Staphylococcus aureus esx gene deleted strain extracellular vesicle as well as preparation method and application thereof
By knocking out the esx gene of Staphylococcus aureus, the prepared BEVs solved the problems of high toxicity and low yield, and achieved high yield and low toxicity preparation of BEVs, which is suitable for drug delivery systems.
Patent Information
- Application Number
- CN202510655424.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-21
- Publication Date
- 2025-08-22
- Estimated Expiration
- 2045-05-21
AI Technical Summary
In the prior art, wild-type Staphylococcus aureus extracellular vesicles (BEVs) have problems with high toxicity, low yield and unstable delivery efficiency, which limits their application in drug delivery.
By knocking out the esx gene of Staphylococcus aureus, especially the esxA or esxB genes, the deletion strain is constructed using homologous recombination technology to prepare BEVs of the esx gene deletion strain of Staphylococcus aureus, reducing the enrichment of toxic components and increasing the yield of BEVs.
It significantly improves the yield of BEVs, reduces the toxicity to host cells, enhances biosafety, lays the foundation for its application in drug delivery systems, and improves preparation efficiency.
Smart Images

Figure CN120519361A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedicine and nano-delivery technology, and in particular to an extracellular vesicle of an esx gene-deficient strain of Staphylococcus aureus, and a preparation method and application thereof. Background Art
[0002] Bacterial extracellular vesicles (BEVs) are natural nanoscale carriers with excellent biocompatibility, membrane fusion ability, and delivery efficiency. Extracellular vesicles (SaEVs) produced by Staphylococcus aureus can carry a variety of active ingredients, including proteins, nucleic acids, and small molecule drugs, showing potential as drug delivery systems. However, BEVs produced by wild-type S. aureus carry multiple virulence factors that can trigger strong immune responses and cytotoxicity, limiting their application in clinical drug delivery.
[0003] At present, the common method for preparing BEVs is to culture wild-type Staphylococcus aureus in culture media such as LB or TSB to the logarithmic growth phase, and extract BEVs by ultracentrifugation combined with filtration membrane or density gradient centrifugation. However, these vesicles are usually rich in virulence proteins, and their virulence components may cause host cell apoptosis or trigger a strong immune response. For example, it has been reported in the literature that wild-type SaEVs carry a variety of bioactive molecules (such as enzymes, lipoproteins, toxins, DNA and RNA, etc.), which makes SaEVs cytotoxic and immunogenic. In particular, when used in vivo, they may cause severe inflammatory reactions, leading to systemic toxicity. This problem has become a major obstacle in the practical application of Staphylococcus aureus BEVs as drug delivery carriers. Therefore, reducing toxicity and increasing BEVs yield is one of the key directions for developing Staphylococcus aureus BEVs delivery systems.
[0004] It can be seen that the existing technology faces problems such as high toxicity, low yield, and unstable delivery efficiency of Staphylococcus aureus BEVs. There is still a lack of an engineering solution that can not only increase EVs production, but also significantly reduce toxicity and enhance biosafety. Summary of the Invention
[0005] The present invention aims to provide extracellular vesicles (EVs) from a Staphylococcus aureus esx gene-deficient strain, as well as a preparation method and application thereof, to address the problems of the prior art. The present invention provides a Staphylococcus aureus esx gene-deficient strain that produces high BEVs and exhibits low host cell toxicity.
[0006] To achieve the above object, the present invention provides the following solutions:
[0007] The present invention provides an esx gene deleted strain of Staphylococcus aureus, which is obtained by knocking out the esx gene of Staphylococcus aureus using homologous recombination technology; the esx gene includes the esxA gene or the esxB gene; the nucleotide sequence of the esxA gene is shown in SEQ ID NO.23; the nucleotide sequence of the esxB gene is shown in SEQ ID NO.24.
[0008] The present invention provides a method for constructing the above-mentioned Staphylococcus aureus esx gene deletion strain, comprising the following steps:
[0009] (1) Extraction of genomic DNA of Staphylococcus aureus Newman strain;
[0010] (2) PCR amplification was used to obtain the upstream and downstream homology arms of the Staphylococcus aureus esx gene;
[0011] (3) PCR amplification was used to obtain the fusion fragment of the upstream and downstream homology arms of the Staphylococcus aureus esx gene;
[0012] (4) Recombining the fusion fragment and the pKOR1 plasmid to construct the homologous recombination plasmid pKOR1-esx;
[0013] (5) electroporating the homologous recombination plasmid pKOR1-esx into a wild-type Staphylococcus aureus strain to obtain a Staphylococcus aureus esx gene-deficient strain;
[0014] Preferably, in step (2), when the esx gene is the esxA gene, the primer pair used for PCR amplification of the upstream homology arm of the esxA gene includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.2, and the primer pair used for PCR amplification of the downstream homology arm of the esxA gene includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.4; when the esx gene is the esxB gene, the primer pair used for PCR amplification of the upstream homology arm of the esxB gene includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.6, and the primer pair used for PCR amplification of the downstream homology arm of the esxB gene includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.7 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.8;
[0015] In step (3), when the fusion fragment is an esxA gene fusion fragment, the primer pair used for PCR amplification includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.9 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.10; when the fusion fragment is an esxB gene fusion fragment, the primer pair used for PCR amplification includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.11 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.12.
