KASP molecular marker related to agronomic traits of wheat and application of KASP molecular marker

By developing KASP molecular markers for the wheat TaFLA62 gene, identifying and screening genotypes that reduce plant height and increase particle weight, the problems of easy lodging of stems and biomass due to the dwarf of wheat varieties are solved, and high yield and stable yield in different environments are achieved.

CN120505447APending Publication Date: 2025-08-19GANSU AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510730593.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-03
Publication Date
2025-08-19

AI Technical Summary

Technical Problem

The existing wheat varieties have lowered stem strength due to low plant height, and are prone to lodging, or excessive plant height leads to increased biomass and are prone to lodging, which affects yield and resistance to lodging.

Method used

A KASP molecular marker targeting the wheat TaFLA62 gene was developed. By detecting the SNP sites in the promoter region of the TaFLA62 gene, mutations from T to G were identified. It was used to identify wheat plant height and grain weight traits. Combined with fluorescence PCR amplification and signal analysis, genotypes that reduce plant height and increase grain weight were screened.

Benefits of technology

Effectively reduce plant height and improve grain yield. The plant height and ear length traits of wheat are significantly improved under different environments through genotype selection, and the wheat is able to resist lodging and yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120505447A_ABST
    Figure CN120505447A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of molecular markers, and particularly relates to a KASP molecular marker related to wheat agronomic traits and application of the KASP molecular marker. The nucleotide sequence of the KASP molecular marker is shown as SEQ ID NO.2, and single nucleotide T-G mutation occurs at the 101bp site. The molecular marker is a KASP molecular marker developed by aiming at an SNP (Single Nucleotide Polymorphism) site of a TaFLA62 promoter region of a bundled arabinogalactoprotein-like gene. The mutation from T to G at the 101bp of the KASP molecular marker can reduce the wheat plant height and / or increase the grain weight. The molecular marker provided by the invention can efficiently detect and track a mutation site of a TaFLA62 gene promoter region in a wheat variety / strain, and provides technical support for wheat molecular breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular markers, and in particular relates to a KASP molecular marker related to wheat agronomic traits and an application thereof. Background Art

[0002] Wheat (Triticum aestivum L.) is one of the world's three major staple crops. Wheat plant shape is a key factor influencing cultivation adaptability, harvesting efficiency, and yield. Plant height is a key determinant of wheat plant structure. The "Green Revolution" in wheat resulted in semi-dwarfing of plant height, enhanced lodging resistance, and increased planting density, significantly increasing wheat yield and resolving food security challenges. However, currently cultivated dwarf wheat varieties have an excessive number of tillers, resulting in reduced stem strength and increased lodging risk.

[0003] Wheat plant architecture is a key factor in determining its growth, development, and yield. The stem, a key structural component of wheat plant architecture, is primarily responsible for dry matter accumulation and transport, as well as lodging resistance. Plant height and sub-spike internode length are key agronomic traits determining the stem and are also key indicators for evaluating wheat lodging resistance, harvest index, and yield. Excessive plant height increases the biomass required for the plant, making it more susceptible to lodging and detrimental to yield stability. While short plant height enhances lodging resistance, it limits leaf photosynthesis, leading to reduced biomass and yield. Therefore, maintaining optimal plant height and architecture is crucial for ensuring high wheat yield and lodging resistance. The sub-spike internode, a key component of the stem, is the primary storage organ for water-soluble carbohydrates and is significantly positively correlated with plant height. It contributes significantly to plant height and inflorescence support, and also determines the extent of spikelet extension from the leaf sheath and the transport of photosynthetic assimilates to the spike. Therefore, sub-spike internode length is crucial for promoting grain filling and increasing yield in wheat, making it an ideal organ for studying source-sink relationships. In summary, suitable plant architecture is the primary goal of plant breeders in improving wheat varieties.

[0004] Based on this, it is crucial to genetically improve the plant traits of wheat and tap into new excellent genetic resources in order to breed new high-yield and stable-yield varieties. Summary of the Invention

[0005] In order to genetically improve the plant type traits of wheat, the present invention provides a KASP molecular marker related to the agronomic traits of wheat.

