Brown planthopper lethal dsRNA and application

By designing and synthesizing the dsRNA of the lethal gene fragment of brown planthopper, and using microinjection technology to interfere with its lethal gene expression, the drug resistance and environmental pollution caused by chemical pesticides are solved, and the sustainability and safety of pest control are achieved.

CN120519459AActive Publication Date: 2025-08-22ZHEJIANG UNIV
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202510708588.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-29
Publication Date
2025-08-22
Estimated Expiration
2045-05-29

AI Technical Summary

Technical Problem

Chemical pesticides lead to drug resistance, environmental pollution and harm to non-target organisms in the process of preventing and controlling brown planthoppers, affecting the sustainability of the agricultural ecological environment, and need to find targeted and sustainable prevention and control strategies.

Method used

Using RNA interference technology, the dsRNA of the lethal gene fragment of brown planthopper Nlug001039.1 was designed and synthesized, and introduced it into the body of brown planthopper by microinjection, interfering with its lethal gene expression and achieving pest control.

Benefits of technology

Effectively killing brown planthoppers has good environmental ecological safety and food safety, and provides a new strategy for RNA interference technology in pest control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

The invention relates to the technical field of agricultural insect and pest control, in particular to brown planthopper lethal dsRNA and application. The gene segment Nlug001039.1 capable of causing death of the brown planthopper after interference is screened out, the brown planthopper can be effectively killed by injecting the dsRNA (SEQ ID NO.4) of the gene segment, and the gene segment has good environmental ecological safety and food safety. The invention establishes a new way for controlling the brown planthopper by using the RNA interference technology.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of agricultural pest control, in particular to brown planthopper lethal dsRNA and its application. Background Art

[0002] The brown planthopper (Brown Planthopper), a common rice planthopper, is currently the primary pest of rice in many Asian countries. An outbreak can cause severe losses to rice production. Chemical pesticides have long been the primary means of controlling brown planthoppers. However, with overuse, problems such as pesticide resistance, environmental pollution, and damage to non-target organisms have become increasingly prominent, seriously impacting the sustainability of agricultural ecosystems. RNA interference (RNAi), an emerging molecular biology tool, has shown significant potential in agricultural pest control due to its high specificity, low toxicity, and broad application prospects. RNAi targets and degrades the mRNA of pest genes through the expression of specific double-stranded RNA (dsRNA), thereby inhibiting the expression of specific genes and disrupting the physiological functions of the pest, achieving pest control. Compared with traditional chemical control methods, RNAi is highly targeted and can reduce negative impacts on the environment and non-target organisms. Therefore, the development of targeted and sustainable strategies for controlling brown planthoppers is of great significance.

[0003] In view of this, the present invention is proposed. Summary of the Invention

[0004] In order to solve the above technical problems, the present invention provides a brown planthopper lethal dsRNA and its application.

[0005] Specifically, the technical solutions provided by the present invention are as follows: In a first aspect, the present invention provides a dsRNA of the brown planthopper lethal gene fragment Nlug001039.1, the nucleotide sequence of the dsRNA is shown in SEQ ID NO.4.

[0006] In a second aspect, the present invention provides a method for preparing the dsRNA, which is prepared by a method comprising the following steps: reverse transcribing the total RNA of the brown planthopper into cDNA, using the cDNA as a template and the primer pair shown in SEQ ID No. 2 and SEQ ID No. 3 to perform PCR amplification, and in vitro transcribing the PCR amplification product into the dsRNA.

[0007] In a third aspect, the present invention provides another method for preparing the dsRNA, which is prepared by a method comprising the following steps: using the gene fragment shown in SEQ ID No. 1 as a template, using the primer pair shown in SEQ ID No. 5 and SEQ ID No. 6 to perform PCR amplification, and in vitro transcribing the PCR amplification product to synthesize the dsRNA.

[0008] In a fourth aspect, the present invention provides a biological material comprising the dsRNA as described in SEQ ID NO. 4 or a gene encoding the dsRNA.

[0009] Preferably, the biological material is a nucleic acid sequence, a recombinant vector or a host cell.

[0010] In a fifth aspect, the present invention provides use of the dsRNA or the biological material in controlling brown planthoppers or preparing products for controlling brown planthoppers.

[0011] In a sixth aspect, the present invention provides a method for controlling brown planthoppers, which kills brown planthoppers by interfering with a brown planthopper lethal gene fragment, wherein the brown planthopper lethal gene fragment is Nlug001039.1, and its nucleotide sequence is shown in SEQ ID NO.1.