[0016] The present invention provides a method for preparing extracellular vesicles of an esx gene-deficient strain of Staphylococcus aureus, the preparation method comprising the following steps:
[0017] (1) Extraction of genomic DNA of Staphylococcus aureus Newman strain;
[0018] (2) PCR amplification was used to obtain the upstream and downstream homology arms of the Staphylococcus aureus esx gene;
[0019] (3) PCR amplification was used to obtain the fusion fragment of the upstream and downstream homology arms of the Staphylococcus aureus esx gene;
[0020] (4) Recombining the fusion fragment and the pKOR1 plasmid to construct the homologous recombination plasmid pKOR1-esx;
[0021] (5) electroporating the homologous recombination plasmid pKOR1-esx into a wild-type Staphylococcus aureus strain to obtain a Staphylococcus aureus esx gene-deficient strain;
[0022] (6) The Staphylococcus aureus esx gene deletion strain is subjected to ultracentrifugation and filtration to obtain Staphylococcus aureus extracellular vesicles.
[0023] Preferably, in step (2), when the esx gene is the esxA gene, the primer pair used for PCR amplification of the upstream homology arm of the esxA gene includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.2, and the primer pair used for PCR amplification of the downstream homology arm of the esxA gene includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.4; when the esx gene is the esxB gene, the primer pair used for PCR amplification of the upstream homology arm of the esxB gene includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.6, and the primer pair used for PCR amplification of the downstream homology arm of the esxB gene includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.7 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.8;
[0024] In step (3), when the fusion fragment is an esxA gene fusion fragment, the primer pair used for PCR amplification includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.9 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.10; when the fusion fragment is an esxB gene fusion fragment, the primer pair used for PCR amplification includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.11 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.12.
[0025] The present invention provides extracellular vesicles of the Staphylococcus aureus esx gene deleted strain obtained by the above preparation method.
[0026] The present invention provides the use of the extracellular vesicles of the above-mentioned Staphylococcus aureus esx gene deleted strain in any of the following items:
[0027] (1) preparing a drug delivery vehicle;
[0028] (2) preparing vaccines;
[0029] (3) Preparation of functional drugs;
[0030] (4) Production of extracellular vesicles from Staphylococcus aureus esx gene deletion strain;
[0031] (5) Prepare a product for producing extracellular vesicles of the Staphylococcus aureus esx gene deleted strain.
[0032] The present invention provides a drug delivery system, comprising the extracellular vesicles of the Staphylococcus aureus esx gene-deficient strain and an exogenous drug;
[0033] The exogenous drugs include proteins, nucleic acids or small molecule drugs.
[0034] The present invention provides an application of the esx gene in promoting the secretion of extracellular vesicles from Staphylococcus aureus. By knocking out the esx gene in Staphylococcus aureus, the secretion of extracellular vesicles from Staphylococcus aureus is promoted.
[0035] The esx gene includes the esxA gene or the esxB gene; the nucleotide sequence of the esxA gene is shown in SEQ ID NO. 23; the nucleotide sequence of the esxB gene is shown in SEQ ID NO. 24.
[0036] The present invention provides a method for promoting the secretion of extracellular vesicles from Staphylococcus aureus, comprising the steps of knocking out the esx gene in Staphylococcus aureus, ultracentrifuging and filtering the resulting strain to obtain extracellular vesicles from Staphylococcus aureus; the esx gene includes the esxA gene or the esxB gene; the nucleotide sequence of the esxA gene is shown in SEQ ID NO. 23; the nucleotide sequence of the esxB gene is shown in SEQ ID NO. 24.
[0037] The present invention discloses the following technical effects:
[0038] The present invention selects the Staphylococcus aureus esxA gene / esxB gene (ESAT-6-like secretion system, esx system) as the knockout target. The esx system is the type III secretion system of Staphylococcus aureus, which is widely involved in the efflux of virulence proteins and the host cell penetration process. The loss of the esx system significantly inhibits the invasiveness and immune activation potential of the bacteria, but has little effect on the survival and basic metabolism of the strain. The present invention provides a Staphylococcus aureus esx gene deletion strain (Staphylococcus aureus esxA gene deletion strain / Staphylococcus aureus esxB gene deletion strain). Staphylococcus aureus BEVs are prepared based on the Staphylococcus aureus esxA gene deletion strain / Staphylococcus aureus esxB gene deletion strain. The BEVs can effectively reduce the enrichment of toxic components while retaining the membrane structure and vesicle release ability. Furthermore, experimental results from the present invention demonstrate that, under identical culture conditions, the esxA / esxB deletion strains of Staphylococcus aureus (S. aureus) increased BEV production by approximately 2-4 times compared to wild-type S. aureus. This is likely due to the inhibitory interaction between the virulence regulatory system and the vesicle release pathway. This property significantly improves the efficiency of large-scale production of S. aureus BEVs, laying the foundation for their industrial application.
[0039] At the same time, BEVs have multiple biological activities, not only playing an important role in bacterial self-regulation and in the process of interaction with host cells, but also having great potential in development and application. The preparation ideas of the Staphylococcus aureus esxA gene deletion strain / Staphylococcus aureus esxB gene deletion strain provided by the present invention can optimize the extraction efficiency while ensuring its high yield, high purity and low cytotoxicity. Therefore, on this basis, through genetic engineering modification, its immunogenicity can be improved, its toxicity can be reduced, and the body's innate immunity and adaptive immune response can be stimulated, making it have the potential for vaccine development. At the same time, as nano-scale particles, Staphylococcus aureus BEVs have good diffusion ability and bioavailability and can carry exogenous substances. Through surface modification and design and addition of functional ligands to enhance its targeting modification, it can be used as a drug delivery carrier.
