A Zn-Mn bimetallic ZIF material, a preparation method and application thereof

By preparing Zn-Mn bimetallic ZIF materials, the problems of targeting, stability and release control of RNA delivery vectors have been solved, achieving efficient RNA loading and controllable release, activating immune responses, and making them suitable for the prevention and treatment of respiratory viral infections.

CN120518879BActive Publication Date: 2025-12-12CAPITAL INST OF PEDIATRICS
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510750029.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-06
Publication Date
2025-12-12
Estimated Expiration
2045-06-06

AI Technical Summary

Technical Problem

Existing RNA delivery carriers, such as lipid nanoparticles (LNPs), have limitations in terms of targeting, immunogenicity, stability, and manufacturing process complexity. Traditional single-metal ZIF materials have limited drug loading efficiency and release kinetics in RNA delivery, which restricts the clinical application of RNA molecules.

Method used

A Zn-Mn bimetallic ZIF material was developed, which forms a nanocrystalline spherical structure through self-assembly and is bound to a 2-methylimidazole ligand. It has a high RNA loading capacity and controllable release characteristics, and is suitable for drug delivery by intraperitoneal injection, nasal drops, lung delivery and other methods to activate natural and mucosal immunity.

Benefits of technology

It achieves non-targeted delivery of RNA, improves cell membrane penetration and controllable RNA release, and has a significant immune activation effect. It is suitable for the prevention and treatment of respiratory viral infections and shows broad application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120518879B_ABST
    Figure CN120518879B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of Zn-Mn bimetallic ZIF material for RNA delivery and its preparation method and application.The Zn-Mn bimetallic ZIF material of the present application has natural immunity and mucosal immunity activation ability, can play the role of preventing and / or treating respiratory viral infection by, for example, the way of nose drop immunization, and can efficiently load RNA, as RNA carrier has excellent cell membrane penetration performance and controllable RNA release characteristics, RNA molecules can be realized by different dosing methods such as intraperitoneal injection, nose drop, lung delivery, non-targeted delivery.Therefore, the Zn-Mn bimetallic ZIF material of the present application has wide application prospect in the field of respiratory viral prevention and treatment, gene therapy drug and vaccine development.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of RNA delivery carriers, in particular to a Zn-Mn bimetallic ZIF material and a preparation method and application thereof. BACKGROUND

[0002] With the rapid development of biotechnology and gene therapy field, RNA molecules such as messenger RNA (mRNA) and small interfering RNA (siRNA) have shown great potential in disease treatment, vaccine development and other biomedical applications. RNA therapy can achieve precise treatment by regulating gene expression, and has made breakthrough progress in the fields of tumor treatment, genetic diseases, infectious diseases and the like. However, the inherent structural fragility of RNA molecules (such as easy to be degraded by ribonuclease), the difficulty of cell membrane penetration caused by negative charge, the rapid clearance in vivo and the like seriously restrict the clinical application effect. Studies have shown that the half-life of unprotected RNA molecules in physiological environment is usually less than 1 hour, which greatly limits the therapeutic effect. Therefore, developing efficient, safe and stable RNA delivery system has become a key scientific problem to be solved in the current gene therapy field.

[0003] At present, lipid nanoparticles (LNPs) are one of the most mature RNA delivery carriers, however, LNPs still face many challenges in practical application: (1) lack of targeting specificity, it is difficult to achieve precise delivery; (2) immunogenicity: long-term use may cause immune response, leading to decreased treatment effect; (3) stability problem: easy to aggregate or degrade during storage and transportation, affecting batch consistency; (4) complex production process: quality control is difficult during large-scale production, and the cost is high. These limitations have prompted researchers to continuously explore new delivery systems.

[0004] In recent years, metal-organic framework materials (MOFs) have attracted widespread attention in the field of drug delivery due to their unique structural characteristics. MOFs are self-assembled by metal ions or metal clusters and organic ligands through coordination bonds, and have the characteristics of high specific surface area, high porosity, adjustable pore size, good chemical stability and easy functional modification, which enable them to efficiently load drug molecules and achieve targeted delivery and controlled release through surface modification.

[0005] Zeolitic imidazolate frameworks (ZIFs) as an important branch of the MOFs family have attracted much attention due to their unique advantages: (1) mild synthesis conditions: usually prepared at room temperature or near physiological conditions; (2) pH responsiveness: can be quickly degraded in an acidic environment, which is conducive to realizing endosome escape; (3) biocompatibility: the degradation products are mainly metal ions and organic ligands, which have low toxicity; (4) structural designability: the performance can be optimized by adjusting the metal nodes and organic ligands. However, the traditional single-metal ZIF materials still have problems in RNA delivery, such as limited drug loading efficiency and difficult accurate control of release kinetics, and at present, there is an urgent need for a new ZIF material that can efficiently load RNA molecules and controllably release RNA. SUMMARY

[0006] In view of the above problems or needs in the prior art, the purpose of the present application is to provide a Zn-Mn bimetallic ZIF material, a preparation method and application thereof.

[0007] The Zn-Mn bimetallic ZIF material not only has natural immune and mucosal immune activation ability, can play a role in preventing and / or treating respiratory viral infection through, for example, nasal immunization, but also can efficiently load RNA, has good cell membrane penetration ability and controllable RNA release characteristics as an RNA carrier, and can be realized by different administration methods such as intraperitoneal injection, nasal instillation, and pulmonary delivery, to achieve non-targeted delivery.

