Brassica oleracea susceptible gene BPM6 and application thereof in breeding for disease resistance of brassica oleracea

By improving the CRISPR/Cas9 gene editing technology, selecting the PAM sequence as 5’-NGGT-3’ and introducing the GRF5-GIF1-GRF5 fusion protein, the problem of low gene editing efficiency of kale CRISPR/Cas9 is solved, and efficient disease-resistant breeding of kale is achieved.

CN120519474AActive Publication Date: 2025-08-22INSTITUTE OF VEGETABLES & FLOWERS CHINESE ACADEMY OF AGRICULTURAL SCIENCES +2
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510590466.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-11-13
Filing Date
2025-05-08
Publication Date
2025-08-22
Estimated Expiration
2045-05-08

AI Technical Summary

Technical Problem

The CRISPR/Cas9 gene editing efficiency of kale is low, resulting in limited disease-resistant breeding efficiency, making it difficult to meet the high-demand facility cultivation and off-season cultivation needs.

Method used

By improving CRISPR/Cas9 gene editing technology, the PAM sequence was selected as 5’-NGGT-3’, and the expression fusion protein GRF5-GIF1-GRF5 was introduced to improve gene editing efficiency and regeneration efficiency, and knock out or inhibit the expression of the kale-sensitized gene BPM6.

Benefits of technology

It significantly improves the disease resistance of kale, improves gene editing efficiency and regeneration efficiency, so that kale material can obtain broad-spectrum disease resistance and improves breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120519474A_ABST
    Figure CN120519474A_ABST
Patent Text Reader

Abstract

The invention relates to a brassica oleracea susceptible gene BPM6 and an application method thereof in brassica oleracea disease resistance breeding, and belongs to a biological breeding technology, and the application method comprises the following steps: (1) carrying out gene editing on the BPM6 gene in a target brassica oleracea material, and knocking out or inactivating the gene; the nucleotide sequence of the brassica oleracea susceptible gene BPM6 is as shown in Seq ID No. 1; and (2) screening the brassica oleracea material with the BPM6 gene edited, and performing regeneration culture to obtain the brassica oleracea germplasm material with improved disease resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a cabbage disease susceptibility gene BPM6 and its application in cabbage disease resistance breeding. Background Art

[0002] Brassica oleracea is an important biennial herbaceous species in the Brassicaceae family. Cruciferous crops, such as cabbage, broccoli, and cauliflower, are cultivated on 3.77 million hectares worldwide, constituting a significant agricultural resource (Li et al., 2021).

[0003] With the change of consumer demand, the area of ​​facility cultivation and off-season cultivation has been expanding year by year, which has put forward higher requirements for cabbage varieties. For example, in terms of disease resistance, the north mainly requires resistance to black rot, viral disease, downy mildew and dry heart, while the south mainly requires resistance to black rot, clubroot, soft rot, sclerotinia, etc. (See reference: Si Jun, Li Chengqiong, Ren Xuesong. Research progress and prospects of disease-resistant cabbage breeding in my country. Northern Horticulture, 2001(1):10-12).

[0004] Molecular breeding is an ideal means of disease-resistant breeding, provided that genes related to disease susceptibility are developed and obtained.

[0005] Gene editing technology is a highly efficient molecular breeding tool. In recent years, CRISPR / Cas9 has been widely applied to major crops such as rice, wheat, and potatoes. This technology can be used to develop high-yield, disease-resistant, or stress-tolerant crops by inhibiting gene expression (Gao, 2021; He et al., 2022). However, the current low regeneration efficiency of cabbage (B. oleracea) limits the efficiency of Agrobacterium-mediated transformation to less than 1.0%, which in turn affects the efficiency of CRISPR / Cas9 gene editing. Compared to the 68% editing efficiency of rice, the editing efficiency of cabbage (B. oleracea) is low, at only 12.9% (Li et al., 2021). Therefore, it is necessary to improve gene editing technology to facilitate its application in breeding cabbage for efficient and disease-resistant varieties. Summary of the Invention

[0006] In view of the needs and current status of this field, the inventors, based on their research results, request protection for the cabbage susceptibility gene BPM6 and its application in cabbage disease resistance breeding, as follows:

[0007] In the first aspect of the present invention, protection is sought for the artificial sequence of the cabbage susceptibility gene BPM6, the nucleotide sequence of which is shown in SeqID No.27.

[0008] The second aspect of the present invention is to protect a method for breeding disease-resistant cabbage based on the cabbage susceptible gene BPM6, which is characterized by comprising the following steps:

[0009] (1) performing gene editing on the BPM6 gene in the target cabbage material to knock out or inactivate the gene, or inhibit the expression of the gene; the nucleotide sequence of the cabbage susceptibility gene BPM6 is shown in Seq ID No. 47;

[0010] (2) Screening cabbage materials with edited BPM6 genes for regeneration culture to obtain cabbage germplasm materials with improved disease resistance.