[0040] In summary, the present invention provides a new technical means and platform for the preparation of new vaccines for various infectious diseases, specific drug delivery, and anti-tumor treatment through genetic engineering and BEVs with specific targeting capabilities. BRIEF DESCRIPTION OF THE DRAWINGS
[0041] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0042] Figure 1 Transmission electron micrograph of Newman wild-type BEVs; scale bar: 500 nm; arrows indicate Newman wild-type BEVs;
[0043] Figure 2 Transmission electron micrograph of Newman wild-type BEVs; scale bar: 100 nm; arrows indicate Newman wild-type BEVs;
[0044] Figure 3 Transmission electron micrograph of Staphylococcus aureus esxA gene deletion strain BEVs; scale bar is 500 nm; arrows indicate Staphylococcus aureus esxA gene deletion strain BEVs;
[0045] Figure 4 Transmission electron micrograph of Staphylococcus aureus esxA gene deletion strain BEVs; scale bar is 100 nm; arrows indicate Staphylococcus aureus esxA gene deletion strain BEVs;
[0046] Figure 5Transmission electron micrograph of Staphylococcus aureus esxB gene deletion strain BEVs; scale bar is 500 nm; arrows indicate Staphylococcus aureus esxB gene deletion strain BEVs;
[0047] Figure 6 Transmission electron micrograph of Staphylococcus aureus esxB gene deletion strain BEVs; scale bar is 100 nm; arrows indicate Staphylococcus aureus esxB gene deletion strain BEVs;
[0048] Figure 7 This is the particle size-particle density distribution diagram of Newman wild strain BEVs;
[0049] Figure 8 This is the particle size-particle density distribution diagram of BEVs of Staphylococcus aureus esxA gene deletion strain;
[0050] Figure 9 This is the particle size-particle density distribution diagram of BEVs of Staphylococcus aureus esxB gene deletion strain;
[0051] Figure 10 The protein concentration bar graphs are for Newman wild-type strain BEVs, Staphylococcus aureus esxA gene-deficient strain BEVs, and Staphylococcus aureus esxB gene-deficient strain BEVs;
[0052] Figure 11 The cytotoxicity bar graphs are for Newman wild-type BEVs, Staphylococcus aureus esxA gene-deficient BEVs, and Staphylococcus aureus esxB gene-deficient BEVs;
[0053] Figure 12 This is the standard curve of BCA detection. DETAILED DESCRIPTION
[0054] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0055] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.
[0056] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.
[0057] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.
[0058] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0059] Example 1
[0060] 1. Construction of Staphylococcus aureus esxA / esxB deletion strain
[0061] 1.1 Extraction of Staphylococcus aureus genomic DNA
[0062] Staphylococcus aureus Newman strain (kindly donated by Professor Yu Liquan of the College of Life Science and Technology, Heilongjiang Bayi Agricultural University) was inoculated into Columbia blood agar medium for recovery and cultured in a constant temperature incubator at 37°C and 5% CO2 for 24 h. A single colony was picked and transferred to 10 mL of TSB nutrient broth (Qingdao Haibo Biotechnology Co., Ltd.) and placed in a constant temperature shaking incubator at 220 rpm and 37°C for 14 h.
[0063] Take 1 mL of the above bacterial solution into an EP tube and centrifuge at 12000 g to collect the bacteria.
[0064] 70 μL of lysozyme solution (the concentration of lysozyme in the solution is 50 mg / mL) was drawn into the above-mentioned EP tube and pipetted to mix well, so as to dissolve the bacterial wall of Staphylococcus aureus.
[0065] The above EP tube was placed in a metal bath at 37°C and incubated for 1 hour. Since the bacterial wall of Staphylococcus aureus is relatively thick, the wall breaking time can be appropriately extended.
[0066] The above EP tube was taken out, 20 μL of proteinase K solution (the concentration of proteinase K in the solution was 20 mg / ml) was drawn into the EP tube, and the mixture was mixed by pipetting.
[0067] Use a pipette to draw 220 μL of GB buffer into the EP tube, pipette and mix well, place in the metal bath again, and incubate at 70°C for 20 min.
[0068] After taking out the above EP tube, draw 220 μL of anhydrous ethanol into the EP tube and mix thoroughly by pipetting.
[0069] Transfer all the mixed liquid in the above EP tube into the centrifugal column, place the centrifugal column into the collection tube, and then centrifuge at 12000 rpm for 30 seconds. After the centrifugation is completed, discard the waste liquid in the collection tube.
[0070] 500 μL of GD buffer was added to the centrifugal column, and then centrifuged at 12000 rpm for 30 seconds. After the centrifugation, the waste liquid in the collection tube was discarded.
[0071] Pipette 600 μL PW buffer and add it to the centrifugal column, then centrifuge at 12000 rpm for 30 seconds. After centrifugation, discard the waste liquid in the collection tube. Repeat this step twice.
[0072] Place the centrifuge column in a centrifuge and centrifuge again at 12000 rpm for 2 minutes. After the centrifugation is complete, discard the waste liquid in the collection tube, then open the centrifuge column and let it stand at room temperature for about 20 minutes to allow the membrane inside the centrifuge column to dry.