[0006] The technical solution adopted in the present invention is:

[0007] The present invention provides a KASP molecular marker related to wheat agronomic traits. The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO. 2, and a single nucleotide mutation from T to G occurs at the 101 bp site.

[0008] Preferably, the sequences of the primer set used to identify the KASP molecular marker are shown as SEQ ID NO.8 to SEQ ID NO.10.

[0009] The second aspect of the present invention provides an application of the KASP molecular marker, wherein the KASP molecular marker is used to identify agronomic traits of wheat.

[0010] Preferably, the wheat agronomic traits are plant height and / or grain weight.

[0011] Preferably, the method for identifying the agronomic traits of wheat comprises the following steps:

[0012] Extracting genomic DNA from the wheat sample to be tested;

[0013] Perform fluorescence PCR amplification using the primer set;

[0014] The genotype of KASP molecular marker sites was analyzed by fluorescence signals to determine the agronomic traits of wheat.

[0015] Preferably, the procedure of the fluorescent PCR amplification is:

[0016] Pre-denaturation: 94°C, 15 min; 10 cycles of gradient annealing: 94°C, 20 s, 61°C~55°C with a decrease of 0.6°C per cycle, for a total of 10 cycles; 35 cycles of isothermal amplification: 94°C for 20 s, 55°C for 45 s; final extension: 37°C, 1 min.

[0017] Preferably, the KASP molecular marker is used in wheat genetic breeding to reduce plant height and / or increase grain weight by selecting individuals with the GG genotype as parents.

[0018] A third aspect of the present invention provides a detection kit for wheat agronomic traits, the detection kit comprising the primer set and probe.

[0019] Preferably, the probe comprises a fluorescent group.

[0020] Preferably, the fluorescent groups are fluorescein amide and phosphoramidite.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] The present invention provides a KASP molecular marker associated with wheat agronomic traits and its application. The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO. 2. A single nucleotide mutation, from T to G, occurs at the 101st bp position. This KASP molecular marker was developed targeting a single nucleotide polymorphism (SNP) in the promoter region of the fasciculating arabinogalactan-like protein gene, TaFLA62. Genotyping and phenotypic association analysis of 242 wheat germplasm samples from different ecological regions in my country showed that the KASP-TaFLA62 marker can classify different wheat varieties into two genotypes: T / T and G / G. Combined with phenotypic data, association analysis of plant height and sub-ear node length across different genotypes revealed that under three different environmental conditions, wheat samples carrying the G / G genotype had significantly lower pH than those carrying the T / T genotype; and under two environmental conditions, wheat samples carrying the G / G genotype had significantly lower PL than those carrying the T / T genotype. Therefore, the wheat TaFLA62 gene may reduce plant height by affecting pH and PL. In addition, association analysis of grain yield-related traits of different genotype materials found that under four different environmental conditions, TKW and KL of wheat materials carrying the G / G genotype were significantly higher than those carrying the T / T genotype; under three environmental conditions, KW of wheat materials carrying the G / G genotype was significantly higher than that of materials carrying the T / T genotype. Therefore, the wheat TaFLA62 gene may increase yield by affecting TKW, KL, and KW. In the breeding process, the aggregation of favorable mutant alleles is consistent with the result of increased yield in the crop breeding process. Therefore, the molecular markers provided by the present invention can efficiently detect and track the TaFLA62 gene in wheat varieties / lines, providing technical support for wheat molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Figure 2: Haplotype analysis of two pleiotropic loci based on BLUE. A: Manhattan plot of PH under BLUE; B: Manhattan plot of PL under BLUE; C: LDblock analysis of two pleiotropic loci; D: PH statistics of AX-95112161; E: PL statistics of AX-95112161; F: PH statistics of AX-94493493; G: PL statistics of AX-94493493.

[0024] Figure 2 The mean PH and PL values of wheat germplasms with 0 to 2 superior alleles under different environments (A: mean PH; B: mean PL). According to Duncan's multiple range test, different letters indicate significant differences at P < 0.05.