[0008] In order to achieve the above purpose, the present application provides the following technical solutions.

[0009] In a first aspect, the present application provides a Zn-Mn bimetallic ZIF material, which comprises zinc ions, manganese ions and 2-methylimidazole ligands, and the chemical formula of the Zn-Mn bimetallic ZIF material is Zn 0.836 Mn 0.164 (dmIm)2, wherein dmIm represents 2-methylimidazole;

[0010] And the Zn-Mn bimetallic ZIF material is a spherical structure self-assembled by nanocrystalline grains, with imidazole as a bridging unit in the framework, each nanocrystalline grain is composed of a polyhedral cage structure combined by 6 four-rings and 8 six-rings, and in its molecular structure, each metal atom is connected with 4 2-methylimidazoles to form a tetrahedral configuration, wherein the atomic ratio of Zn:Mn is 5.1:1.

[0011] In a feasible embodiment, the particle size of the Zn-Mn bimetallic ZIF material ranges from 119.9 nm to 214.9 nm, preferably 167.4 nm;

[0012] In feasible embodiments, the ZETA potential of the Zn-Mn bimetallic ZIF material is 11.3-13.8, preferably 12.5.

[0013] In a second aspect, the present application provides a preparation method of a Zn-Mn bimetallic ZIF material, the preparation method comprising: reacting a solution comprising a zinc ion source, a manganese ion source and 2-methylimidazole under oscillation conditions, to obtain the Zn-Mn bimetallic ZIF material.

[0014] In feasible embodiments, the zinc ion source is one or more of soluble zinc salts selected from ZnSO4, Zn(NO3)2and ZnCl2, preferably ZnSO4.

[0015] In feasible embodiments, the manganese ion source is one or more of soluble manganese salts selected from Mn(NO3)2, MnSO4and MnCl2, preferably Mn(NO3)2.

[0016] In feasible embodiments, the solution is an aqueous solution.

[0017] Preferably, in the aqueous solution, the concentration of the zinc ion source is 15-25 mM, preferably 20 mM.

[0018] Preferably, in the aqueous solution, the concentration of the manganese ion source is 15-25 mM, preferably 20 mM.

[0019] Preferably, in the aqueous solution, the concentration of the imidazole ligand is 60-100 mM, preferably 80 mM.

[0020] Preferably, in the aqueous solution, the molar ratio of zinc ion, manganese ion and imidazole ligand, calculated based on zinc ion, manganese ion and imidazole group, is (0.8-1.2):(0.8-1.2):(3-5), preferably 1:1:4.

[0021] In feasible embodiments, the temperature of the reaction is 20-30℃, preferably 23-28℃, more preferably 25-26℃.

[0022] In feasible embodiments, the time of the reaction is 5-10 min, preferably 5-8 min, more preferably 5 min.

[0023] In a preferred embodiment, the preparation method of the Zn-Mn bimetallic ZIF material comprises: reacting ZnSO4, Mn(NO3)2 and 2-methylimidazole in an aqueous solution under oscillation to obtain the Zn-Mn bimetallic ZIF material; wherein, in the aqueous solution, the molar ratio of zinc ions, manganese ions and imidazole ligands is (0.8-1.2):(0.8-1.2):(3-5), preferably 1:1:4, based on zinc ions, manganese ions and imidazole groups. As a preferred, the preparation sequence of the reaction system is: first adding ZnSO4, then adding Mn(NO3)2, and finally adding 2-methylimidazole.

[0024] In a third aspect, the present application provides a Zn-Mn bimetallic ZIF material prepared by the preparation method of the second aspect.

[0025] In a fourth aspect, the present application provides a use of the Zn-Mn bimetallic ZIF material of the first aspect or the Zn-Mn bimetallic ZIF material of the third aspect as an RNA delivery carrier in the preparation of an RNA-based vaccine or drug.

[0026] In a fifth aspect, the present application provides an RNA delivery system based on a ZIF material, which comprises:

[0027] (I) the Zn-Mn bimetallic ZIF material of the first aspect or the Zn-Mn bimetallic ZIF material of the third aspect as a carrier, and

[0028] (II) an RNA molecule loaded on the carrier.

[0029] In a sixth aspect, the present application provides a preparation method of the RNA delivery system of the fifth aspect, which comprises:

[0030] mixing and reacting the Zn-Mn bimetallic ZIF material of the first aspect or the Zn-Mn bimetallic ZIF material of the third aspect with the RNA, so that the RNA is adsorbed on the Zn-Mn bimetallic ZIF material to obtain the RNA delivery system.

[0031] Preferably, the mass ratio of the Zn-Mn bimetallic ZIF material to the RNA is (100000-1000):1, more preferably (20000-1000):1.

[0032] Preferably, the adsorption reaction is carried out at 20-30℃, preferably 23-28℃, more preferably 25-26℃.

[0033] In a seventh aspect, the present application provides a preparation method of an RNA delivery system, which comprises:

[0034] (1) mixing a zinc ion source aqueous solution with a manganese ion source aqueous solution to obtain a mixed solution I;

[0035] (2) adding RNA to the mixed solution I and mixing to obtain a mixed solution II;

[0036] (3) adding 2-methylimidazole to the mixed solution II, mixing, and reacting at 20-30℃ under oscillation for 5-10 min; then, centrifuging, discarding the supernatant, resuspending with nuclease-free water, and obtaining the product.