[0073] Place the above-mentioned centrifuge column into a new EP tube, draw 125μLTE eluate and add it to the centrifuge column, let it stand at room temperature for 2min-5min, and then centrifuge it at 12000rpm for 2min. After the centrifugation is completed, discard the centrifuge column. The liquid in the EP tube is the extracted Staphylococcus aureus DNA.
[0074] 1.2. Amplification and fusion PCR of upstream and downstream homologous fragments of esxA / esxB genes
[0075] Using the above-extracted Staphylococcus aureus genomic DNA as a template, the upstream and downstream homologous fragments of the target gene were amplified respectively. The amplification primers are shown in Table 1, and the target fragments were excised and recovered.
[0076] To a 50 μL aliquot, 1.5 μL of each upstream and downstream homologous fragment (SEQ ID NO. 17-SEQ ID NO. 20, as shown in Table 4) (total DNA mass approximately 600 ng), 25 μL of 2× Pfu PCR Master-Mix, and 18 μL of ultrapure water were added for complementary extension to form a full-length fusion PCR product (intermediate product, the nucleotide sequence of which is shown as SEQ ID NO. 21-SEQ ID NO. 22, as shown in Table 4). The amplification system and procedure are shown in Tables 2 and 3.
[0077] 2 μL each of esxA primer (esxA-UF: TTACGGGCAAGGTTCAGACC, SEQ ID NO.25; esxA-DR: GTTCTTGAACGGCATCAGCA, SEQ ID NO.26) and esxB primer (esxB-UF: AAGCAGATGGTGGCAAGGTT, SEQ ID NO.27; esxB-DR: TGGTCAGCCATCGGTTGTAC, SEQ ID NO.28) were added to the above intermediate product, and the full-length fusion fragment was amplified according to the following reaction conditions: 94°C for 5 min; 94°C for 30 s, 55°C for 30 s, 72°C for 2 min, 30 cycles; 72°C for 7 min to obtain esxA fusion PCR products and esxB fusion PCR products. The nucleotides of the esxA fusion PCR product are shown in SEQ ID NO.21; the nucleotides of the esxB fusion PCR product are shown in SEQ ID NO.22.
[0078] Table 1 Detailed information of primers
[0079] name sequence SEQ ID NO. esxA upstream homologous fragment-F TCGTGTGTCCATCTTTGGCA 1 esxA upstream homologous fragment-R GTGAATAAAGACACCGGCGC 2 esxA downstream homologous fragment-F ACGTTGCTGAGTCTGGTTTGA 3 esxA downstream homologous fragment-R TCGCTGTATTGTGCTCGTCA 4 esxB upstream homologous fragment-F GCAAAGAGAAATGGACGGCC 5 esxB upstream homologous fragment-R TGTACGTCCTTTGCTGTGCT 6 esxB downstream homologous fragment-F TCGATACGATTGGGCGTGTT 7 esxB downstream homologous fragment-R TGGCAAATTCCGTACCCCAA 8 esxA fusion fragment-F TCGTGTGTCCATCTTTGGCA 9 esxA fusion fragment-R GTGAATAAAGACACCGGCGC 10 esxB fusion fragment-F GCAAAGAGAAATGGACGGCC 11 esxB fusion fragment-R TGTACGTCCTTTGCTGTGCT 12 pKORl-esxA-F TCGTGTGTCCATCTTTGGCA 13 pKORl-esxA-R GTGAATAAAGACACCGGCGC 14 pKORl-esxB-F GCAAAGAGAAATGGACGGCC 15 pKORl-esxB-R TGTACGTCCTTTGCTGTGCT 16
[0080] Table 2 Amplification system
[0081] Components Volume (μL) Upstream homologous fragment 1.5 Downstream homologous fragment 1.5 2×PfuPCRMaster—Mix 25 <![CDATA[ddH2O]]> 18 DNA template 4
[0082] Table 3 Amplification procedures
[0083]
[0084] Table 4 Nucleotide sequence information
[0085]
[0086]
[0087]
[0088]
[0089] 1.3 Construction of homologous recombination plasmid pKOR1-esxA / esxB
[0090] To a PCR tube, add 2 μL of BP Clonase™ II Enzyme Mix, 4 μL of fusion PCR product (approximately 300 ng of either esxA or esxB fusion PCR product), 1 μL of pKOR1 plasmid (approximately 150 ng, kindly provided by Professor Yu Fangyou of Shanghai Pulmonary Hospital), and 3 μL of TE buffer. Mix thoroughly and incubate at 25°C for 18 hours. Then, add 1 μL of 2 μg / μL Proteinase K solution and incubate at 37°C for 30 minutes to stop the BP reaction and obtain the BP reaction product. This BP reaction product was transformed into competent Escherichia coli DC10B cells (kindly provided by Professor Yu Fangyou of Shanghai Pulmonary Hospital). The entire transformed bacterial suspension was plated onto a solid LB plate containing ampicillin (100 μL / mL) and cultured overnight at 37°C. Plasmids were then extracted using a plasmid extraction kit (Axygen, USA). PCR verification was performed on the obtained plasmids using primers shown in SEQ ID NOs. 13 to 16. Correct knockout plasmids (pKOR1-esxA and pKOR1-esxB) were obtained. PCR reaction conditions were as follows: 94°C for 5 min; 94°C for 30 s, 60°C for 30 s, 72°C for 2 min, 30 cycles; and 72°C for 7 min. The reaction system is shown in Table 5.