[0012] Preferably, the present invention utilizes dsRNA to interfere with the lethal gene fragment of brown planthopper, and the nucleotide sequence of the dsRNA is shown as SEQ ID NO.4.

[0013] Preferably, the dsRNA is interfered by microinjection, and the concentration of the microinjected dsRNA is 150-350 μg / mL.

[0014] In a seventh aspect, the present invention provides a preparation for controlling brown planthoppers, which contains the biological material according to claim 4 or 5 and can effectively kill brown planthoppers by microinjection or the like. Beneficial effects

[0015] The present invention provides a brown planthopper lethal dsRNA and its application. The present invention screens for a gene fragment, Nlug001039.1, that can cause brown planthopper lethality after interference. Using dsRNA derived from this gene fragment (SEQ ID NO. 4) for injection into brown planthoppers effectively kills the insects while maintaining good environmental and food safety. This invention establishes a new approach to controlling brown planthoppers using RNA interference technology. DETAILED DESCRIPTION

[0016] The present invention utilizes the transcriptome of brown planthoppers to screen target genes through gene co-expression network analysis, and discovers an important target gene (brown planthopper lethal gene fragment Nlug001039.1) that can cause the death of brown planthoppers after interference. At the same time, the dsRNA of the lethal gene fragment Nlug001039.1 and its synthesis method are provided, providing a sequence and data basis for establishing a new strategy for controlling pests using RNA interference technology.

[0017] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions of the present invention are described clearly and completely below. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

[0018] The endpoints and any values ​​of the ranges disclosed in this specification are not limited to the exact ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be considered to be specifically disclosed herein.

[0019] In the description of this specification, the reference terms "one embodiment", "some embodiments", "specific implementation methods", or "some specific implementation methods" and the like mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the embodiments of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.

[0020] Unless otherwise specified, the materials and reagents used in the following examples are all commercially available. Experimental methods without specific conditions specified in the examples are generally performed under conventional conditions or the conditions recommended by the manufacturer.

[0021] The sequences involved in the following embodiments include: SEQ ID NO.1:

[0022] SEQ ID NO.2: TGGAACATGGTGCTCGAATA.

[0023] SEQ ID NO.3: ACAGGTTAATGGCGTTCAGG.

[0024] SEQ ID NO.4: GGATGGAACATGGTGCTCGAATACCTGATAGGTACGTCGGCGTGCGCATGCGCGTTGTCGGCCTGCTTTGATGCGTTGACCGACGGCGCCATCAGCAGTTTAGTCACCGAGTCCGTCGGAACTTTCTTTGGTCGGCCACCTGACTTTTTAGCGTTTGTGATAACGCTGCTGATGATGCTG TTGATGGCAGCCGGGGTGAAGAAGTCGCTGGTCTTCAACAACATCCTGAACGCCATTAACCTGTCAGCGTGGGTGTTCGTCATGACAGCTGGCATGTTCTACGTGAACACGGCCAACTGGTCAGAGCACAAGGGCTTCCTACCATACGGCTGGTCCGGGGTGTTCACGGGAGCAGCGACT.

[0025] SEQ ID NO.5: TAATACGACTCACTATAGGGTGGAACATGGTGCTCGAATA.

[0026] SEQ ID NO.6: TAATACGACTCACTATAGGGACAGGTTAATGGCGTTCAGG. Example 1

[0027] Cloning of Nlug001039.1 gene fragment: Total RNA from brown planthopper was extracted using Trizol method.

[0028] RNA was reverse transcribed using the HiScript II Q Select RT SuperMix for qPCR kit produced by Vazyme.

[0029] The cDNA obtained by reverse transcription was diluted 10 times with RNase-free H2O and used in the subsequent PCR reaction. The PCR primer sequences are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0030] DNA fragments were recovered using the FastPure Gel DNA Extraction Mini Kit produced by Vazyme.

[0031] DNA clones were obtained by ligation using the pMD™19-T Vector Cloning Kit produced by Takara and transformation of competent E. coli DH5α cells. Example 2

[0032] dsRNA synthesis of Nlug001039.1 gene fragment: Enter the target gene sequence at https: / / www.flyrnai.org / cgi-bin / RNAi_find_primers.pl to design primers. Try to limit the product length to around 350 bp and add the T7 promoter sequence: 5'-TAATACGACTCACTATAGGG-3' to the 5' end. The primer sequences are shown in SEQ ID NO. 5 and SEQ ID NO. 6.