[0025] Figure 3Figure 2 is the qRT-PCR analysis of the expression pattern of TaFLA62 in different organs; A is the expression profile of TaFLA62 during the wheat development cycle; B is the expression profile of TaFLA62 in developing wheat grains.

[0026] Figure 4 There are five SNP sites contained in the promoter and coding regions of the TaFLA62 gene, which are marked as TaFLA62-HapⅠ and TaFLA62-HapⅡ.

[0027] Figure 5 Figure 5 is the phenotypic data of two genotypes of wheat germplasm resources of the TaFLA62 gene in different ecological zones. Figure A is the genotype identification results of wheat germplasm resources from different wheat-growing areas in my country using the KASP marker primer set, where the scattered dots in the upper left box represent the HEX-type allele G, and the scattered dots in the lower right box represent the FAM-type allele T. Figures B to F are the associations of the TT and GG genotypes with PH, PL, TKW, KL, and KW of 243 wheat materials in the present invention under four environmental conditions, respectively.

[0028] Figure 6 is the spatiotemporal distribution of the TaFLA62 genotype in the present invention; A is the geographical distribution of TaFLA62 genotype varieties in China; B is the frequency of TaFLA62 allele variation in wheat breeding projects in China in different decades.

[0029] Figure 7 Phenotypic images and statistical analysis of tafla62, a wheat mutant with premature termination of the TaFLA62 gene. A shows the genetic structure of TaFLA62. The yellow marker indicates the mutation site, which leads to premature termination of the coding sequence. The red marker indicates the amino acid encoded by the mutation site: the arginine codon GGA mutates to the termination codon TGA. B shows a comparison of plant height between KN9204 and tafla62 (scale: 10 cm). C shows a comparison of internode length between KN9204 and tafla62 (scale: 5 cm). D shows a comparison of stem node length between KN9204 and tafla62. Statistics were performed using three biological replicates. Error bars represent standard deviations. ns indicates not significant; ** indicates P < 0.01. DETAILED DESCRIPTION

[0030] The present invention will be further described below by way of specific examples, but the scope of the present invention is not limited thereto. The details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but such modifications or replacements fall within the scope of protection of the present invention.

[0031] The inventive concept of the present invention is as follows:

[0032] With the development of molecular marker technology, the use of genome-wide association analysis to identify favorable allelic variations for major agronomic traits has become an important means to improve the efficiency of molecular breeding. Since its first successful application in the study of age-related macular degeneration in 2005, GWAS has become a core tool for analyzing the genetic basis of complex traits. GWAS reveals the impact of genetic variation on disease, agronomic traits, and evolutionary adaptation by detecting statistical associations between single nucleotide polymorphisms and phenotypes across the genome. Compared with traditional linkage analysis, association analysis has a complex genetic background and features a large number of detection sites and high resolution, making it suitable for genetic studies of different germplasms. With the iteration of high-throughput sequencing technology and the innovation of data analysis methods, GWAS has evolved from the initial single-site detection to a systematic research framework integrating multiple omics.

[0033] In order to make those skilled in the art better understand the technical solution of the present invention and be able to implement it, the present invention is further described below in conjunction with specific examples. In the description of the present invention, if not otherwise specified, the reagents used are all commercially available and the methods used are all conventional techniques in the art.

[0034] The abbreviations of the present invention are shown in Table 1.

[0035] Table 1 Abbreviations of the present invention

[0036]

[0037] Example 1

[0038] A KASP molecular marker related to wheat agronomic traits and its application are as follows:

[0039] 1. Obtaining candidate genes.

[0040] 1.1 Genome-wide association analysis

[0041] Mixed linear models were used to identify MTAs. Using the population structure Q and kinship K matrices effectively avoided false associations caused by population structure and controlled for false positives. GWAS analyses of PH and PL traits were performed using population structure Q and kinship K as covariates, along with polymorphic SNP markers. Markers were considered significantly associated with the target trait when P ≤ 0.001 (i.e., –log10(P) ≥ 3). Manhattan and quantile plots were created using the CMplot package in R v3.6.1. Data were visualized using Tbtools software.

[0042] CMplot package: https: / / cran.r-project.org / web / packag-es / CMplot / .