[0091] Table 5 Reaction system
[0092] Components Volume (μL) Mixtap Enzyme 12.5μL Primers 0.5 μL × 2 (0.5 μL each for upstream and downstream primers) Plasmid template 1 μL <![CDATA[ddH2O]]> 10.5μL
[0093] 1.4. Construction of Staphylococcus aureus Newman strain knockout strain
[0094] (1) Preparation of Staphylococcus aureus Newman strain competent bacteria for electroporation
[0095] 1) Pick a single colony of Staphylococcus aureus Newman strain using a disposable inoculating loop, add 5 mL of TSB liquid medium, and culture overnight in a shaking incubator at 37°C and 220 rpm.
[0096] 2) The next day, add the solution to 100 mL of fresh TSB broth at a ratio of 1:100 and place in a shaking incubator at 37°C and 200 rpm until the OD 600 Rising to about 1.0.
[0097] 3) Aliquot the bacterial suspension into 50 mL sterile tubes. Place on ice for 30 minutes, then centrifuge at 4,500 rpm for 10 minutes at 4°C. Carefully remove the supernatant using a pipette.
[0098] 4) Add 40 mL of pre-chilled 0.5 M sucrose solution to each centrifuge tube. Vortex to mix thoroughly, then place on ice for 5 minutes. Centrifuge at 4500 rpm at 4°C for 10 minutes. Carefully remove the supernatant using a pipette. Wash three times with 0.5 M sucrose solution. Resuspend the pellet in 1 mL of pre-chilled 0.5 M sucrose solution to obtain electroporated S. aureus Newman strain competent bacteria. Aliquot 50 μL into each electroporation tube and store at -80°C.
[0099] (2) Electroconversion
[0100] 1) Mix approximately 0.5-1 μg of the knockout plasmid pKOR1-esxA or pKOR1-esxB with 50 μL of electroporation-competent Staphylococcus aureus Newman strain. After incubating on ice for 20 minutes, transfer the mixture to a pre-chilled 0.2 cm electroporation cuvette and allow to stand for 5-10 minutes for electroporation (voltage 2.5 kV, capacitance 25 μF, resistance 200 Ω).
[0101] 2) After electroporation, quickly add 1 mL of TSB liquid medium in a clean bench and incubate at 30°C, 150 rpm for 2 h. Then, spread the transformed bacteria onto TSB plates containing 10 μL / mL chloramphenicol and incubate at 30°C for 24 h.
[0102] (3) Screening and identification of deletion strains
[0103] 1) A single colony identified as positive by PCR was inoculated into 3 mL of TSB medium containing 10 μg / mL chloramphenicol (TSB Cm10 ) and cultured at 30°C overnight.
[0104] 2) Take 50mL TSB Cm10 The bacterial solution obtained in step 1) was diluted at a volume ratio of 1:100 and cultured at 42°C overnight.
[0105] 3) Take 50mL TSB Cm5 The bacterial solution obtained in step 2) was diluted with culture medium (TSB medium containing 5 μg / mL chloramphenicol) at a volume ratio of 1:100 and cultured at 42°C overnight.
[0106] 4) Dilute the bacterial solution obtained in step 3) and apply it on TSB Cm10 Plates were incubated overnight at 42°C. Single colonies were picked and placed in 5 mL of TSB medium and incubated overnight at 30°C.
[0107] 5) The bacterial solution 10 obtained in step 4) 4 The cells were diluted 1-fold and plated on TSB plates containing 1 μg / mL anhydrotetracycline (ATc) and cultured at 37°C for 24 h.
[0108] 6) Pick 50 colonies and inoculate them on ordinary TSB plates and TSB Cm10 Plates were incubated at 37°C overnight.
[0109] 7) Select 10 colonies growing exclusively on TSB plates for genomic DNA extraction, using the genome of the wild-type Newman strain (Staphylococcus aureus Newman) as a control. PCR reaction conditions are: 94°C for 5 minutes; 94°C for 30 seconds, 60°C for 30 seconds, 72°C for 3 minutes, 30 cycles; 72°C for 7 minutes. The PCR amplification system is as shown in Table 2. If the wild-type Newman strain amplifies a DNA fragment of the target size, but the knockout strain fails to amplify a DNA fragment of the target size, it indicates that the target gene has been successfully knocked out.
[0110] 2. Isolation and concentration of BEVs (extracellular vesicles) from wild-type Staphylococcus aureus, esxA gene-deficient Staphylococcus aureus, and esxB gene-deficient Staphylococcus aureus strains
[0111] 2.1. Preparation of Newman wild strain, Staphylococcus aureus esxA gene deletion strain, and Staphylococcus aureus esxB gene deletion strain culture medium The Newman wild strain, Staphylococcus aureus esxA gene deletion strain, and Staphylococcus aureus esxB gene deletion strain were inoculated into Columbia blood agar medium for recovery and incubated in a constant temperature incubator at 37°C and 5% CO2 for 24 hours. A single colony was picked and transferred to 10 mL of TSB nutrient broth (Qingdao Haibo Biotechnology Co., Ltd.) and placed in a constant temperature shaking incubator at 220 rpm and 37°C for 14 hours. After 14 hours of incubation, 4 mL of the cultured bacterial liquid was poured into 400 mL of TSB nutrient broth.