[0037] In an implementable embodiment, the zinc ion source is one or more of soluble zinc salts selected from ZnSO4, Zn(NO3)2, and ZnCl2, preferably ZnSO4;

[0038] In an implementable embodiment, the manganese ion source is one or more of soluble manganese salts selected from Mn(NO3)2, MnSO4, and MnCl2, preferably Mn(NO3)2;

[0039] Preferably, in step (1), the molar concentration of the zinc ion source aqueous solution is 15-25 mM, preferably 20 mM, and the molar concentration of the manganese ion source aqueous solution is 15-25 mM, preferably 20 mM;

[0040] Preferably, in step (2), 5-10 μg of RNA is added to the mixed solution I;

[0041] Preferably, in step (3), 60-100 mM, preferably 80 mM, of the imidazole ligand is added to the mixed solution II.

[0042] Preferably, in step (3), the reaction is performed at room temperature (i.e., 21-25℃) for 5 min; and the centrifugation is at 1500-2500 g for 5-15 min, preferably at 2000 g for 5-10 min.

[0043] Preferably, in the preparation of the RNA delivery system, the mass ratio of the formed Zn-Mn bimetallic ZIF material to the loaded RNA is (100000-1000):1, more preferably (20000-1000):1.

[0044] In an eighth aspect, the present application provides use of the Zn-Mn bimetallic ZIF material according to the first aspect above or the Zn-Mn bimetallic ZIF material according to the third aspect above in the preparation of a medicament for:

[0045] (1) improving immunity to prevent respiratory virus infection;

[0046] (2) treating respiratory virus infection.

[0047] In an implementable embodiment, the improved immunity is achieved by a method selected from the group consisting of:

[0048] (1) activating the natural immune response;

[0049] (2) enhancing the cellular immunity;

[0050] (3) activating the mucosal immune response.

[0051] In an implementable embodiment, the respiratory viral infection is an influenza virus infection.

[0052] In a ninth aspect, the present application provides a method for preventing and / or treating a respiratory viral infection, the method comprising: administering to a subject in need thereof a prophylactically and / or therapeutically effective amount of the Zn-Mn bimetallic ZIF material according to the first aspect above or the Zn-Mn bimetallic ZIF material according to the third aspect above.

[0053] In an implementable embodiment, the respiratory viral infection is an influenza virus infection.

[0054] The "prophylactically and / or therapeutically effective amount" can vary depending on the subject of administration, the organ of the subject, the symptoms, the method of administration, etc., and can be determined according to the judgment of a doctor, taking into account the type of dosage form, the method of administration, the age and weight of the patient, the symptoms of the patient, etc.

[0055] Beneficial effects

[0056] The present application successfully develops a novel bimetallic ZIF material by innovatively optimizing and designing the structure and surface function of the ZIF skeleton. The novel bimetallic ZIF material not only has the ability to activate the natural immune response and the mucosal immune response, but also can play a role in preventing and / or treating respiratory viral infections through, for example, nasal immunization. In addition, the novel bimetallic ZIF material exhibits significant technical advantages and application value in the field of RNA delivery. The Zn-Mn bimetallic ZIF material of the present application can efficiently load RNA, and as an RNA carrier, it has excellent cell membrane penetration performance and controllable RNA release characteristics. The Zn-Mn bimetallic ZIF material can achieve non-targeted delivery of RNA molecules through different administration methods such as intraperitoneal injection, nasal drops, and pulmonary delivery.

[0057] Therefore, the Zn-Mn bimetallic ZIF material of the present application has broad application prospects in the fields of respiratory viral prevention and treatment, gene therapy drugs, and vaccine development. BRIEF DESCRIPTION OF DRAWINGS

[0058] One or more embodiments are illustrated by way of example in the figures that form a part of this disclosure and which do not limit the scope of embodiments in any way. The drawings are illustrative and for use as an aid in understanding embodiments. As such, the drawings provided are not a limitation on the scope of embodiments.

[0059] Figure 1 The appearance of the precipitate formed in different reaction systems in Example 1 is shown.

[0060] Figure 2 The results of characterizing the structural features and element ratios of Zn / Mn-ZIF by electron microscopy are shown, where A is a transmission electron microscopy result, B is a scanning electron microscopy result, and C is an energy spectrum analysis result.

[0061] Figure 3 The characteristic spectrum of element composition analysis of Zn / Mn-ZIF material is shown, where A is the overall characteristic spectrum, B is the Zn element peak spectrum, and C is the Mn element peak spectrum.

[0062] Figure 4 The results of characterizing the size and potential characteristics of Zn / Mn-ZIF nanoparticles are shown, where A is a normal distribution graph of nanoparticle size, and B is a Zeta potential measurement result.

[0063] Figure 5 The spectrum of chemical bond characteristics and crystal structure characteristics of Zn / Mn-ZIF material is shown, where A is a Fourier infrared spectrum, and B is an X-ray crystal diffraction spectrum.

[0064] Figure 6 The results of specific surface area and pore size determination of Zn / Mn-ZIF material are shown, where A is an N2 adsorption-desorption isotherm graph, B is a specific surface area determination result graph, and C is a pore volume determination result graph.

[0065] Figure 7 The difference heat map of cytokine expression in the serum of mice inoculated with Zn / Mn-ZIF material in different administration modes, as well as the difference heat map of cytokine expression in the lung tissue and nasal cavity tissue grinding liquid after nasal inoculation, is shown.

[0066] Figure 8 The results of mucosal immune activation level determination of mice inoculated with Zn / Mn-ZIF material by nasal administration are shown, where A is the expression of IgM, mIgA, and sIgA antibodies in lung tissue, and B is the expression of IgM, mIgA, and sIgA antibodies in nasal mucosa.