[0043] 1.2. Haplotype analysis.

[0044] Haplotype analysis of significantly associated SNP loci was performed using Haploview 4.2 software. Blocks were generated using Haploview software based on the confidence intervals described by Gabriel et al.

[0045] 1.3. Candidate gene prediction and functional annotation.

[0046] After identifying significant MTAs across different environments, we annotated genes within the 2-Mb physical region (1 Mb upstream and downstream) of the significant association site using the IWGSC RefSeq v1.1 Chinese Spring reference genome. We then used JBrowse within WheatOmics 1.0 to identify candidate genes that overlapped with the SNP flanking regions. Functional annotation of the candidate genes was performed using the UniProt website.

[0047] WheatOmics 1.0: http: / / 202.194.139.32 / .

[0048] UniProt website: https: / / www.uniprot.org / .

[0049] GWAS results revealed two pleiotropic loci (LOCs)—AX-95112161 and AX-94493493—that were significantly associated with PH and PL, located on chromosomes 5A and 5B, respectively. Manhattan plots of PH and PL under the Blue Line (BLUE) scheme, combined with linkage disequilibrium analysis, revealed that AX-95112161 and AX-94493493 were located in different LD blocks, suggesting that AX-95112161 and AX-94493493 are true, stable MTAs. To further determine the influence of favorable haplotypes / alleles on PH and PL at these pleiotropic loci, statistical analysis of the allelic effects of AX-95112161 and AX-94493493 was performed. The allelic effects for AX-95112161 and AX-94493493 were T / C and A / G, respectively. It was found that AX-95112161 was significantly associated with PH and PL, and AX-94493493 was associated with PH. The PH and PL of the lines with the superior alleles TT and AA were significantly lower than those with the inferior alleles CC and GG. The superior allele TT of AX-95112161 reduced PH and PL by 10.21cm and 3.95cm, respectively; the superior allele GG of AX-94493493 reduced PH by 3.94cm. Figure 1 .

[0050] The phenotypic averages of wheat germplasms carrying 0, 1 or 2 different numbers of superior alleles are as follows Figure 2The values are shown in the table, where 0 indicates the absence of the superior alleles TT and AA; 1 indicates the presence of one superior allele, TT or AA; and 2 indicates the presence of both TT and AA. Across different environments, the average pH value for plants with two superior alleles was 71.97 cm. In contrast, the average pH values for plants with one superior allele and two superior alleles were 79.13 cm and 83.54 cm, respectively. For PL, the average values for plants with two superior alleles were 30.05 cm, and for plants with one superior allele were 32.95 cm and 34.30 cm, respectively. Furthermore, the average pH values for plants with different superior alleles showed the same results as for PL, indicating that the phenotypic values of these plant height traits decrease with increasing numbers of dominant alleles.

[0051] Based on the linkage disequilibrium decay distance, genes within 1MB upstream and downstream of the SNP were searched, and 43 candidate genes were initially identified. Subsequently, the 43 candidate genes were functionally annotated based on the Chinese Spring reference genome, and their expression levels were analyzed in combination with previously published transcriptome data. After filtering out unannotated genes and genes with a TPM < 2, 16 key candidate genes associated with PH and PL were finally obtained. To further screen for potential genes controlling PH, the present invention performed expression profiling analysis on the 16 candidate genes and found that TraesCS5B02G279900, TraesCS5A02G211700, TraesCS5B02G279200, and TraesCS5B02G280000 were expressed at relatively high levels in the stem, encoding chloroplast envelope quinone oxidoreductase, adrenochrome protein, E3 ubiquitin ligase BIG brother, and bundled arabinogalactan protein-like protein, respectively. Homologous sequence alignment revealed homologous genes in Arabidopsis and rice, and close connections were observed between wheat, Arabidopsis, and rice. Functional annotation revealed that the homologous genes of TraesCS5B02G280000 in both Arabidopsis and rice encode a bundle-forming arabinogalactan-like protein, which is involved in stem secondary cell wall synthesis, pollen development, and seed shrinkage. Therefore, TraesCS5B02G280000 is predicted to be a key gene influencing wheat plant height. This gene, encoding a bundle-forming arabinogalactan-like protein, was identified at the genome-wide level and named TaFLA62.