[0112] The cells were shaken in nutrient broth and placed in a 37°C, 5% CO2 constant temperature shaking incubator at 220 rpm and 37°C for 48 h.
[0113] 2.2. Centrifugal filtration, sterilization and enrichment of bacterial solution
[0114] The bacterial solution was centrifuged (7000 × g for 5 min), and the precipitate was discarded after centrifugation, retaining the supernatant. The supernatant was filtered for the first time using a 0.22 μm filter membrane. The filtrate was enriched and concentrated using an ultrafiltration cup (with a magnetic stirrer) to obtain concentrates of different strains. The enrichment and concentration multiple was 10-fold, the molecular weight cutoff was 100 kDa, the magnetic stirrer speed was 320-350 rpm, and a sterile nitrogen bottle was used to apply a certain pressure to the ultrafiltration cup. The pressure indicator was: the ultrafiltration cup waste liquid (liquid with a molecular weight less than 100 kDa) drip rate was 1 drop / 5-7 seconds.
[0115] 2.3. Ultra-high-speed centrifugation to obtain BEVs precipitation
[0116] The concentrates of the different strains were poured into separate ultracentrifuge tubes, brought to a volume of 29.9 mL with sterile PBS buffer, and the tubes were leveled. The tubes were then subjected to a first ultracentrifugation (centrifugation conditions: 4°C, 100,000 × g for 4 h). At the end of the centrifugation, the supernatant was discarded, the pellet was retained, and the pellet was resuspended in sterile PBS buffer. Ultracentrifugation was repeated (centrifugation conditions: 4°C, 100,000 × g for 1 h). At the end of the centrifugation, the supernatant was discarded, the pellet was retained, and each pellet was resuspended in 1 mL of sterile PBS buffer. Any clumps of pellet adhering to the tube walls were crushed with a disposable inoculating loop. The resuspended fractions were then filtered a second time to obtain BEVs of the Newman wild-type strain, the Staphylococcus aureus esxA gene-deficient strain, and the Staphylococcus aureus esxB gene-deficient strain, using a 0.22 μm filter membrane.
[0117] 3. BCA protein quantitative detection method to determine BEVs protein concentration
[0118] 25 μL of BEVs of Newman wild strain, Staphylococcus aureus esxA gene deletion strain and Staphylococcus aureus esxB gene deletion strain and 200 μL of BSA standard were respectively aspirated into 96-well microplate wells, and 3 parallel replicate wells were set for each sample. 200 μL of BCA working solution was added to each well, mixed thoroughly, and incubated at 37°C for 30 minutes. Cool to room temperature and measure the absorbance of each sample and BSA standard in the range of 540-590 nm using a microplate reader. Draw a standard curve. The BCA standard curve is as follows: Figure 12 As shown, the standard curve is: Y = 0.3209X + 0.1018, R 2 = 09972. The protein concentration in the sample was calculated using the standard curve. Figure 10 shown.
[0119] 4. Observation of BEVs morphological characteristics using transmission electron microscopy (TEM)
[0120] 20 μL of BEVs from the Newman wild-type strain, the Staphylococcus aureus esxA gene deletion strain, and the Staphylococcus aureus esxB gene deletion strain were pipetted onto a copper mesh grid on an electron microscope in a water droplet-like pattern. The cells were allowed to stand for 2 minutes. The cells were then negatively stained and fixed with phosphotungstic acid solution for 10 minutes and allowed to dry at room temperature. The cells were then observed and photographed under a transmission electron microscope.
[0121] 5. Nanoparticle Tracking Analysis (NTA) technology to analyze BEVs particle characteristics
[0122] The BEVs of Newman wild-type strain, Staphylococcus aureus esxA gene deletion strain and Staphylococcus aureus esxB gene deletion strain were diluted 100-fold, 1000-fold and 10000-fold respectively with sterile PBS buffer. The sample pool of the analyzer was cleaned with 10 mL of sterile buffer and 1 mL of the diluted sample was drawn and loaded. The particle density was selected at 10 6 -10 7 Data statistics and analysis are performed on dilutions within the specified range.
[0123] 6. CCk-8 detection of BEVs cytotoxicity
[0124] The density is 5×10 3 A549 cells were seeded into 96-well plates at a specific cell density, and 1 mL of DMEM medium containing 10% FBS was added to each well. The cells were cultured at 37°C and 5% CO2 for 24 h. BEVs of the Newman wild-type strain, the esxA gene deletion strain, and the esxB gene deletion strain of S. aureus were added to the 96-well plates at concentrations of 10 μg / mL and 30 μg / mL, respectively. These were designated as: Nm-10 μg / mL group, Nm-30 μg / mL group, esxA deletion strain-10 μg / mL group, esxA deletion strain-30 μg / mL group, esxB deletion strain-10 μg / mL group, and esxB deletion strain-30 μg / mL group. Three replicate wells were set for each sample. A control group without BEVs and a blank group without BEVs and cells were also set up. The cells were cultured for another 24 h. Add 10 μL of CCK-8 reagent to each well and incubate at 37°C, 5% CO₂ for 1 hour. Measure the absorbance (OD value) of each well using a microplate reader (450 nm wavelength). Calculate cell viability based on the OD value of each group: Cell viability (%) = OD value of treatment group - OD value of blank group / OD value of control group - OD value of blank group.