[0067] Figure 9Inhibition of influenza virus in mice inoculated with Zn / Mn-ZIF materials by nose drop administration. A, difference in influenza virus RNA replication ability in lung tissue; B, difference in influenza virus RNA replication ability in nasal cavity.

[0068] Figure 10 Schematic diagram showing that Zn / Mn-ZIF materials adsorb Cy5-labeled siRNA in different ways.

[0069] Figure 11 Evaluation results of RNA packaging efficiency of Zn / Mn-ZIF materials adsorbing EGFP mRNA in different ways.

[0070] Figure 12 Evaluation results of expression of EGFP mRNA in cells after transfection of Vero cells with Zn / Mn-ZIF loaded with EGFP mRNA.

[0071] Figure 13 Results of in vivo imaging of mice after administration of Zn / Mn-ZIF loaded with Cy5-labeled siRNA to mice by different administration routes. DETAILED DESCRIPTION

[0072] Unless otherwise defined, all terms used in disclosing the application, including technical and scientific terms, have the meaning as commonly understood by one of ordinary skill in the art to which this application belongs. By means of non-limiting example, the following definitions are provided.

[0073] The practice of the present application will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art.

[0074] To facilitate the understanding of this application, a certain level of nomenclature is used to describe certain aspects of the application. Unless otherwise defined, all terms used in describing the application herein, including technical and scientific terms, have the meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0075] The term "and / or" should be understood to mean either one of the items or any combination of the items in the list.

[0076] As used herein, the term "or" is to be interpreted as having the same meaning as "and / or" as defined above. For example, a list of items joined by "or" or "and / or" should be construed in the inclusive sense, i.e., to include one, more, or all of the listed items and optionally additional unlisted items. Only terms clearly recited as standing in opposition are intended to mean one exclusive item or list.

[0077] The technical solutions in the embodiments of the present application will be described clearly and completely below. The described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present application.

[0078] The materials, reagents and the like used in the following examples can be obtained commercially unless otherwise specified. The examples were performed according to the conventional experimental conditions or according to the recommended conditions suggested by the manufacturer's instructions unless otherwise specified.

[0079] Example 1: Preparation of Zn-Mn bimetallic zeolitic imidazolate framework material (hereinafter also referred to as Zn / Mn-ZIF)

[0080] RNase free H2O was used to prepare 50mM ZnSO4 solution, 1M Mn(NO3)2 solution and 1M 2-methylimidazole solution respectively. In a 1.5mL EP tube, 500μL RNase free H2O was first added, followed by 400μL 50mM ZnSO4 solution, and mixed by blowing; then, 20μL 1M Mn(NO3)2 solution was added, and mixed by blowing; finally, 80μL 1M 2-methylimidazole solution was added, and mixed by blowing, and the mixture was subjected to 100g vortex oscillation at room temperature for 5min; the obtained precipitate was centrifuged at 2000g for 10min at room temperature, and the precipitate was obtained as Zn / Mn-ZIF material; 1mL RNase free H2O was added to the precipitate, and mixed by blowing, and the precipitate was resuspended, and the obtained material was Zn / Mn-ZIF material obtained under 1x reaction system.

[0081] The reaction system was adjusted by reducing the concentration of metal ions and 2-methylimidazole in the solution, and 0.25x and 0.5x reaction systems were prepared respectively, and the synthesis yield of Zn / Mn-ZIF material was determined by weighing the mass of the precipitate, and the specific reactants of each reaction system and the yield of Zn / Mn-ZIF material are shown in Table 1, and the results of the precipitate state are shown in Table 2. Figure 1 .

[0082] Table 1

[0083]

[0084] From Table 1, it can be seen that in different reaction systems, the greater the concentration of reaction ions, the higher the quality and yield of the harvested material.

[0085] It can be seen from Figure 1 that after centrifugation of the material, a milky white precipitate can be formed, and the higher the ion concentration, the more the precipitate.

[0086] Example 2: Chemical property identification of Zn / Mn-ZIF

[0087] 1. Morphological characteristics

[0088] The Zn / Mn-ZIF material prepared in the 1x reaction system in Example 1 was added dropwise on a copper mesh and adsorbed for 10 min, and then naturally dried. Using a Hitachi HT7700 transmission electron microscope (TEM), porous spherical particles with a size of about 200 nm were observed, as shown in FIG. A of Figure 2 ; using a German ZEISS Gemini SEM 300 scanning electron microscope (SEM), the surface structure characteristics were observed, and porous spherical particles with a size of about 200 nm were also observed, as shown in FIG. B of Figure 2 ; these results show that the Zn / Mn-ZIF material obtained in Example 1 is a spherical porous nanoparticle.

[0089] 2. Element identification

[0090] The Zn / Mn-ZIF material was analyzed using an Oxford x-max energy spectrometer (EDX), and the results are shown in FIG. C of Figure 2 ; the figure shows that these nanoparticles mainly contain elements such as carbon 29.98wt%, oxygen 8.76wt%, nitrogen 23.12wt%, zinc 23.43wt%, and manganese 14.80wt%, which shows that the Zn / Mn-ZIF material has zinc and manganese bimetallic elements, and the Zn-Mn bimetallic ZIF material is successfully prepared in Example 1.

