Trichoderma atrophaeum with pine wood nematode killing activity and application of trichoderma atrophaeum in pine wood nematode prevention and control

Abstract

The invention provides a Trichoderma atrobrunneum strain, a fermentation broth of the Trichoderma atrobrunneum strain, a fermentation broth extract of the Trichoderma atrobrunneum strain and application of the Trichoderma atrobrunneum strain to pine wood nematode resistance. The trichoderma atrophaeum is obtained by taking pinus koraiensis tissue of bursaphelenchus xylophilus as a separation object and culturing the pinus koraiensis tissue. The fermentation liquor and the fermentation liquor extract of the trichoderma atrophaeum have high lethal activity on pine wood nematodes, the 24-hour fatality rate of the fermentation liquor on the pine wood nematodes is 100%, and the 24-hour fatality rate of the active extract on the pine wood nematodes is 92 + / -13%. The strain contained in the fermentation liquor and the fermentation liquor extract for resisting pine wood nematode provided by the invention comes from pinus koraiensis tissue infected with pine wood nematode disease, is friendly to ecological environment and free of pollution, can be used for preparing corresponding products capable of being practically applied, and has huge application potential in the field of pesticides.

Description

Technical Field

[0001] The invention belongs to the field of pesticides, and particularly relates to a dark brown Trichoderma with pine wood nematode killing activity and use of the same in preventing and controlling pine wood nematodes. Background Art

[0002] Pine wilt disease (PWD), caused by the plant-parasitic nematode Bursaphelenchus xylophilus, is a devastating disease affecting pine species worldwide. Pine wilt nematode (PWN) has been declared a quarantine organism in over 52 countries and ranks sixth among the ten most economically important plant-parasitic nematodes (PPNs). In China, PWD is widespread in over 790 counties and 21 provinces. By 2030, the prevalence of PWD in Europe could reach 8%-34%, resulting in losses exceeding €22 billion in forestry resources. Currently, PWD control relies primarily on the use of pesticides and preventive physical measures, such as trunk injections of nematicides, aerial spraying, removal of infected trees, and burning of dead wood, but these measures have limited effectiveness. While the use of nematicides is effective to some extent, the overuse of these chemicals carries numerous drawbacks, including environmental hazards and human health impacts. Pine wood nematode disease has significant negative economic impacts on timber commercialization, forest ecosystems, and biodiversity. Therefore, biological control is gaining increasing attention.

[0003] Endophytic fungi in plants overcome the shortcomings of poor colonization of biocontrol fungi previously screened from natural environments. Compared with epiphytic fungi and rhizospheric fungi in natural environments, they have a stable living environment and are not easily affected by the external environment. They can colonize and transmit in plants, causing systemic resistance in plants. Therefore, endophytic fungi in plants have good development and application prospects in the control of nematode diseases.

[0004] Current research on biocontrol agents for pine wilt disease primarily focuses on the following bacteria: Bacillus pumilus, Paenibacillus polymyxa, Bacillus cereus, and Bacillus siamensis; actinomycetes: Streptomyces sp; and fungi: Bacillus thuringiensis and Paecilomyces lilacinus.

[0005] Therefore, the development of highly effective, low-toxic biocontrol agents is urgent, and the use of beneficial microorganisms to control nematodes has become an important approach in this area. Screening microorganisms with nematicidal activity from Korean pine plant tissues infected with pine wilt nematode disease aims to provide a theoretical basis for the development of plant tissue microbial resources and the utilization of pine wilt nematode-killing endophytes, thus having important practical significance.

[0006] Trichoderma is widely found in nature. It produces a large number of secondary metabolites and has been used as a biocontrol agent since the 1930s. Numerous field experiments have demonstrated that its application can promote plant growth while limiting the growth of pathogens, playing a significant role in the biological control of plant diseases. Trichoderma sepia is a newly identified complex species in the genus, but its antagonistic effects against pine wood nematodes have not yet been reported. Summary of the Invention

[0007] Currently, the prevention and control of pine wilt disease still primarily relies on felling infected trees, supplemented by the registration and use of agricultural pesticides such as avermectin and emamectin benzoate in forestry settings. Research on the potential of biological control to kill nematodes is far less focused. This application isolated a strain of Trichoderma atrobrunneum with pine wilt nematode-killing ability from Korean pines infected with pine wilt nematodes and named it PHY2. Through the biological and molecular identification of PHY2 and its biocontrol potential, this study provides a reference for expanding the pine wilt nematode biological control resource library and green control of pine wilt disease.