[0125] 8. Results
[0126] Electron microscopic images of Newman wild-type BEVs Figure 1 and Figure 2 As shown, the electron micrograph of Staphylococcus aureus esxA gene deletion strain BEVs is shown in Figure 3 and Figure 4 The electron micrograph of Staphylococcus aureus esxB gene deletion strain BEVs is shown in Figure 2. Figure 5 and Figure 6 The results showed that the particle density of Staphylococcus aureus esxA gene deleted strain BEVs and Staphylococcus aureus esxB gene deleted strain BEVs was significantly higher than that of Newman wild strain BEVs.
[0127] The particle size-particle density distribution of Newman wild strain BEVs is shown in the figure. Figure 7 The results showed that the particle concentration of Newman wild-type BEVs was 1.3E+10 particles / mL, the average particle size was 141.2 nm, and the main particle size distribution range of Newman wild-type BEVs was 79.6 nm to 212.1 nm.
[0128] The particle size-particle density distribution of BEVs of Staphylococcus aureus esxA gene deletion strain is shown in the figure. Figure 8 The results showed that the particle concentration of the Staphylococcus aureus esxA gene deletion strain BEVs was 6.9E+10 particles / mL, the average particle size was 148.4 nm, and the main particle size distribution range of the Staphylococcus aureus esxA gene deletion strain BEVs was 81.0 nm-213.8 nm.
[0129] The particle size-particle density distribution of BEVs of Staphylococcus aureus esxB gene deletion strain is shown in the figure. Figure 9 The results showed that the particle concentration of the Staphylococcus aureus esxB gene deletion strain BEVs was 2.9E+10 particles / mL, the average particle size was 142.7 nm, and the particle size distribution range of the Staphylococcus aureus esxB gene deletion strain BEVs was 83.5 nm-209.3 nm.
[0130] The protein concentrations of Newman wild-type BEVs, Staphylococcus aureus esxA gene-deficient BEVs, and Staphylococcus aureus esxB gene-deficient BEVs were as follows: Figure 10 The results showed that the protein concentrations of the Staphylococcus aureus esxA gene deletion strain BEVs and Staphylococcus aureus esxB gene deletion strain BEVs (1156.7 μg / mL and 633.2 μg / mL) were significantly higher than the protein concentration of the Newman wild-type strain BEVs (256.5 μg / mL).
[0131] The cytotoxicity of Newman wild strain BEVs, Staphylococcus aureus esxA gene deleted strain BEVs and Staphylococcus aureus esxB gene deleted strain BEVs was detected using cck-8, and the results were presented as cell survival rate, as shown in Figure 2. Figure 11The results showed that the cytotoxicity of Staphylococcus aureus esxA gene-deficient strain BEVs and Staphylococcus aureus esxB gene-deficient strain BEVs at different concentration gradients (10 μg / mL, 30 μg / mL) was not significantly different from that of Newman wild-type strain BEVs. The cell survival rates of the Nm-10 μg / mL group were 95%; the cell survival rates of the Nm-30 μg / mL group were 99%; the cell survival rates of the esxA-deficient strain-10 μg / mL group were 96%; the cell survival rates of the esxA-deficient strain-30 μg / mL group were 100%; the cell survival rates of the esxB-deficient strain-10 μg / mL group were 99%; and the cell survival rates of the esxB-deficient strain-30 μg / mL group were 99%.
[0132] In summary, the gene knockout method and extracellular vesicle extraction method for Staphylococcus aureus provided herein can produce Newman wild-type BEVs, Staphylococcus aureus esxA gene-deficient BEVs, and Staphylococcus aureus esxB gene-deficient BEVs. Transmission electron microscopy, nanoparticle tracking analysis, and BCA protein quantification were used to analyze and compare the morphological characteristics, average particle size, particle density, and protein content of Newman wild-type BEVs, Staphylococcus aureus esxA gene-deficient BEVs, and Staphylococcus aureus esxB gene-deficient BEVs. The results showed that Newman wild-type BEVs, Staphylococcus aureus esxA gene-deficient BEVs, and Staphylococcus aureus esxB gene-deficient BEVs all exhibited a spherical structure with a clear double membrane under transmission electron microscopy. Furthermore, the average particle size of the three groups of BEVs was not significantly different. However, the average particle density of Staphylococcus aureus esxA / esxB gene-deficient BEVs was greater than that of Newman wild-type BEVs. BCA protein quantification also showed that the protein concentration of BEVs from the esxA / esxB gene-deficient strain of S. aureus was significantly higher than that of the Newman wild-type strain. Furthermore, the CCK-8 assay revealed that the cytotoxicity of BEVs from the esxA / esxB gene-deficient strain of S. aureus was not significantly different from that of the Newman wild-type strain at different concentrations.
[0133] The method of the present invention shows that the particle density and protein content of the BEVs of the esxA / esxB gene-deficient Staphylococcus aureus are significantly higher than those of the Newman wild strain BEVs. This result is consistent with the results of electron microscopy technology. The extracellular vesicles of the gene-deficient strain obtained are of high purity and have low toxicity to host cells, and have the advantage of wide practicality.
[0134] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.
Claims
1. A Staphylococcus aureus esx gene deletion strain, characterized in that: The esx gene of Staphylococcus aureus is knocked out by homologous recombination technology; the esx gene includes the esxA gene or the esxB gene; the nucleotide sequence of the esxA gene is shown in SEQ ID NO.23; the nucleotide sequence of the esxB gene is shown in SEQ ID NO.