[0091] Further, the X-ray photoelectron spectrometer (XPS) was used to analyze the element characteristics of the material, and the results are shown in Figure 3 ; the macroscopic XPS full spectrum confirms the C1s, N 1s, O 1s, Zn 2p and Mn 2p signals, Mn 2p appears at ~ 641 eV, and Zn 2p is at ~ 1022 eV, the peak positions all correspond to +2 valence state, indicating that Mn 2+ has really entered the tetrahedral coordination site. By calculating the peak area of Zn and Mn, the atomic ratio of zinc and manganese is determined to be Zn:Mn=5.1:1, and the molecular formula of the basic unit crystal grain of the material is deduced to be Zn 0.836 Mn 0.164(dmIm)2, where dmIm represents 2-methylimidazole.

[0092] 3. Detection of nanoparticle size and surface Zeta potential

[0093] The size and surface zeta potential of Zn / Mn-ZIF nanoparticles were detected using a Malvern Zetasizer Nano ZS90 micrometer from the UK. The results are as follows: Figure 4 As shown in Figures A and B.

[0094] Depend on Figure 4 It can be seen that the average diameter of Zn / Mn-ZIF nanoparticles is 167.4±47.5nm and the Zeta potential is 12.5±1.3mV.

[0095] 4. Characteristics of chemical bonds and crystal structure

[0096] Zn / Mn-ZIF was placed in 5mL vials and freeze-dried using a freeze dryer. The freeze-drying program was as follows: pre-cooling at -35℃ for 6 hours, condensing with gas for 40 minutes to bring the freeze well to -45℃, vacuum heating, and freeze-drying continued for 17 hours under the condition of controlling the thermal conductivity at -6℃, and drying at 20℃ for 1 hour to obtain freeze-dried Zn / Mn-ZIF material.

[0097] The chemical bond characteristics in the lyophilized samples were determined using a Thermo Scientific Nicoleti S50 Fourier transform infrared spectroscopy analyzer, and the results are as follows: Figure 5 As shown in Figure A, in this figure, 3117cm -1 The nearby absorption peak mainly originates from the CH stretching vibration mode on the imidazole ring, at 1627 cm⁻¹. -1 The nearby absorption peak originates from the C=C and C=O structures, at 1576 cm⁻¹. -1 The nearby absorption peak is a typical characteristic of the C=N stretching vibration mode on the imidazole ring, 1411 cm⁻¹. -1 and 1329cm -1 The nearby absorption peak is attributed to the C=C stretching vibration mode in the imidazole ring of the ligand, 1113 cm⁻¹. -1 The overlapping peaks in the vicinity are related to the CN structure on the imidazole ring.

[0098] Furthermore, the crystal structure characteristics of the Zn / Mn-ZIF material were detected using a Rigaku SmartLab-SE X-ray diffractometer (Japan), and the diffraction pattern is shown below. Figure 5As shown in Figure B, the diffraction pattern reveals multiple sharp diffraction peaks, indicating that the Zn / Mn-ZIF material has good crystallinity. Furthermore, its main characteristic peaks appear in the range of approximately 10-40 degrees at 2θ, while the strong diffraction peaks observed in the lower angle region (10-20 degrees) are typical characteristics of ZIF materials. Therefore, this result indicates that the Zn / Mn-ZIF material retains the basic framework structure peaks of ZIF. In addition, the strongest diffraction peak appears around 15-16 degrees, which is consistent with the typical ZIF-8 structure, further supporting the basic framework structure of the Zn / Mn-ZIF material.

[0099] In addition, for Figure 5 Analysis of the Fourier transform infrared spectrum shown in Figure A and the X-ray crystal diffraction pattern shown in Figure B reveals that the chemical formula of the Zn / Mn-ZIF material is Zn2Mn(dmIm)6, where dmIm represents 2-methylimidazole. Furthermore, each nanoparticle is composed of a polyhedral cage structure consisting of 6 four-rings and 8 six-rings. In its molecular structure, each metal atom is connected to 4 2-methylimidazoles to form a tetrahedral configuration.

[0100] 5. Specific surface area and pore size

[0101] The specific surface area and pore size of Zn / Mn-ZIF materials were determined using a Micromeritics ASAP 2460 microscope (USA). The results are shown below. Figure 6 . Figure 6 In the diagram, Figure A shows the N2 adsorption-desorption isotherm, Figure B shows the specific surface area, and Figure C shows the pore volume.

[0102] Depend on Figure 6 The BET specific surface area of ​​the Zn / Mn-ZIF material is 2.7019 m². 2 / g, Langmuir surface area is 14.2706m² 2 / g, the micropore area of ​​t-Plot is 1.1579m². 2 / g, with an external surface area of ​​1.5440m² 2 / g; its BJH adsorption pore volume (1.5-300nm) is 0.005008cm³. 3 / g, the BJH desorption pore volume (1.5-300nm) is 0.005215cm³. 3 / g, the t-Plot microwell volume is 0.000397 cm³. 3 / g; its average pore size for BJH adsorption is 6.5572nm, the average pore size for BJH desorption is 5.2460nm, and the average pore size for BET adsorption is 7.5330nm.

[0103] These results indicate that a certain number of "ink bottle" type pore junctions exist in the Zn / Mn-ZIF material, mainly containing micropores and small mesopores. The micropore size is mainly concentrated in the range of 1.2-1.8 nm, which provides sufficient active sites for gas adsorption and catalytic applications.