[0011] Preferably, the method is characterized in that the gene editing refers to introducing a CRISPR / Cas9 gene editing vector into the target cabbage material;

[0012] Among them, the sgRNA sequence of the CRISPR / Cas9 gene editing vector is taken from the BPM6 gene coding region sequence shown in Seq ID No.48.

[0013] Preferably, the method is characterized in that the sgRNA sequence of the CRISPR / Cas9 gene editing vector is shown as Seq ID No.49.

[0014] Preferably, the method is characterized in that the PAM sequence of the CRISPR / Cas9 gene editing vector is 5'-NGGT-3', wherein N is one of A, C, and G.

[0015] Preferably, any of the above methods is characterized in that it further comprises introducing an expression vector expressing the fusion protein GRF5-GIF1-GRF5 while performing gene editing on the target cabbage material;

[0016] The amino acid sequence of the fusion protein GRF5-GIF1-GRF5 is as follows (1) or (2):

[0017] (1) From N to C terminus, the GRF5-1 polypeptide shown in Seq ID No. 33, the GIF1 polypeptide shown in Seq ID No. 37, and the GRF5-2 polypeptide shown in Seq ID No. 34 were linearly fused; the polypeptides were connected by 3 to 5 alanine residues;

[0018] (2) From N to C terminus, the amino acid sequence is a linear fusion of the GRF5-2 polypeptide shown in Seq ID No. 34, the GIF1 polypeptide shown in Seq ID No. 37, and the GRF5-1 polypeptide shown in Seq ID No. 33; the polypeptides are connected by 3 to 5 alanine residues;

[0019] Preferably, the amino acid sequence of the fusion protein GRF5-GIF1-GRF5 is shown in Seq ID No.38, and its coding sequence is shown in Seq ID No.41.

[0020] In another aspect of the present invention, protection is sought for a cabbage material in which the BPM6 gene is edited obtained by any of the above methods according to any one of the claims, characterized in that the cabbage material refers to cells and / or tissues.

[0021] Another aspect of the present invention seeks protection for a CRISPR / Cas9 gene editing vector, characterized in that the sgRNA sequence therein is taken from the BPM6 gene coding region sequence shown in Seq ID No.48.

[0022] Preferably, the gene editing vector is characterized in that the sgRNA sequence is shown as Seq ID No.49.

[0023] Preferably, the gene editing vector is characterized in that its PAM sequence is 5'-NGGT-3', wherein N is one of A, C, and G.

[0024] The present invention amplified the cabbage disease susceptibility gene BPM6 (Seq ID No. 47) in cabbage, and inhibited the expression of the BPM6 gene through a gene editing method. The present invention obtained a transgenic cabbage material with significantly improved disease resistance. Compared with wild-type cabbage, the disease index of bobpm6 plants inoculated with wilt, black rot, and clubroot decreased from 65.4 to 14.5 (significant), from 53.8 to 20.9 (significant), and from 63.1 to 55.7, respectively. Figure 6 .

[0025] Based on the characteristics of this gene, the most important aspect of the present invention is to provide the application of the above-mentioned cabbage disease-susceptibility gene BPM6 in disease-resistant breeding, that is, to obtain cabbage materials in which the BPM6 gene is edited through a gene editing method, thereby inhibiting the expression of the BPM6 gene. New varieties with broad-spectrum disease resistance can be obtained by cultivating these materials.

[0026] The present invention also improves gene editing and genetic transformation methods. Experimental data show that replacing the last position of the PAM sequence 5'-NGG-3' in the CRISPR / Cas9 vector with a 'T' significantly increases the number of edits made by the CRISPR / Cas9 gene editing system and improves editing efficiency. Furthermore, expressing the fusion protein GRF5-GIF1-GRF5 increased the average regeneration efficiency of cabbage by 55.2%. These technical improvements enable the efficient application of the cabbage susceptibility gene BPM6 in disease resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1Schematic diagram of the PDS gene editing vector structure constructed in the present invention to study the effects of different PAM sequences on gene editing efficiency and type;

[0028] Figure 2 Experimental results on the effects of different PAM sequences on rice gene editing efficiency and type, among which,

[0029] The upper figure shows rice plants in which the OsPDS gene was knocked out using NGGN and NGGT as PAM sequences. The red circles indicate plants that did not undergo gene editing. The lower figure shows the rice OsPDS gene editing efficiency (bar chart) and editing type (line chart). Figure 3 Experimental results on the effects of different PAM sequences on cabbage gene editing efficiency and type, among which,

[0030] The upper figure shows the situation of knocking out the BoPDS gene using NGGN and NGGT as PAM sequences. Mock represents a cabbage plant without gene editing. The lower figure shows the cabbage gene editing efficiency (bar chart) and editing type (line chart).

