Kit and method for detecting DBN9936 and RF125
By designing a combination of specific detection primers and probes, the problem of only single identification of genetically modified corn in the prior art was solved, and efficient and rapid identification of DBN9936 and RF125 genetically modified corn was achieved, and the detection effect of high specificity and sensitivity was achieved.
Patent Information
- Application Number
- CN202510417682.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-03
- Publication Date
- 2025-08-19
AI Technical Summary
The existing genetically modified corn detection technology can only identify a certain transformant event in a single way, and the cost is high, and more accurate and rapid identification methods are needed in the market.
Design specific detection primers and probe combinations, including ZSSIIb, DBN9936 and RF125, carry different fluorescent labels for rapid PCR detection of DBN9936 and RF125 transgenic corn materials, achieving indication of target genes through fluorescence channels.
It realizes accurate identification of DBN9936 and RF125 transgenic materials, has high specificity and sensitivity, and is suitable for rapid PCR detection, and the detection can be completed within 15 minutes.
Smart Images
Figure CN120505440A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of plant breeding, and in particular to a kit and method for detecting DBN9936 and RF125. Background Art
[0002] Existing technologies for detecting the authenticity of genetically modified corn mainly include qualitative detection technology based on nucleic acid level, quantitative PCR technology, digital PCR technology, gene chip technology and nucleic acid sensors, and protein level detection technology such as enzyme-linked immunosorbent assay (ELISA) technology and immunochromatographic test strip technology.
[0003] PCR and isothermal amplification are both nucleic acid amplification techniques used to detect specific DNA sequences. PCR relies on a PCR instrument for precise quantitative detection, while digital PCR enables absolute quantification of transgenic DNA fragments with higher sensitivity than qPCR, making it particularly suitable for detecting low-copy-number transgenic fragments. Gene chips can simultaneously detect multiple transgenic loci using a high-density probe array. They enable high-throughput and rapid screening of multiple target genes in transgenic corn. Nucleic acid sensors achieve rapid detection by specifically recognizing specific nucleic acid sequences in transgenic crops and combining physical or chemical signal conversion. Enzyme-linked immunosorbent assay (ELISA) is a leading technology for quantitative detection of transgenic proteins, detecting the presence of specific proteins expressed in transgenic corn to determine the presence of transgenic components. Immunochromatographic test strips utilize an antigen-antibody reaction to rapidly screen for transgenic corn components in the field. Their core mechanism is the binding of labeled antibodies to target proteins to produce visual detection results.
[0004] Currently available detection technologies can usually only identify a single transformation event, which is costly. However, the detection of genetically modified corn on the market requires more accurate and rapid identification. Summary of the Invention
[0005] In order to solve the problems existing in the prior art, the present invention provides a kit and method for detecting DBN9936 and RF125.
[0006] Numerous transgenic corn materials are currently commercialized or under development. These are typically constructed through target gene selection, gene vector construction, corn cell transformation, screening and regeneration, functional validation, field trials, and safety assessments. In light of this, the present invention designs specific detection primers and probes for transformation events in transgenic corn varieties DBN9936 and RF125. By detecting transformation events in these two transgenic corn varieties, specific transgenic corn materials can be identified and differentiated.
[0007] In a first aspect, the present invention provides a primer combination comprising: ZSSIIb, DBN9936, and RF125; The ZSSIIb includes: ZSSIIb-F1:CGGTGGATGCTAAGGCTGATG, ZSSIIb-R1:AAAGGGCCAGGTTCATTATCCTC; The DBN9936 includes: DBN9936-F2: TCAGGGGCAAGAAAACATCC, DBN9936-R: GTGTTATTAAGTTGTCTAAGCGTC; The RF125 includes: RF125-F1: AGGTCTCGGGAGAAGACGTCC, RF125-R1: TGTGTTATTAAGTTGTCTAAGCGTC.
[0008] In a second aspect, the present invention provides a primer and probe combination, wherein the primer and probe combination includes the aforementioned primer combination and probe combination, and the probe combination includes: ZSSIIb-P1:AGCACTCGCCGCCGCATCTG, DBN9936-P: TGGGCACACAAGACACATGTGGTG, RF125-P1: CGCCCCGAGGCTATTTTGTGGTGTA.
[0009] Furthermore, the ZSSIIb-P1, DBN9936-P and RF125-P1 carry different fluorescent labels, which correspond to different fluorescent dyes.
[0010] Preferably, the fluorescent marker comprises one or more of FAM, TET, HEX, ROX, Cy3, Cy5, Alexa Fluor, SYBRGreen, DAPI, FITC or Texas Red.