[0033] This example uses the Novagen T7 RNAi Transcription Kit. Example 3

[0034] Microinjection of dsRNA into brown planthoppers: (1) Preparation of the gel base for microinjection: Prepare 2% agarose gel and fully melt it under high temperature. Then, pour the melted agarose gel into a sterile culture dish, ensuring that its thickness is uniform and sufficient to cover the toothpick and capillary placed in it, so as to form a groove suitable for a specific age of brown planthopper. After the agarose is completely cooled and solidified, gently remove the toothpick and capillary, leaving a groove on the gel base that matches the insect body shape to provide a stable support for subsequent microinjection.

[0035] (2) Drawing capillary needles for injection: Use a P-97 Micropipette Puller microinjection needle puller for drawing. The material used is a microelectrode glass capillary (B10024F) produced by Chengdu Weitan Scientific Instruments. Set the drawing program parameters according to the experimental requirements: the heating temperature (Heat) is set to 650, the pulling force (Pull) is set to 300, the pulling speed (Vel) is set to 150, and the heating time (Time) is set to 150ms.

[0036] (3) Microinjection: Inject the dsRNA liquid into a capillary needle and fix it on the microinjector. Use a blade to cut the needle into the appropriate thickness and length according to the age of the brown planthopper. Use the joystick to control the mechanical arm of the injection instrument to insert the capillary needle into the middle of the thorax between the hind legs of the brown planthopper. Then inject the dsRNA. The brown planthopper's abdomen will be slightly swollen during the injection. In addition to injecting the dsRNA of the target gene, dsGFP is also injected as a control group. Each group is repeated for 50 heads, and the injection dsRNA concentration is about 150–350 μg / ml.

[0037] (4) Phenotypic observation: The injected brown planthopper nymphs were immediately transferred to glass test tubes containing fresh rice plants for rearing, and their mortality within 8 days was counted. The results are shown in Table 1.

[0038] Table 1

[0039] As shown in Table 1, the injection of dsRNA of Nlug001039.1 had a significant lethal effect on brown planthoppers.

[0040] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. dsRNA of the brown planthopper lethal gene fragment Nlug001039.1, characterized in that: The nucleotide sequence of the dsRNA is shown in SEQ ID NO.

4.

2. The method for preparing dsRNA according to claim 1, characterized in that: The method comprises the following steps: reverse transcribing the total RNA of brown planthopper into cDNA, using the cDNA as a template and the primer pair shown in SEQ ID No. 2 and SEQ ID No. 3 for PCR amplification, and in vitro transcribing the PCR amplification product into the dsRNA.

3. The method for preparing dsRNA according to claim 1, characterized in that: The preparation method comprises the following steps: using the gene fragment shown in SEQ ID No. 1 as a template, using the primer pair shown in SEQ ID No. 5 and SEQ ID No. 6 to perform PCR amplification, and in vitro transcribing the PCR amplification product into the dsRNA.

4. Biomaterial, characterized in that It contains the dsRNA as described in SEQ ID NO. 4 or its encoding gene.

5. The biomaterial according to claim 4, characterized in that The biological material is a nucleic acid sequence, a recombinant vector or a host cell.

6. Use of the dsRNA according to claim 1 or the biological material according to claim 4 or 5 in controlling brown planthoppers or preparing products for controlling brown planthoppers.

7. A method for controlling brown planthoppers, which kills brown planthoppers by interfering with the lethal gene fragment of brown planthoppers, characterized in that: The brown planthopper lethal gene fragment is Nlug001039.1, and its nucleotide sequence is shown in SEQ ID NO.

1.

8. The method for controlling brown planthopper according to claim 7, characterized in that: The interference with the lethal gene fragment of brown planthopper is achieved by using dsRNA, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO.

4.

9. The method for controlling brown planthopper according to claim 7 or 8, characterized in that: dsRNA interference is performed by microinjection, and the concentration of microinjected dsRNA is 150-350 μg / mL.

10. A preparation for controlling brown planthopper, characterized in that: It contains the biomaterial according to claim 4 or 5.

Citation Information

Patent Citations

  • Planthopper lethal gene segment

    CN109321579A

  • Lethal gene fragment Ribosomal protein L19 of laodelphax striatellus and application thereof

    CN109468328A

  • Application of brown planthopper PHD gene or coded protein as target spot in preparation of medicine for preventing and treating brown planthopper

    CN115927353A

  • Laodelphax striatellus lethal gene segment and application thereof

    CN116396966A

  • Brown planthopper NlNPF gene and application of dsRNA of brown planthopper NlNPF gene in prevention and treatment of brown planthopper

    CN116555277A