[0008] The purpose of the present invention is achieved through the following technical solutions: A strain of Trichoderma fusca with pine wood nematode killing activity, designated PHY2, has the accession number CGMCC No. 41755 and was deposited on January 14, 2025, at the General Microbiology Center of the China Microorganism Collection Administration, located at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0009] Described dark brown Trichoderma has the following morphological characteristics: After culturing on PDA medium at 26℃ for 3 days, the aerial hyphae were abundant and white flocculent, then gradually turned green. After culturing for 7 days, the hyphae turned dark green and had no obvious odor.

[0010] The fermentation liquid of Trichoderma sepia and the active extract of the fermentation liquid can kill pine wood nematodes: The fermentation liquid of dark brown Trichoderma and its active extract are used to soak pine wood nematodes using the insect immersion method, and have high toxicity activity.

[0011] Application of the Trichoderma sepia fermentation broth and / or its fermentation broth active extract in preventing and controlling pine wood nematode disease; A biological bacterial agent comprises the fermentation liquid of the above-mentioned Trichoderma fusca and / or an active extract of the fermentation liquid.

[0012] The preparation method of the biological agent comprises the following steps: Fermentation culture: inoculating the dark brown Trichoderma into PDB culture solution, shaking and culturing at a temperature of 25-28° C. and a stirring speed of 120-220 rpm for 14 days to obtain a liquid fermentation solution; Extraction of active ingredients: The fermentation broth of Trichoderma atrobrunneum PHY2 was extracted with petroleum ether:ethyl acetate at a ratio of 5:3, and concentrated by rotary evaporation to obtain a crude extract of the active ingredient.

[0013] The fermentation liquid of Trichoderma atrobrunneum PHY2 and / or the crude extract of active ingredients are the bacterial agent of active ingredients.

[0014] The strain isolated and identified in this application was named PHY2, with the deposit number CGMCC NO.41755. It was deposited on January 14, 2025 at the General Microbiology Center of the China Microorganism Collection Administration, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0015] The present application also provides a use of the Trichoderma sepia in the preparation of a pine wood nematode insecticide.

[0016] The present application also provides a biocontrol agent for killing pine wood nematodes, which uses the fermentation broth of the dark brown Trichoderma and / or its fermentation broth active extract as an active ingredient.

[0017] The present application also provides a use of the dark brown Trichoderma or the biocontrol agent in the prevention and treatment of pine wood nematode disease in forest trees.

[0018] The present application also provides a preparation method of the biocontrol agent, comprising: inoculating Trichoderma sepia into a PDB liquid culture medium for cultivation, centrifuging and filtering the fermentation broth containing mycelium to remove the mycelium, and collecting the filtrate; and extracting the fermentation broth with petroleum ether:ethyl acetate to obtain an active extract.

[0019] The present application also provides a method for controlling pine wood nematodes, comprising: applying the fermentation liquid and / or active extract of the Trichoderma sepia to forest trees or pine wood nematodes.

[0020] Optionally, the fermentation broth refers to the secretion produced after a period of culture by inoculating the PHY2 strain into a liquid culture medium; the active extract refers to the fermentation broth subjected to petroleum ether:ethyl acetate extraction and then concentrated by rotary evaporation.

[0021] Optionally, the trees are pine trees; further optionally, the trees are pine trees infected with pine wilt disease or pine trees not infected with pine wilt disease.

[0022] The dark brown Trichoderma of the present application or the biocontrol agent prepared based on the strain is applied to pine trees infected with pine wood nematode disease.

[0023] Optionally, the Trichoderma sepia or the biocontrol agent prepared based on the strain can be applied in a variety of ways, for example, common spraying, dry injection or irrigation.

[0024] Alternatively, when directly applying to pine wood nematodes, it is preferred to apply the biocontrol agent made from Trichoderma sepia.

