarose gel electrophoresis. After the detection bands were correct, the remaining PCR products were sent to the company for sequencing. The sequencing results showed that two strains with mutations in the OsARF22 gene were identified, namely osarf22-cr1 and osarf22-cr2. The DNA sequences of the editing target sites and their flanking sites in these two strains are as follows Figure 1 shown.

[0058] In the osarf22-cr1 strain, a nucleotide A was inserted in the first exon of the OsARF22 gene;

[0059] In the osarf22-cr2 strain, a nucleotide T was inserted in the first exon of the OsARF22 gene;

[0060] In these two mutant strains, mutations in the CDS sequence of the OsARF22 gene caused frameshift mutations and premature termination of the encoded protein.

[0061] Example 4 Identification of Salt Tolerance of OsARF22 Gene Mutant Lines at the Seedling Stage

[0062] The two T0 generation transgenic mutants osarf22-cr1 and osarf22-cr2 identified in Example 3 were self-pollinated for two generations. After homozygous identification, these two homozygous mutant lines were subjected to a salt tolerance identification experiment at the seedling stage together with the Nipponbare wild type.

[0063] (1) Select rice seeds with full grains and soak them in tap water in a 37℃ incubator for 2 days. Select seeds with uniform germination and sow them on a 96-well PCR plate without a tube bottom. Place them in a black glass culture box filled with pure water and culture seedlings in an artificial climate chamber. The culture conditions are: 14h light (28℃) / 10h dark (24℃), light intensity 1100μmol·m -2 ·s -1 After culturing in tap water for one week, the culture was continued in Kimura B nutrient solution for rice.

[0064] (2) When the rice seedlings grew to the two-leaf and one-heart stage, the nutrient solution was replaced with a nutrient solution containing 120 mM NaCl for salt stress treatment.

[0065] (3) After 7 days of NaCl treatment, rehydrate the rice seedlings with tap water. After 7 days, calculate the survival rate of the rice seedlings. Survival rate = number of surviving seedlings / total number of treated seedlings × 100%.

[0066] The results of salt tolerance identification showed that compared with the wild type (WT) of Nipponbare, the salt damage symptoms such as leaf wilting and drying of the two OsARF22 gene mutant strains (osarf22-cr1 and osarf22-cr2) were significantly alleviated ( Figure 2 ); After 7 days of salt stress treatment and 7 days of rehydration, the survival rate of seedlings of osarf22-cr1 and osarf22-cr2 lines was significantly higher than that of the wild type (WT) ( Figure 3 ).

[0067] The above experimental results show that the OsARF22 gene has the function of negatively regulating the salt tolerance of rice seedlings, and knocking out this gene can significantly improve the salt tolerance of rice.

[0068] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. The genetic engineering application of the rice salt tolerance-related gene OsARF22, or the protein encoded by the gene OsARF22, or the knockout vector of the gene OsARF22, or the primers for amplifying the gene OsARF22 in regulating rice salt tolerance.

2. The use according to claim 1, characterized in that Knocking out the OsARF22 gene, or reducing the expression level of the protein encoded by the OsARF22 gene, or transferring the knockout vector of the OsARF22 gene into rice can improve the salt tolerance of rice.

3. The use according to claim 1, characterized in that The gene OsARF22 is a DNA molecule as described in 1) or 2) below: 1) A DNA molecule having a genomic sequence as shown in SEQ ID NO. 1; 2) A DNA molecule whose CDS sequence is shown in SEQ ID NO.

2.

4. The use according to claim 1, characterized in that The amino acid sequence of the protein encoded by the gene OsARF22 is shown in SEQ ID NO.

3.

5. The use according to claim 1, characterized in that The knockout vector of the gene OsARF22 is a CRISPR-Cas9 vector targeting the target site shown in SEQ ID NO.

6.

6. The use according to claim 1, characterized in that The primers are selected from Primer 1 shown in SEQ ID NO. 4 and Primer 2 shown in SEQ ID NO. 5, or Primer 5 shown in SEQ ID NO. 9 and Primer 6 shown in SEQ ID NO. 10.

Images