[0052] 2. qRT-PCR analysis of TaFLA62 gene.

[0053] The samples were collected from roots, stems, leaves, ears at the booting stage of wheat and grains at 5, 10, 15, 20, 25 and 30 days after anthesis. Total RNA was extracted from the collected samples using a plant tissue RNA rapid extraction kit, and RNA concentration was measured using an ultramicrophotometer. First-strand cDNA was synthesized using the FastKing gDNA isolation method. qRT-PCR analysis was performed using FastRealqPCRPreMix to examine the relative expression of the TaFLA62 gene in different tissues. Wheat tissue developmental expression analysis was performed using wheat TaGADPH as an internal reference gene. The gene ID for GADPH is Traescs6B01G243700.1.

[0054] The PCR reaction volume was 20 μL, consisting of 10 μL of FastReal qPCR PreMix, 0.6 μL each of forward and reverse primers, 2 μL of cDNA, and 6.8 μL of ddH₂O. PCR conditions were 95°C for 2 min, 95°C for 5 s, 60°C for 10 s, and 72°C for 15 s, with fluorescence collection, for 40 cycles.

[0055] The primers used for qRT-PCR are shown in Table 2. -ΔΔC(t) Methods The relative expression level of TaFLA62 gene was calculated. All data were obtained from three biological replicates.

[0056] Table 2 qRT-PCR primer information

[0057] Gene name Sequence information Sequence number TaFLA62 Forward primer F, 5'-3': GTACTGCAAGAGCTTCGCG SEQ ID NO.4 TaFLA62 Reverse primer R, 5'-3': TGGCCGTCAGGTTCTTGTAC SEQ ID NO.5 TaGADPH Forward primer F, 5'-3': CCTTCCGTGTTCCCACTGTTG SEQ ID NO.6 TaGADPH Reverse primer R, 5'-3': ATGCCCTTGAGGTTTCCCTC SEQ ID NO.7

[0058] The expression levels of the genes in roots, stems, leaves, and ears at the booting stage and in grains at 5, 10, 15, 20, 25, and 30 days after anthesis were determined by qRT-PCR. Figure 3 qRT-PCR results showed that TaFLA62 was highly expressed in wheat stems, ears, and grains, suggesting a potential role in spikelet development. Data are presented as mean ± SD, n = 3. a and b indicate significant differences (P < 0.05).

[0059] 2. Method for obtaining molecular markers of TaFLA62, a gene related to wheat plant height and grain weight.

[0060] The wheat plant height and grain weight related gene TaFLA62 provided by the present invention contains a conserved catalytic core ubiquitin binding domain FAS. Sequence polymorphism analysis of TaFLA62 was performed based on 1769 wheat resequencing data from the Wheat Genome Variation Joint Database to search for SNP sites on the mRNA and promoter of TaFLA62. It was found that a total of 14 SNP sites were detected in the coding region and promoter region of the TaFLA62 gene. A KASP marker was developed for the SNP at -1800bp in the promoter region, and genotyping was performed on a natural population consisting of 242 wheat varieties / lines, which can be divided into two different genotypes, namely TT and GG, see Figure 4 .

[0061] The TT-type nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the GG-type nucleotide sequence is shown in SEQ ID NO.2.

[0062] SEQ ID NO.1

[0063] ATCTCATAATTACCATGGACAAAAAAAAATCCATGCTACATACAATGAAGCTACCATGGGCCTAATTAACTATTTTGCTGTGAAAAATAATAAAATTTTCCACGGCCTTAAAAAAATGCCATGATCTTTAATAATATAAATGCCATGCTCTTATTAAAACTATTGCCATGTTGTTAATAAATAAAAAGTGACATGCTCT.

[0064] SEQ ID NO.2

[0065] ATCTCATAATTACCATGGACAAAAAAAAATCCATGCTACATACAATGAAGCTACCATGGGCCTAATTAACTATTTTGCTGTGAAAAATAATAAAATTTGCCACGGCCTTAAAAAAATGCCATGATCTTTAATAATATAAATGCCATGCTCTTATTAAAACTATTGCCATGTTGTTAATAAATAAAAAGTGACATGCTCT.