[0011] The primer and probe combinations provided herein can carry different fluorescent labels. These fluorescent labels are typically covalently attached to specific positions on the primers (e.g., the 5' or 3' end, typically the 5' end) through chemical modification during primer synthesis. These labels correspond to different excitation / emission wavelengths. For example, FAM (Ex 494 nm, Em 520 nm) is commonly used for the blue laser channel, HEX (Ex 535 nm, Em 556 nm) is adapted for the green laser channel, and Cy5 (Ex 649 nm, Em 670 nm) is used for the red laser channel. In actual detection, the target gene can be identified by the detection results of different fluorescence channels.
[0012] In a third aspect, the present invention provides a kit comprising the primer combination, or the primer and probe combination.
[0013] The kit described herein is a pre-prepared experimental tool set that can include only primer pairs, which can be used in conjunction with commonly used PCR amplification reagents in the field to achieve detection purposes. Alternatively, the kit can include a complete set of PCR detection reagents, such as Taq enzyme, dNTPs, and buffer.
[0014] In a fourth aspect, the present invention provides a method for simultaneously detecting DBN9936 and RF125 transgenic materials, comprising: using the primer combination, or the primer and probe combination, or the kit to detect the sample to be tested, and judging whether the sample to be tested contains DBN9936 and / or RF125 transformation events based on the test results.
[0015] The method for simultaneously detecting DBN9936 and RF125 transgenic materials provided by the present invention can be applied to all transgenic corn materials containing transformation events of DBN9936 or RF125, such as DBN9936 and RF125 transgenic corn, or derived transgenic corn materials obtained by selfing, hybridization or backcrossing of these two lines.
[0016] Furthermore, the method includes: extracting DNA from the sample to be tested, performing PCR amplification using the aforementioned primer and probe combination, and determining whether the sample to be tested contains a transformation event of DBN9936 and / or RF125 based on the amplification result.
[0017] Furthermore, the PCR amplification system includes: 0.3-0.8 μL of each detection primer pair, 0.1-0.5 μL of each probe, 15-25 μL of qPCR Mix, 1000-2000 ng of genomic DNA, and the balance is water.
[0018] Furthermore, the PCR amplification procedure includes: pre-denaturation at 93-97°C for 20-60s; denaturation at 93-97°C for 2-5s, and extension at 56-65°C for 7-10s, for 35-45 cycles.
[0019] The primer and probe combination of the present invention can be applied to rapid PCR amplification and has high compatibility, specificity and sensitivity, which are difficult to achieve with conventional primers and probes.
[0020] In actual experiments, those skilled in the art can adopt conventional experimental conditions and PCR amplification systems, such as the rapid PCR amplification system and rapid PCR amplification procedure described above. Under these experimental conditions, the detection of the target gene can be completed in a short time with high accuracy.
[0021] Furthermore, the determining whether the sample to be tested contains the transformation event of DBN9936 and / or RF125 according to the amplification result includes: Based on the fluorescent labels carried by different probes, it is determined whether the sample to be tested contains the transformation event of DBN9936 or the transformation event of RF125 according to the different fluorescent signals detected in the amplification results.
[0022] Furthermore, if the transformation event of DBN9936 is contained, the sample to be tested is judged to be DBN9936 or a derivative thereof; if the transformation event of RF125 is contained, the sample to be tested is judged to be RF125 or a derivative thereof.
[0023] The amplified products of PCR amplification can be detected using a variety of existing methods, such as directly sequencing the amplified products (there are already a large number of companies that provide commercial gene sequencing services), or detecting through fluorescence detection, fluorescent probe hybridization, liquid chromatography or mass spectrometry technology to detect the sample to be tested and determine whether it contains genetically modified corn materials.
[0024] The present invention has the following beneficial effects: The present invention provides a highly specific and sensitive primer and probe combination for DBN9936 and RF125 transgenic materials, using ZSSIIb as an internal reference. This primer and probe combination can accurately identify DBN9936 and RF125 transgenic materials, exhibiting high compatibility within a single detection system without mutual inhibition. It is also suitable for rapid PCR detection procedures, enabling detection in as little as 15 minutes. The primer and probe combination provided by the present invention enables efficient detection of transgenic materials and has significant application value in the field of plant breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] In order to more clearly illustrate the technical solutions in the present invention or the prior art, a brief introduction is given below to the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0026] Figure 1 These are the test results of the primers and probes in the standard provided in Experimental Example 1 of the present invention; wherein A is the B73 transgenic authenticity test result, B is the DBN9936 transgenic authenticity test result, and C is the RF125 transgenic authenticity test result.
[0027] Figure 2 It is the detection result of the primer and probe combination in Example 1 provided in Experimental Example 1 of the present invention; wherein A is the B73 transgenic authenticity detection result, B is the DBN9936 transgenic authenticity detection result, and C is the RF125 transgenic authenticity detection result.