[0104] Example 3: Evaluation of the immune activation capacity of Zn / Mn-ZIF

[0105] 1. Evaluation of cytokine activation of innate immunity

[0106] Six-week-old female Balb / c mice were immunized with 50 μL / mouse of Zn / Mn-ZIF (obtained in the 1× reaction system of Example 1) via nasal drop, lung delivery, intraperitoneal injection, and intravenous injection. Twenty-four hours post-immunization, blood was collected from each group of mice, and serum was separated. For the nasal drop immunization group, nasal cavity and lung tissue were also collected. The tissues were homogenized in 1 mL PBS at 60 Hz for 10 min, centrifuged at 12000 rpm for 10 min, and the supernatant was collected. Cytokine expression in the serum and tissue homogenate supernatant of the immunized mice was then detected using a Luminex kit. The results are as follows: Figure 7 As shown.

[0107] Depend on Figure 7 It can be seen that the upregulation of cytokines induced by various immunization methods in serum is basically consistent. Among them, the inflammatory factor IL6 was mainly upregulated 10-fold, and NK cell and cytotoxic T cell-related factors IL-15 / IL-15R were upregulated 10-fold. After intranasal inoculation, in lung tissue, the chemokine MIP-2 was mainly upregulated 15-fold, the regulatory T cell-related factor IL-7R was upregulated 8-fold, and the B cell-related factor IL-7 was upregulated 3-fold. In nasal tissue, the inflammatory factor IL6 was mainly upregulated 5-fold, the chemokine MIP-2 was upregulated 10-fold, and other regulatory factors LIF were upregulated 6-fold. The above results indicate that Zn / Mn-ZIF can effectively activate inflammatory factors and antiviral innate immune responses related to cellular immune activation in mice, and can stimulate the upregulation of various cytokine expression levels in the blood and upper and lower respiratory tract organs.

[0108] 2. Evaluation of mucosal immune activation by IgM and IgA antibodies

[0109] Six-week-old female Balb / c mice were immunized by nasal injection with 50 μL / mouse of Zn / Mn-ZIF (obtained in the 1× reaction system of Example 1). Nasal and lung tissues were collected from the mice on days 1, 7, and 14 post-immunization. The tissues were homogenized in 1 mL PBS at 60 Hz for 10 min, centrifuged at 12000 rpm for 10 min, and the supernatant was collected. The expression levels of IgM and IgA in the lung and nasal mucosa were detected using an ELISA kit. The results are as follows:Figure 8

[0110] Figure 8 It can be seen that in the lung tissue, the IgM antibody expression level began to increase by 1.5 times on the 7th day after Zn / Mn-ZIF administration, and the mIgA antibody and sIgA antibody expression levels began to increase on the 14th day, with an increase of 2 times. In the nasal cavity tissue, the IgM antibody, mIgA antibody and sIgA antibody all began to increase on the 7th day after administration, and the expression levels all increased by more than 2 times on the 14th day. This result shows that Zn / Mn-ZIF can effectively activate the expression of non-specific IgM antibodies, mIgA antibodies and sIgA antibodies in the upper and lower respiratory tract tissues by nasal immunization, indicating that the material can effectively activate the mucosal immune response and form a certain immune protection barrier.

[0111] Example 4: Evaluation of the anti-influenza virus infection ability of Zn / Mn-ZIF

[0112] By means of nasal injection, 6-week-old female Balb / c mice were immunized with Zn / Mn-ZIF (obtained from 1x reaction system in Example 1) at 50 μL per mouse, and 10 4 PFU of influenza virus H1N1 PR8 strain was inoculated by nasal injection on the 1st day after infection, and 50 μL of Zn / Mn-ZIF (obtained from 1x reaction system in Example 1) was administered by nasal injection again. On the 2nd day and the 5th day after virus infection, the mice were dissected, and the lung tissue and the nasal cavity tissue were taken, 1 mL of PBS was used for 60HZ grinding for 10 min, and the supernatant was taken after centrifugation at 12000 rpm for 10 min, and the influenza virus RNA copy number was detected by fluorescence quantitative PCR method, and the results are shown in Figure 9

[0113] Figure 9 It can be seen that on the 2nd day after infection, the influenza virus RNA in the lung tissue decreased by 3 times, and in the nasal cavity decreased by 5 times; on the 5th day after infection, the influenza virus RNA in the lung tissue decreased by 2 times, and in the nasal cavity decreased by 3 times. This result shows that Zn / Mn-ZIF has a certain antagonistic effect on influenza virus infection by means of nasal immunization, and can effectively inhibit the replication of influenza virus RNA in the upper and lower respiratory tract tissues of mice.

[0114] Example 5: Evaluation of the RNA packaging efficiency of Zn / Mn-ZIF

[0115] 1. First, the siRNA with Cy5 label at the 5' end was synthesized, and the siRNA sequence was as follows:

[0116] ​​​​Forward: UUCUCCGAACGUGUCACGUUU (SEQ ID NO: 1),

[0117] Reverse: ACGUGACACGUUCGGAGAAUU (SEQ ID NO: 2).

[0118] 2, respectively by adsorption and self-encapsulation (schematic diagram as shown in Figure 10 The adsorption method is as follows: 13.3 mg (dry weight) of Zn / Mn-ZIF material obtained by 1x reaction system in Example 1 is used, 1 μg of the above siRNA is added, incubated at room temperature for 5 minutes, and then centrifuged at 2000g at room temperature for 5 minutes to complete the packaging. The self-encapsulation method is as follows: 20 mM ZnSO4, 20 mM Mn(NO3)2, 1 μg of the above siRNA, and 80 mM 2-methylimidazole are sequentially added in an aqueous solution, and reacted at room temperature for 5 minutes. Then, centrifugation is performed at 2000g at room temperature for 5 minutes to complete the packaging. It can be observed that the blue Cy5-labeled RNA is completely packaged by Zn / Mn-ZIF.