[0066] Wheat Genomic Variation Union Database: http: / / wheat.cau.edu.cn / WheatUnion / .

[0067] The wheat plant height and grain weight-related SNP site provided by the present invention is located at -1800bp of the TaFLA62 promoter. The SNP at the -1800bp position of the TaFLA62 promoter is converted into a homologous allele-specific PCR molecular marker, named TaFLA62-KASP.

[0068] Amplification primers were designed for the KASP molecular marker, including two forward primers and one reverse primer, and the primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. The specific primers and their sequences are shown in Table 3.

[0069] Table 3 Primers used in the KASP molecular marker of the present invention 3. Application of TaFLA62-KASP molecular marker in identifying wheat genotypes.

[0070] (1) Wheat leaves at the three-leaf stage were collected and wheat genomic DNA was extracted using the CTAB method. DNA concentration and quality were determined using a NanoDrop 2000 and 1% agarose gel electrophoresis. An A260 / A280 ratio of approximately 1.8 indicated acceptable sample quality.

[0071] (2) KASP marker amplification and detection.

[0072] A two-step PCR reaction system was used: DNA denaturation at a higher temperature, followed by annealing and extension at the same lower temperature. The PCR reaction volume was 4 μL and contained 2 μL of 2×KASP Mastermix, 1 μL of 4×SNP Primer Mix, 1 μL of DNA, and 4 μL of ddH2O. The 4×SNP Primer Mix contained the sequences shown in SEQ ID NOs. 8 to 10.

[0073] The PCR amplification system was as follows: pre-denaturation at 94°C for 15 min; annealing at 94°C for 20 s, 61°C to 55°C with a decrease of 0.6°C per cycle, for a total of 10 cycles; 94°C for 20 s, 55°C for 45 s, for a total of 35 cycles; and final extension at 37°C for 1 min.

[0074] After the PCR amplification cycle, fluorescence readings were taken using an OMEGA SNP typing instrument. In the present invention, SNP detection was performed using a TaqMan probe with a fluorescent group. The TaqMan probe carries fluorescein amide (FAM) and VIC phosphoramidite to distinguish between two isogenic loci. The FAM fluorescence intensity, located near the y-axis, corresponds to the G / G genotype in the present invention; the VIC fluorescence intensity, located near the x-axis, corresponds to the T / T genotype in the present invention. The passive reference dye, carboxy-X-rhodamine, was used to correct for signal differences between wells due to reaction volume errors.

[0075] The excitation light of FAM fluorescein amide is 485 nm and the emission light is 520 nm; the excitation light of VIC phosphoramidite is 535 nm and the emission light is 556 nm; the excitation light of carboxy-X-rhodamine is 575 nm and the emission light is 610 nm.

[0076] (3)Data analysis.

[0077] Data were analyzed using the genotype caller software KlusterCaller. VIC and FAM data were plotted on the x-axis and y-axis, respectively. VIC and FAM values for each well were corrected using the values of a reference dye for that specific well, and the fluorescence values were normalized to obtain relative fluorescence values for VIC and FAM for each PCR well. Samples were clustered based on relative fluorescence values, and genotypes were further determined based on sample clusters and fluorescence patterns.

[0078] 4. Application of molecular marker TaFLA62-KASP in wheat genetic breeding. Specific research is as follows:

[0079] (1) 242 wheat germplasm resources from different ecological zones in my country were used as shown in Table 4. The resources were planted at: Tongwei Agricultural Station (35°11N 105°19E, 1750m above sea level); Zhuanglang Agricultural Station (35°21N 105°58E, 2110m above sea level); and Tianshui Agricultural Station (34°34N 105°53E, 1550m above sea level). The four planting environments are as follows: E1: Tongwei, Gansu, 2019-2020; E2 and E3: Zhuanglang, Gansu, 2022-2024; and E4: Tianshui, Gansu, 2023-2024. All wheat resources were sown at the end of September and harvested in early July of the following year. The field experiment was a randomized block experiment with three replicates. Each resource was planted in three rows with a row spacing of 20 cm and a row length of 1 m. 30 seeds were planted in each row. The seeds were tested after they matured, and three biological replicates were performed for each line.