[0025] The present invention has the following advantages and effects compared to the prior art: (1) The present invention uses Korean pine tissue infected with pine wood nematodes as the isolation object, and isolates a dark brown Trichoderma with a good inhibitory effect on pine wood nematode disease, named Trichoderma atrobrunneumPHY2. The present invention provides a new type of biocontrol fungus for the biological control of pine wood nematode disease and has the potential to be developed into a biopesticide; (2) The biological preparation provided by the present invention contains Trichoderma atropurpureus PHY2, which has high lethality against pine wood nematodes, wherein the 24-hour lethality rate against pine wood nematodes in the fermentation liquid is 100%, and the 24-hour lethality rate of the active extract is 92±13%; (3) The biological preparation provided by the present invention has low requirements for culture conditions, and the strains contained therein are derived from Korean pine tissue infected with pine wood nematode disease, which is friendly to the ecological environment and pollution-free. Therefore, the biological preparation has a good development and application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The morphological diagram of Trichoderma atrobrunneumPHY2 strain; a is the colony morphology after 3 days of culture, and b is the colony morphology after 7 days of culture; Figure 2 This is the result diagram of the phylogenetic tree constructed based on the strain ITS. DETAILED DESCRIPTION

[0027] The following will clearly and completely describe the technical solutions of this application in conjunction with the embodiments. Obviously, the embodiments described are only a part of the embodiments of this application, not all of them. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of this application.

[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application pertains. The terms used herein in the specification of this application are for the purpose of describing specific embodiments only and are not intended to limit this application.

[0029] The culture medium formulas involved in the examples are as follows: Potato dextrose agar (PDA) medium: 200 g peeled potatoes, 20 g glucose, 18 g agar, 1 L distilled water, autoclave at 121°C for 15 min; Potato liquid (PDB) medium (containing chloramphenicol): 200 g peeled potatoes, 20 g glucose, 0.1 g chloramphenicol, 1 L distilled water, autoclave at 121°C for 15 min.

[0030] Example 1 Strain Isolation A sample of approximately 20 grams of sawdust was collected from a naturally infected Korean pine (Pinus koraiensis Siebold et Zuccarini) with pine wilt disease about 1.5 meters above the ground using a borer, placed in a sealed plastic bag, and sent to the laboratory for fungal isolation. The sample was placed in a solid potato dextrose agar (PDA) culture dish containing 0.01% chloramphenicol to promote the growth of molds, yeasts, and fungi and inhibit bacterial growth. The culture dishes were incubated at 28°C for 7 days, at which time the microbial growth on each culture dish and culture medium was clearly visible. After 7 days, fungal growth with different morphologies was picked for subculture and isolation. Each isolate was subcultured a total of four times to ensure that it was the only strain growing on the plate before molecular identification. Finally, the isolates that met the requirements of long-term growth on PDA culture medium and were not contaminated by other bacteria were selected for further identification.

[0031] Example 2 Strain Identification Morphological identification: The isolated and purified strain PHY2 was inoculated on PDA medium and cultured at 28°C in the dark for 7 days. The colony morphology (including color and texture) was observed every 24 hours. After culturing on PDA medium at 26℃ for 3 days, the aerial hyphae were abundant and white flocculent, then gradually turned green. After culturing for 7 days, the hyphae turned dark green and had no obvious odor.