[0028] Figure 3 These are the test results of DBN9936 corn material samples of different concentrations provided in Experimental Example 1 of the present invention; wherein AH are 5ng / μL, 10ng / μL, 100ng / μL, 300ng / μL, 800ng / μL, 1200ng / μL, 1500ng / μL, and 2500ng / μL, respectively.
[0029] Figure 4 These are the test results of RF125 corn material samples of different concentrations provided in Experimental Example 1 of the present invention; wherein AH are 5ng / μL, 10ng / μL, 100ng / μL, 300ng / μL, 800ng / μL, 1200ng / μL, 1500ng / μL, and 2500ng / μL, respectively. DETAILED DESCRIPTION
[0030] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.
[0031] Unless otherwise specified, the experimental methods involved in the following examples are all conventional methods in the art. For example, reference can be made to experimental manuals in the art, or the conditions recommended by the manufacturer's instructions.
[0032] Unless otherwise specified, the experimental materials and reagents involved in the following examples can be obtained from commercial sources.
[0033] Example 1 DBN9936 and RF125 genetically modified corn are two genetically modified corn varieties with significant characteristics. Among them, DBN9936 has high resistance to various lepidopteran pests such as Asian corn borer and armyworm, which can effectively reduce the damage caused by pests to corn. In addition, this variety can tolerate 4 times the medium dose of glyphosate herbicide, which makes it easier for farmers to use herbicides in field management without affecting the growth of corn; it has high resistance to Fusarium graminearum stem rot and moderate resistance to gray leaf spot; it has excellent yield performance and can be planted in multiple regions.
[0034] RF125 carries the Bt insecticide gene, effectively killing lepidopteran pests such as corn borers and cotton bollworms, with significantly superior control effectiveness. This variety is also tolerant to glyphosate herbicides, allowing it to maintain normal growth while using the herbicide. Compared to conventional corn, RF125 genetically modified corn has significantly increased yields.
[0035] These two genetically modified corn varieties have undergone numerous safety assessments and testing and are therefore of significant value. Therefore, the present invention provides primer and probe combinations for detecting transgenic events contained in these two genetically modified corn varieties. By detecting these transgenic events, the present invention enables the detection of corn varieties. Furthermore, the primer and probe combinations provided by the present invention are also capable of detecting derivative lines of the genetically modified corn varieties DBN9936 and RF125.
[0036] The primer combinations provided are as follows: Table 1 List of amplification primers and probes
[0037] Example 2 This example provides a method for detecting DBN9936 and RF125 transgenic materials, including the following process: 1. Processing and nucleic acid extraction Take 0.007g of the seed powder to be tested or a 1cm leaf fragment. Add it to a release tube (Guanidine Hydrochloride, Tween-20, Tris-HCl, etc.). Gently shake the release tube to allow the sample to fully contact the release agent. Tap the bottom of the tube for 1 minute, gently shaking the tube during this time. Add 4 drops of the liquid from the release tube to a dilution tube (nuclease-free water) by tapping the bottom of the tube 30 times, gently shaking the release tube during this time. Discard the first drop from the release tube to remove air. Add the second drop to a reaction tube (dPCR Buffer, dNTP / dUTP Mix, MgCl2, Taq DNA Polymerase, Primer, Probe, etc.). Let it sit for 20 seconds until the lyophilized pellet is completely dissolved. Vigorously shake the reaction tube to allow the liquid to flow into the reaction chamber. Gently tap the reaction chamber 3-4 times. Vigorously shake the reaction tube again to remove bubbles. Then proceed with PCR amplification.
[0038] 2. PCR amplification (1) The amplification primers are shown in Table 1 in Example 1.
[0039] (2) Amplification system The amplification system is 40 μL, including: 0.4 μL of each detection primer pair; 0.2 μL of each probe; 20 μL of qPCR Mix; 1500 ng of genomic DNA; and the balance is ddH2O.
[0040] (3) The amplification procedure is as follows Table 2 Amplification procedures
[0041] (4) Interpretation of test results Table 3 Interpretation of test results
[0042] Example 3 This experimental example conducts a comparative experiment on the existing transgenic screening detection primers in the standard and the primer and probe combination provided in Example 1 of the present invention. The specific process is as follows: 1. Primers and probes in the standard (SEQ ID NO.10-18) ZSSIIb-F: CTCCCAATCCTTTGACATCTGC ZSSIIb-R:TCGATTTCTCTCTTGGTGACAGG Probe-ZSSIIb:AGCAAAGTCAGAGCGCTGCAATGCA DBN9936-F:AGCGTCAATTTGTTTACAC DBN9936-R:CAGGGGCAAGAAACATC Probe-DBN9936: TCTTGTGTGCCCATGAGCCTA Ruifeng 125-F: GTCGTTTCCCGCCTTCAGTT Ruifeng 125-R: GGTGCCTGGAAGACAAGTTCTA Probe-Ruifeng 125: AGCTCAACCACATCGCCCGACGC 2. Experimental Materials The genomic DNA extraction method for maize inbred line B73, maize transgenic varieties DBN9936 and Ruifeng 125 was the same as that in Example 1.