24.
2. The method for constructing the Staphylococcus aureus esx gene deletion strain according to claim 1, characterized in that: The following steps are involved: (1) Extraction of genomic DNA of Staphylococcus aureus Newman strain; (2) PCR amplification was used to obtain the upstream and downstream homology arms of the Staphylococcus aureus esx gene; (3) PCR amplification was used to obtain the fusion fragment of the upstream and downstream homology arms of the Staphylococcus aureus esx gene; (4) Recombining the fusion fragment and the pKOR1 plasmid to construct the homologous recombination plasmid pKOR1-esx; (5) The homologous recombination plasmid pKOR1-esx was electroporated into a wild-type Staphylococcus aureus strain to obtain a Staphylococcus aureus esx gene-deficient strain.
3. The construction method according to claim 2, characterized in that In step (2), when the esx gene is the esxA gene, the primer pair used for PCR amplification of the upstream homology arm of the esxA gene includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.2, and the primer pair used for PCR amplification of the downstream homology arm of the esxA gene includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.4; when the esx gene is the esxB gene, the primer pair used for PCR amplification of the upstream homology arm of the esxB gene includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.6, and the primer pair used for PCR amplification of the downstream homology arm of the esxB gene includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.7 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.8; In step (3), when the fusion fragment is an esxA gene fusion fragment, the primer pair used for PCR amplification includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.9 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.10; when the fusion fragment is an esxB gene fusion fragment, the primer pair used for PCR amplification includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.11 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.
12.
4. A method for preparing extracellular vesicles of an esx gene-deficient strain of Staphylococcus aureus, characterized in that: The preparation method comprises the following steps: (1) Extraction of genomic DNA of Staphylococcus aureus Newman strain; (2) PCR amplification was used to obtain the upstream and downstream homology arms of the Staphylococcus aureus esx gene; (3) PCR amplification was used to obtain the fusion fragment of the upstream and downstream homology arms of the Staphylococcus aureus esx gene; (4) Recombining the fusion fragment and the pKOR1 plasmid to construct the homologous recombination plasmid pKOR1-esx; (5) electroporating the homologous recombination plasmid pKOR1-esx into a wild-type Staphylococcus aureus strain to obtain a Staphylococcus aureus esx gene-deficient strain; (6) The Staphylococcus aureus esx gene deletion strain is subjected to ultracentrifugation and filtration to obtain Staphylococcus aureus extracellular vesicles.
5. The preparation method according to claim 4, characterized in that In step (2), when the esx gene is the esxA gene, the primer pair used for PCR amplification of the upstream homology arm of the esxA gene includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.2, and the primer pair used for PCR amplification of the downstream homology arm of the esxA gene includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.4; when the esx gene is the esxB gene, the primer pair used for PCR amplification of the upstream homology arm of the esxB gene includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.6, and the primer pair used for PCR amplification of the downstream homology arm of the esxB gene includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.7 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.8; In step (3), when the fusion fragment is an esxA gene fusion fragment, the primer pair used for PCR amplification includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.9 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.10; when the fusion fragment is an esxB gene fusion fragment, the primer pair used for PCR amplification includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.11 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.
12.
6. Extracellular vesicles of the Staphylococcus aureus esx gene deleted strain obtained by the preparation method according to claim 4 or 5.
7. Use of the extracellular vesicles of the Staphylococcus aureus esx gene deleted strain according to claim 6 in any of the following: (1) preparing a drug delivery vehicle; (2) preparing vaccines; (3) Preparation of functional drugs; (4) Production of extracellular vesicles from Staphylococcus aureus esx gene deletion strain; (5) Prepare a product for producing extracellular vesicles of the Staphylococcus aureus esx gene deleted strain.
8. A drug delivery system, characterized in that The drug delivery system comprises the extracellular vesicles of the Staphylococcus aureus esx gene deletion strain according to claim 6 and an exogenous drug; The exogenous drugs include proteins, nucleic acids or small molecule drugs.
9. Use of the esx gene in promoting extracellular vesicle secretion of Staphylococcus aureus, characterized in that: By knocking out the esx gene in Staphylococcus aureus, the secretion of extracellular vesicles from Staphylococcus aureus is promoted; The esx gene includes the esxA gene or the esxB gene; the nucleotide sequence of the esxA gene is shown in SEQ ID NO.23; the nucleotide sequence of the esxB gene is shown in SEQ ID NO.
24.
10. A method for promoting the secretion of extracellular vesicles of Staphylococcus aureus, characterized in that: The method comprises the steps of knocking out the esx gene in Staphylococcus aureus, ultracentrifuging and filtering the obtained strain to obtain extracellular vesicles of Staphylococcus aureus; The esx gene includes the esxA gene or the esxB gene; the nucleotide sequence of the esxA gene is shown in SEQ ID NO.23; the nucleotide sequence of the esxB gene is shown in SEQ ID NO.24.
Citation Information
Patent Citations
Immune protection application of staphylococcus aureus EsxA protein
CN104873964A
Staphylococcus aureus membrane vesicle, and preparation method and application thereof
CN112402601A
Method for increasing yield of staphylococcus aureus membrane bubbles and application of method
CN117568248A
Staphylococcus aureus antigens
US20150259388A1
Compositions for immunising against staphylococcus aureus
WO2015144691A1