[0119] 3, respectively by adsorption and self-encapsulation as described above, 10 μg of EGFP-mRNA with the RNA sequence of:

[0120] AUGGUGAGCAAGGGCGAGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUCGAGCUGGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGACGGCAGCGUGCAGCUCGCCGACCACUACCAGCAGAACACCCCCAUCGGCGACGGCCCCGUGCUGCUGCCCGACAACCACUACCUGAGCACCCAGUCCGCCCUGAGCAAAGACCCCAACGAGAAGCGCGAUCACAUGGUCCUGCUGGAGUUCGUGACCGCCGCCGGGAUCACUCUCGGCAUGGACGAGCUGUACAAGUAG (SEQ ID NO: 3).

[0121] After the packaging was completed, the supernatant was aspirated after centrifugation at 2000g at room temperature for 10 min, and the absolute content of the residual EGFP-mRNA in the supernatant was detected by real-time fluorescent quantitative PCR to determine the RNA packaging efficiency of Zn / Mn-ZIF.

[0122] Specifically, the CT value of real-time fluorescent quantitative PCR and the calculation formula of RNA copy number (i.e., Log 10The absolute amount of the RNA remaining in the supernatant was calculated by the formula (i.e., absolute amount of the RNA before packaging - absolute amount of the RNA remaining in the supernatant) and the adsorption rate (%) was calculated by the formula (i.e., (absolute amount of the RNA before packaging - absolute amount of the RNA remaining in the supernatant) / absolute amount of the RNA before packaging x 100%).

[0123] The CT value data of the real-time fluorescence quantitative PCR and the RNA copy number and the adsorption rate calculated based thereon are shown in Table 2, and the column chart reflecting the packaging efficiency of the Zn / Mn-ZIF material of each reaction system is shown in Figure 11 .

[0124] Table 2

[0125]

[0126] It can be seen from Table 2 and Figure 11 that the higher the concentration of the Zn / Mn-ZIF material, the higher the RNA packaging efficiency, and in particular, the Zn / Mn-ZIF material obtained under the 1x reaction system can adsorb 10 μg of EGFP RNA molecules at 100%.

[0127] Example 6: Evaluation of mRNA expression efficiency after transfection of mRNA by Zn / Mn-ZIF packaged mRNA

[0128] According to the description in Example 1, the Zn / Mn-ZIF materials of 0.25x, 0.5x and 1x reaction systems were respectively synthesized, and the synthesized Zn / Mn-ZIF materials (the amount of each material was approximately the yield shown in Table 1) were diluted by RNase free H2O according to 1:1, 1:2 and 1:4, and then 10 μg of EGFP-mRNA was added for adsorption and packaging. After the packaging was completed, the precipitate was collected by centrifugation at 2000g at room temperature for 10 min.

[0129] The precipitate was dissolved using 1 mL of opti-MEM, and 100 μL of the dissolved solution was added to the VERO cells or BHK cells with a single layer of 96-well plates for 6 h of culture for transfection. After 6 h of culture, fresh opti-MEM culture solution was replaced for continued culture for 48 h, and fluorescence imaging was performed using a fluorescence microscope. In the fluorescence imaging picture, green fluorescent protein expressed in the cells can be observed, which is the transfected mRNA.

[0130] The fluorescence imaging results are shown in Figure 12 ; and from Figure 12It can be seen that the transfection efficiency of the Zn / Mn-ZIF material obtained under the 1x reaction system is the highest, which can reach 100% cell positive, and the fluorescence brightness in the positive cells is higher (indicating that the content of the transfected mRNA is high); with the decrease of the concentration of the reaction system during the preparation of the material and the dilution of the concentration of the prepared Zn / Mn-ZIF material, the number of positive cells and the green fluorescence intensity in the cells are gradually reduced.

[0131] Example 7: Non-targeted delivery of siRNA packaged by Zn / Mn-ZIF in vivo in mice

[0132] Take 50 μL of the Cy5 fluorescent labeled siRNA packaged by Zn / Mn-ZIF prepared in Example 3, and respectively administer by intraperitoneal injection, nasal administration, and pulmonary delivery to 6-week-old Balb / C female mice for RNA delivery. Use the PerkinElmer small animal live imaging instrument IVIS SPECTRUM to observe the live imaging at 0h, 3h, and 24h after administration, respectively, and the detection conditions are chemiluminescence detection mode exposure for 30s, excitation light wavelength 640, and emission light wavelength 680.

[0133] The results are shown in Figure 13 As Figure 13 It can be seen that the RNA-Cy5 signal can be detected in the liver and spleen in the intraperitoneal injection administration group, in the nasal cavity and lung in the nasal administration group, and in the lung and liver in the pulmonary delivery administration group.

[0134] The results show that the Zn / Mn-ZIF material can deliver siRNA to different tissues and organs in mice through different administration methods, and the distribution of the delivered RNA in the organs depends on the specific site of administration. Therefore, the Zn / Mn-ZIF material of the present application is suitable for the delivery of RNA drug molecules to various treatment sites, and has a wide application prospect.

[0135] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application, and not to limit them; although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that they can still modify the technical solutions described in the foregoing examples, or make equivalent substitutions for part of the technical features; and these modifications or substitutions do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application.