[0043] 3. PCR amplification The PCR amplification system was the same as that in Example 1, and the program used was a PCR amplification program that matched the primer pair.
[0044] 4. Results Analysis The results of the primers and probes in the standard are as follows Figure 1 As shown, from Figure 1 As can be seen from the results, none of the three groups of samples successfully detected the target GMO component. This indicates that the standard GMO screening primer and probe combination is not suitable for rapid PCR detection and cannot produce positive test results.
[0045] The detection results of the primer and probe combination in Example 1 are as follows Figure 2 As shown, from Figure 2 It can be seen that no positive results were detected in group A, DBN9936 transgenic material was detected in group B, Ruifeng 125 was detected in group C, and no false positive test results occurred.
[0046] 5. Sensitivity test: Different concentration samples of DBN9936 and RF125 corn materials (5ng / μL, 10ng / μL, 100ng / μL, 300ng / μL, 800ng / μL, 1200ng / μL, 1500ng / μL, 2500ng / μL) were used for detection.
[0047] The results are as follows Figure 3 、 Figure 4 As shown in the figure, it can be seen that the two corn material samples can detect 5ng / μL samples.
[0048] The method provided by this invention can accurately detect transgenic corn varieties DBN9936 and RF125. These two corn varieties are of great value in the field of transgenic corn breeding and can be used to develop corn varieties with similar disease or pest resistance. The method provided by this invention has important application value.
[0049] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.
Claims
1. A primer combination, characterized in that: include: ZSSIIb, DBN9936, and RF125; The ZSSIIb comprises: ZSSIIb-F1:CGGTGGATGCTAAGGCTGATG, ZSSIIb-R1:AAAGGGCCAGGTTCATTATCCTC; The DBN9936 includes: DBN9936-F2: TCAGGGGCAAGAAAACATCC, DBN9936-R: GTGTTATTAAGTTGTCTAAGCGTC; The RF125 includes: RF125-F1: AGGTCTCGGGAGAAGACGTCC, RF125-R1: TGTGTTATTAAGTTGTCTAAGCGTC.
2. A primer and probe combination, characterized in that, The primer and probe combination includes the primer combination according to claim 1, and also includes a probe combination; The probe combination includes: ZSSIIb-P1:AGCACTCGCCGCCGCATCTG, DBN9936-P: TGGGCACACAAGACACATGTGGTG, RF125-P1: CGCCCCGAGGCTATTTTGTGGTGTA.
3. The primer and probe combination according to claim 2, characterized in that The ZSSIIb-P1, DBN9936-P and RF125-P1 carry different fluorescent labels.
4. A kit, characterized in that The kit comprises the primer combination according to claim 1, or the primer and probe combination according to claim 2 or 3.
5. A method for simultaneously detecting DBN9936 and RF125 transgenic materials, characterized in that: include: The primer combination according to claim 1, or the primer and probe combination according to claim 2 or 3, or the kit according to claim 4 is used to detect the sample to be tested, and whether the sample to be tested contains the transformation event of DBN9936 and / or RF125 is determined according to the test results.
6. The method according to claim 5, characterized in that include: Extract the DNA of the test sample, perform PCR amplification using the primer and probe combination of claim 2, and determine whether the test sample contains the transformation event of DBN9936 and / or RF125 based on the amplification result.
7. The method according to claim 6, characterized in that The PCR amplification system includes: (0.3-0.8) μL of each detection primer pair, (0.1-0.5) μL of each probe, (15-25) μL of qPCR Mix, (1000-2000) ng of genomic DNA, and the balance is water.
8. The method according to claim 7, characterized in that The PCR amplification procedure includes: pre-denaturation at 93-97° C. for 20-60 s; denaturation at 93-97° C. for 2-5 s, and extension at 56-65° C. for 7-10 s, for 35-45 cycles.
9. The method according to claim 6, characterized in that The method of determining whether the sample to be tested contains the transformation event of DBN9936 and / or RF125 according to the amplification result includes: Based on the fluorescent labels carried by different probes, it is determined whether the sample to be tested contains the transformation event of DBN9936 or the transformation event of RF125 according to the different fluorescent signals detected in the amplification results.
10. The method according to claim 9, characterized in that If the transformation event of DBN9936 is contained, the sample to be tested is judged to be DBN9936 or a derivative thereof; if the transformation event of RF125 is contained, the sample to be tested is judged to be RF125 or a derivative thereof.