[0080] (2) When wheat reached maturity, three plants were randomly selected from each germplasm material and the plant height (PH) and the internode length (PL) below the spike were measured using a tape measure. PH is the length from the spike tip (excluding the awn) to the base of the stem, and PL is the distance from the base of the spike to the next internode on the stem. The spikes were then naturally air-dried and threshed. 200 grains were randomly selected and the thousand-grain weight, grain length, and grain width were measured using the SC-G image analysis system. The best linear unbiased estimates of the multi-year, multi-point pH and PL data for wheat were calculated using the "lme4" package in the R language. All measurements were performed with three biological replicates. The specific data are shown in Table 4.

[0081] The SC-G image analysis system was completed by Hangzhou Wanshen Testing Technology Co., Ltd.

[0082] Best linear unbiased estimate: Best linear unbiased estimate, referred to as BLUE.

[0083] (3) Using the molecular markers and methods provided above, the significance between the phenotypes of the two genotypes of wheat germplasm resources was analyzed. The typing results are as follows Figure 5 The single-factor variance analysis method of SPSS22.0 software was used to analyze whether there were significant differences in PH, PL, TKW, KL and KW of wheat with different genotypes. The specific data are shown in Table 4 and Figure 5 .

[0084] Table 4 Plant height and grain phenotype data of two genotypes of wheat germplasm resources with TaFLA62 gene in different ecological zones

[0085]

[0086] Association analysis revealed that under four environmental conditions, both genotypes of the TaFLA62 gene were significantly associated with TKW and KL. Under three environmental conditions, both genotypes were significantly or extremely significantly associated with PH and KW. Under two environmental conditions, both genotypes were significantly associated with PL. Association analysis of plant height and sub-ear node length across different genotypes revealed that PH was significantly lower in GG than in TT under three environmental conditions (P < 0.05), and PL was significantly lower in GG than in TT under two environmental conditions (P < 0.05). Association analysis of grain yield-related traits across different genotypes revealed that TKW and KL were significantly higher in GG than in TT under four environmental conditions (P < 0.05), and KW was significantly higher in GG than in TT under three environmental conditions (P < 0.05). These results indicate that genotype GG may be a superior allele variant for reducing plant height and improving grain traits, and should be given priority in future breeding.

[0087] (4) To investigate whether the superior genotype GG is actively selected in wheat breeding, the geographical distribution of the two genotypes of the TaFLA62 gene in China was evaluated using 501 wheat varieties from 14 provinces and autonomous regions in China. Figure 6 And Table 5. Among them, if the total number of varieties containing two genotypes in each province is greater than or equal to 5, they can be counted. If the total number is less than 5, the province will not be counted. The ratio of the two genotype materials in different provinces is calculated.

[0088] Table 5 Geographical distribution of wheat germplasm resources with different genotypes of TaFLA62 gene

[0089] area TT quantity GG quantity Beijing 8 28 Gansu 23 51 Hebei 13 16 Henan 12 43 Jiangsu 3 10 Ningxia 5 1 Qinghai 4 4 Shandong 14 36 Shanxi 11 31 Shaanxi 17 13 Sichuan 18 6 Tibet 12 98 Xinjiang 2 11 Yunnan 3 8

[0090] The distribution frequencies of genotype GG in 14 provinces and autonomous regions in my country were 77.8%, 68.9%, 55.2%, 78.2%, 76.9%, 16.7%, 50.0%, 72.0%, 73.8%, 43.3%, 25.0%, 89.1%, 84.6%, and 72.7%, respectively. These results indicate that genotype GG has been widely selected in major wheat-producing areas in my country.

[0091] To further determine whether the genotype GG has been positively selected during wheat breeding in China, the allelic variation of the TaFLA62 gene during historical wheat breeding was analyzed using 253 different wheat varieties. Figure 6and Table 6. The years of all materials were divided into pre-1960, 1960s-1970s, 1980s-1990s and post-2000 for statistical analysis, and the distribution frequencies of the two genotype materials in the four time periods were calculated.