[0032] Sequence alignment and phylogenetic analysis: The strain was inoculated into PDB medium containing chloramphenicol and cultured at 26°C on a shaker rotating at 180 rpm for 14 days. After incubation, the mycelial cell mass was separated by filtration, transferred to a mortar, and ground in the presence of liquid nitrogen. DNA was extracted using the Solebro Fungal Genomic DNA Extraction Kit. PCR primers were as follows: internal transcribed spacer (ITS): ITS1 (5′TCCGTAGGTGAACCTGCCG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′); The PCR temperature cycle parameters were as follows: preheating at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 45 s, for 35 cycles; annealing at 72°C for 10 min. The amplified products were sequenced by a sequencing company. The obtained base sequences of ITS1 and ITS4 are as follows: ITS1: TATACGACTTTCACTTCCAACCCATTGTGAACGTACCAAAACTGTTGCCTCGGCGGGATCTCTGCCCCG GGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCCCCCCGTATAACCCCT CGCGGGTTTTTTATAATCTGAGCCTTCTCGGCGCCTCTCGTAGGGCGTTTCGAAAATGAATCAAAACTT TCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATT GCAGAATTCAGTGAATCATCGAATCTTTGAACGCACACTGCGCCCGCCAGTATTCTGGCGGGCATGCC TGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTGCCTTGG CGGTGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCCTGCGCAGTAGTTTGCACACTC GCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGG TAGGAATACCCGCTGAACTTAAGCATTAAAGGGGGGAAGAAAAAA ITS4: TCCTACCTGATCCGAGGTCACATTTCAGAAGTTGGGTGTTTAACGGCTGTTGGACGCGCCGCGCTTCCC GATGCGAGTGTGCAAACTACTGCGCAGGAGAGGCTGCGGCGAGACCGCCACTGTATTTCGGAGACGGC CACCGCCAAGGCAGGGCCGATCCCCAACGCCGACCCCCCGGAGGGGTTCGAGGGTTGAAATGACGCTC GGACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAAT TCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTT GTTGAAAGTTTTGATTCATTTTCGAAACGCCTACGAGAGGCGCCGAGAAGGCTCAGATTATAAAAAAC CCGCGAGGGGGTATACAAAAAGAGTTTTGGTTGGTCCTCCGGCGGGCGCCTTGGTCCGGGGCTGCGAC GCACCCGGGGCAGAGATCCCGCCGAGGCAACAGTTTGGTAACGTTCACATTGGGTTTGGGAGTTGTAA ACTCGGTAATGATCCCTCCGCAGCCCCCCCTCAGGGAAAC Phylogenetic and molecular evolutionary analyses were performed using MEGA11 software. The ITS sequence of the strain Trichoderma atrobrunneum PHY2 was compared with the ITS rRNA genes of several other related strains downloaded from the National Center for Biotechnology Information (NCBI). This sequence was selected as an outgroup for Saccharomyces pastorianus and a maximum likelihood tree was constructed using bootstrap testing with 1000 replicates. Table 1 Phylogenetic tree of selected strains and their NCBI accession numbers The phylogenetic tree was constructed based on strains ITS1 and ITS4. Figure 2 The figure shows a phylogenetic tree constructed based on the ITS sequence of Trichoderma atrobrunneum PHY2 using MEGA11 according to the maximum likelihood estimation (MLE) method. After the tree was constructed, it was found that the test strain Trichoderma atrobrunneum PHY2 was most closely related to Trichoderma atrobrunneum (MH156193.1) in terms of ITS sequence. The strain isolated and identified in this example was named PHY2, with the accession number CGMCC NO.41755, and was deposited on January 14, 2025 at the General Microbiology Center of the China Microorganism Collection Administration Committee, located at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0033] Example 3: Pine wood nematode toxicity test of Trichoderma atrobrunneum PHY2 fermentation broth: Prepare PDB medium containing chloramphenicol and dispense 300 mL into 1 L Erlenmeyer flasks. Sterilize at 121°C for 15 min. Take the fungus PHY2 cultured on the PDA plate, take a bacterial cake from the plate with a hole punch, inoculate it into the PDB medium, and culture it in a shaker at 26°C and 180 rpm for 14 days. Fermentation broth nematode toxicity test: Take 1 ml of the fermentation liquid and add it to 3,000 pine wood nematodes. Mix thoroughly by pipetting. Use clean water as a control. Place the mixture in a 25°C incubator for 24 hours and observe. For counting, take 10 μL of the mixture containing nematodes, add 100 μL of clean water, place it on a slide, illuminate it for 30 minutes, and examine the nematode mortality using an optical microscope. When no nematode movement is observed, the nematodes are considered dead. Repeat each treatment three times, and calculate the average mortality rate. Nematode mortality % = (number of dead nematodes / number of test nematodes) × 100. Corrected mortality % = (death rate of treated nematodes - death rate of control nematodes) / (1 - death rate of control nematodes) × 100; The fermentation liquid of strain PHY2 had a significant killing effect on pine wood nematodes. The corrected mortality rate of pine wood nematodes within 24 hours was 100%, while in the control group, pine wood nematodes showed no abnormal symptoms. Table 2 Toxic activity of PHY2 fermentation liquid against pine wood nematodes