Claims

1. A Zn-Mn bimetallic ZIF material, characterized in that, The Zn-Mn bimetallic ZIF material includes zinc ions, manganese ions, and 2-methylimidazole ligands, and a chemical formula of the Zn-Mn bimetallic ZIF material is Zn 0.836 Mn 0.164 (dmIm)2, wherein dmIm represents 2-methylimidazole. The Zn-Mn bimetallic ZIF material is in a spherical structure self-assembled by nanocrystalline grains, and imidazole is used as a bridging unit in the framework. Each nanocrystalline grain is composed of a polyhedral cage structure combined by 6 four-rings and 8 six-rings. In the molecular structure, each metal atom is connected with 4 2-methyl imidazoles to form a tetrahedral configuration, and the atomic ratio of Zn:Mn is 5.1:

1.

2. The Zn-Mn bimetallic ZIF material of claim 1, wherein, The particle size of the Zn-Mn bimetallic ZIF material ranges from 119.9 nm to 214.9 nm. The ZETA potential of the Zn-Mn bimetallic ZIF material ranges from 11.3 to 13.

8.

3. The method of claim 1 or 2, wherein the Zn-Mn double metal ZIF material is prepared by the method comprising: The preparation method comprises: reacting a solution containing a zinc ion source, a manganese ion source and 2-methyl imidazole under oscillation conditions.

4. The production method according to claim 3, characterized by, The zinc ion source is one or more of the following soluble zinc salts: ZnSO4, Zn(NO3)2 and ZnCl2; The manganese ion source is one or more of the following soluble manganese salts: Mn(NO3)2, MnSO4 and MnCl2; The solution is an aqueous solution.

5. The production method according to claim 4, characterized by, The zinc ion source is ZnSO4, and the manganese ion source is Mn(NO3)2. The concentration of the zinc ions in the aqueous solution is 15-25 mM. The concentration of the manganese ions in the aqueous solution is 15-25 mM. The concentration of the 2-methyl imidazole in the aqueous solution is 60-100 mM. The molar ratio of zinc ions, manganese ions and 2-methyl imidazole in the aqueous solution, based on zinc ions, manganese ions and imidazole groups, is (0.8-1.2):(0.8-1.2):(3-5).

6. The method of any one of claims 3-5, wherein, The temperature of the reaction is 20-30℃. The time of the reaction is 5-10 min.

7. Use of the Zn-Mn bimetallic ZIF material of claim 1 or 2 as an RNA delivery carrier in the preparation of an RNA-based vaccine or drug.

8. A ZIF material based RNA delivery system, characterized in that, The RNA delivery system comprises: (I) the Zn-Mn bimetallic ZIF material of claim 1 or 2 as a carrier, and (II) an RNA molecule loaded on the carrier.

9. A method of preparing an RNA delivery system as claimed in claim 8, characterized in that, The preparation method comprises: Mixing and reacting the Zn-Mn bimetallic ZIF material of claim 1 or 2 with RNA to adsorb the RNA on the Zn-Mn bimetallic ZIF material.

10. The method of claim 9, wherein, The mass ratio of the Zn-Mn bimetallic ZIF material to the RNA is (100000-1000):

1. The adsorption reaction is carried out at 20-30℃.

11. A method of preparing an RNA delivery system, characterized by, The preparation method comprises: (1) mixing a zinc ion source aqueous solution with a manganese ion source aqueous solution to obtain a mixed solution I; (2) adding RNA to the mixed solution I and mixing to obtain a mixed solution II; (3) adding 2-methylimidazole to the mixture II, mixing, and reacting at 20-30℃ for 5-10 min under oscillation; then, centrifuging, discarding the supernatant, resuspending with nuclease-free water, and obtaining the RNA delivery system; in the obtained RNA delivery system, the RNA is loaded on the Zn-Mn bimetallic ZIF material of claim 1 or 2.

12. The method of claim 11, wherein, The zinc ion source is one or more of the following soluble zinc salts: ZnSO4, Zn(NO3)2, and ZnCl2. And / or, the manganese ion source is one or more of the following soluble manganese salts: Mn(NO3)2, MnSO4, and MnCl2.

13. The method of claim 12, wherein, The zinc ion source is ZnSO4, and the manganese ion source is Mn(NO3)2.

14. The method of any one of claims 11-13, wherein, In step (1), the molar concentration of the zinc ion source aqueous solution is 15-25 mM, and the molar concentration of the manganese ion source aqueous solution is 15-25 mM. And / or, in step (2), 1-10 μg of RNA is added to the mixture I. And / or, in step (3), 60-100 mM of 2-methylimidazole is added to the mixture II.

15. Use of the Zn-Mn bimetallic ZIF material of claim 1 or 2 in the preparation of a medicament for: (1) improving immunity to prevent respiratory virus infection; (2) treating respiratory virus infection.

16. Use according to claim 15, characterized in that, The improvement of immunity is achieved by a method selected from: (1) activating the natural immune response; (2) enhancing cellular immunity; (3) activating the mucosal immune response.

17. Use according to claim 15 or 16, characterized in that, The respiratory virus infection is influenza virus infection.

Citation Information

Patent Citations

  • MicroRNA delivery nanocarrier based on zeolitic imidazolate framework and preparation method thereof

    CN110368398A

  • Nitrogen-enriched hollow hybrid carbon catalytic material as well as preparation method and application thereof

    CN113145150A