[0092] Table 6 Allele variation frequency of TaFLA62 in Chinese wheat breeding programs in different eras

[0093] The results showed that the proportion of genotype GG has also increased year by year in the process of wheat breeding in my country. In summary, the spatiotemporal distribution results show that genotype GG has been positively selected in wheat breeding and plays an important role in improving wheat plant height and grain-related traits.

[0094] 5. Application of the wheat plant height and grain weight-related gene TaFLA62, as follows:

[0095] (1) Obtaining and cultivating the wheat TaFLA62 gene mutant tafla62.

[0096] The CDS sequence of wheat TaFLA62 gene is shown in SEQ ID NO.3 in the sequence listing.

[0097] SEQ ID NO.3:

[0098]

[0099] The tafla62 mutant has a nonsense mutation at base 202 of the first exon, which results in a CT mutation. The arginine codon GGA is mutated to the stop codon TGA, resulting in premature termination of the coding sequence. Forty-five uniformly sized mutant and wild-type seeds were disinfected with 10% sodium hypochlorite by volume for 30 minutes, rinsed five times with sterile water, placed in sterile Petri dishes with appropriate amounts of ddH2O, and cultured in a tissue culture room with a 16 / 8h photoperiod, 25°C / 23°C, and 60% humidity. After germination, the seeds were transferred to pots containing nutrient soil and placed in a vernalization incubator with a 16 / 8h photoperiod and 4°C temperature. After 20 days of vernalization, they were transplanted into larger pots. Two wild-type and two mutant plants were grown in each pot in a tissue culture room with a 16 / 8h photoperiod, 25°C / 23°C, and 60% humidity.

[0100] (2) Phenotypic analysis of tafla62 mutants.

[0101] On the day of flowering, three plants of each material were randomly sampled and photographed for plant height and internode length. pH and PL were measured and statistically analyzed using a tape measure. Phenotypic values were the average of 10 replicates.

[0102] like Figure 7 As shown, the pH and PL of the tafla62 mutant were significantly lower than those of the control Kenong 9204. Statistical analysis showed that the pH and PL of the tafla62 mutant were significantly lower than those of the control Kenong 9204.

[0103] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0104] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. A KASP molecular marker related to agronomic traits of wheat, characterized in that: The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO. 2, and a single nucleotide mutation from T to G occurs at the 101 bp site.

2. The KASP molecular marker according to claim 1, wherein The sequences of the primer set used to identify the KASP molecular marker are shown in SEQ ID NO.8 to SEQ ID NO.

10.

3. The use of the KASP molecular marker according to any one of claims 1 or 2, characterized in that: The KASP molecular marker is used to identify agronomic traits of wheat.

4. The use according to claim 3, characterized in that The agronomic traits of wheat are plant height and / or grain weight.

5. The use according to claim 3, characterized in that The method for identifying the agronomic traits of wheat comprises the following steps: Extracting genomic DNA from the wheat sample to be tested; Perform fluorescence PCR amplification using the primer set; The genotype of KASP molecular marker sites was analyzed by fluorescence signals to determine the agronomic traits of wheat.

6. The use according to claim 5, characterized in that The procedure of the fluorescent PCR amplification is: Pre-denaturation: 94°C, 15 min; 10 cycles of gradient annealing: 94°C, 20s, 61°C to 55°C, decreasing by 0.6°C per cycle, for a total of 10 cycles; 35 cycles of isothermal amplification: 94°C for 20 s, 55°C for 45 s; Final extension: 37°C, 1 min.

7. The use of KASP molecular marker according to claim 1, characterized in that: The KASP molecular marker is used in wheat genetic breeding to reduce plant height and / or increase grain weight by selecting individuals with a GG genotype as parents.

8. A detection kit for wheat agronomic traits, characterized in that: The detection kit comprises the primer set and probe described in claim 2.

9. The detection kit according to claim 8, wherein The probe comprises a fluorescent group.

10. The detection kit according to claim 9, wherein The fluorescent groups are fluorescein amide and phosphoramidite.