[0034] Example 4: Toxicity test of Trichoderma atrobrunneum PHY2 fermentation broth active extract against pine wood nematodes Preparation of fermentation broth extract: The strain Trichoderma atrobrunneum PHY2 was cultured at 28°C for 7 days and then inoculated into 1L triangular flasks, each containing 400ml of potato liquid culture medium supplemented with 0.01% chloramphenicol. The triangular flasks were cultured on a rotary shaker at 26°C and 180rpm for 14 days to obtain a fermentation broth. 300ml of the fermentation broth was extracted with 500ml of petroleum ether for 3 times, each time until the color of the extract changed to the color of the solvent. After the petroleum ether extraction was completed, ethyl acetate extraction was performed, and the operation was the same as the petroleum ether extraction. The ethyl acetate extract obtained each time was concentrated to an extract by vacuum rotary evaporation at 50°C; Determination of biological activity of fermentation broth extract: Weigh the fermentation broth extract to make a 10 mg / ml aqueous solution, add it to a 24-well plate containing 3,000 pine wood nematodes, pipette and mix thoroughly, use clean water as a control, place in a 25°C incubator for 24 hours, and observe. For counting, take 10 μL of the mixture containing nematodes, add 100 μL of clean water, place on a slide, and illuminate for 30 minutes. Then count the total number and number of dead pine wood nematodes under different treatments. Nematode mortality % = (number of dead nematodes / number of test nematodes) × 100. Corrected mortality % = (death rate of treated nematodes - death rate of control nematodes) / (1 - death rate of control nematodes) × 100 Table 2 Toxic activity of PHY2 fermentation broth extract against pine wood nematodes

[0035] The above-described embodiments merely represent several implementation methods of the present application. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art could make various modifications and improvements without departing from the spirit of the present application, all of which fall within the scope of protection of the present application. Therefore, the scope of protection of the present patent application shall be determined by the appended claims.

Claims

1. A Trichoderma atrobrunneum strain, characterized in that: The dark brown Trichoderma is named PHY2, with the preservation number CGMCC NO.41755. It was deposited in the General Microbiology Center of the China Microbiological Collection Administration on January 14, 2025, and the preservation address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

2. The dark brown Trichoderma according to claim 1, wherein: The dark brown Trichoderma is separated from Korean pine infected with pine wood nematodes and obtained through culture.

3. Use of a dark brown Trichoderma and its fermentation liquid and fermentation liquid extract in resisting pine wood nematodes.

4. A biological agent, characterized in that: The biological agent comprises the Trichoderma fuscata, the Trichoderma fuscata fermentation broth and / or the active extract of the fermentation broth according to claim 1.

5. The biological agent according to claim 4, characterized in that: The preparation method of the Trichoderma sepia fermentation liquid comprises the following steps: inoculating the Trichoderma sepia into PDB culture liquid and culturing at a temperature of 25-28° C., a stirring speed of 120-220 rpm, and a culturing time of 12-16 days to obtain the fermentation liquid.

6. The biological agent according to claim 4, characterized in that: The preparation method of the active extract of Trichoderma sepia fermentation comprises the following steps: removing mycelia from the Trichoderma sepia fermentation liquid to obtain a filtrate, then extracting the filtrate with petroleum ether and ethyl acetate in sequence, and concentrating the obtained ethyl acetate phase to obtain the active extract.

7. Use of Trichoderma sepia and its fermentation liquid and fermentation liquid extract in the preparation of pine wood nematode insecticide.

8. Use of Trichoderma sepia and its fermentation liquid, fermentation liquid extract or biocontrol agent in the prevention and treatment of pine wood nematode disease.

9. A method for controlling pine wood nematodes, characterized in that: The following steps are involved: The fermentation liquid and / or active extract of Trichoderma sepia is applied to plants or places infected by pine wood nematodes.

10. The control method according to claim 9, characterized in that: The plant infected by pine wood nematodes is of the genus Pinus.

Images