[0031] Figure 4 This is the research result of the present invention on the influence of growth condition factors on genetic transformation regeneration efficiency, wherein, in the treatment of expressing GRF5-GIF1-GRF5 fusion protein, the average regeneration efficiency of cabbage was increased by 55.2%.

[0032] Figure 5 The structure of the BoBPM6 gene cloned in the present invention and the gene editing status are shown, where light pink represents the gene coding region (exon), dark pink represents the intron region, and the red short underline target 1 at the bottom of the first exon region represents the sgRNA target region; the nucleotide sequence below represents target region 1, where the wild-type target nucleotide sequence is underlined, and the remaining four are from the T0 generation mutant that underwent gene editing. The blue broken line represents a deletion, and the yellow letters represent an insertion; ACCG before the target represents the PAM sequence.

[0033] Figure 6 The results of the disease resistance study of bobpm6 plants with BoBPM6 gene editing are shown, among which the disease index of wilt, black rot, and clubroot inoculation decreased from 65.4 to 14.5 (significant), from 53.8 to 20.9 (significant), and from 63.1 to 55.7, respectively. DETAILED DESCRIPTION

[0034] The present invention is further described below by specific implementation methods and accompanying drawings, but the present invention is not limited to the following examples. In the following examples, unless otherwise specified, the experimental methods used are conventional methods in the art and conventional commercially available reagents are used.

[0035] Experimental materials used in this study:

[0036] The rice genetic transformation material in this experiment was Nipponbare;

[0037] The wild-type cabbage variety 'M1' is an inbred line material, which is preserved by the applicant's unit and can be provided for verification testing;

[0038] The CRISPR / Cas9 vector used for rice was pVS1, purchased from Addgene™;

[0039] The CRISPR / Cas9 vector used for cabbage was pYLCRISPR / Cas9-35S-B, purchased from Addgene. TM ;

[0040] Example 1. Construction of CRISPR / Cas9 editing vector and the effect of PAM sequence on gene editing efficiency and editing type

[0041] The inventors observed in their research that Cas9 (ScCas9) from Streptococcus canis requires a spacer adjacent motif (PAM) sequence such as 5'-NNG-3', after which any base can be selected; however, when the base after the PAM sequence is "T", the editing efficiency is higher ( http: / / crispor.tefor.net / ).

[0042] To test whether the "T" after the SpCas9 PAM sequence can enhance the editing efficiency of CRISPR / Cas9 technology, the inventors constructed CRISPR / Cas9 gene editing vectors (OsPDS and BoPDS) for rice and cabbage, respectively, to knock out the phytoene dehydrogenase gene PDS.

[0043] S1. Construction of PDS gene editing vector

[0044] To construct the PDS editing vectors for knockout knockout of cabbage and rice, 5'-NGGN-3' and 5'-NGGT-3' were selected as the PAM sequences of rice and cabbage, respectively, where 'N' represents the other three bases except 'T'.

[0045] Based on the selected target sites and PAM sequences, target introduction sequence sgRNAs and their adapter primers were designed (Table 1). After synthesis, they were ligated into pVS1 to obtain the rice PDS gene editing vector OsPDS. Similarly, based on the selected target sites and PAM sequences, target introduction sequence sgRNAs and their adapter primers were designed (Table 2). After synthesis, they were ligated into the pYLCRISPR / Cas9-35S-B(Bol) vector to obtain the cabbage PDS gene editing vector BoPDS.

[0046] Schematic diagram of CRISPR / Cas9 construct Figure 1 Figure 1: Schematic diagram of the CRISPR / Cas9 construct OsPDS for rice PDS editing; NGGN (N1-N3) and NGGT (T1-T3) represent the locations of the target sites. Figure 2: Schematic diagram of the CRISPR / Cas9 construct BoPDS for cabbage PDS editing; NGGN (N1-N2) and NGGT (T1-T2) represent the locations of the target sites.

[0047] Table 1. Rice PDS gene sgRNA sequences

[0048]

[0049]

[0050] Table 2. sgRNA sequences of Brassica oleracea PDS genes

[0051]

[0052] Effects of S2.5'-NGGT-3' PAM sequence on CRISPR / Cas9 editing efficiency and diversity of editing types

[0053] The rice editing vector OsPDS and cabbage editing vector BoPDS constructed by S1 were introduced into the rice variety Nipponbare and the wild cabbage variety M1 through Agrobacterium-mediated genetic transformation, respectively.

[0054] Transform Agrobacterium using the standard procedure: Add 1 μg of plasmid to 100 μl of competent Agrobacterium cells, mix thoroughly, and incubate on ice, in liquid nitrogen, in a 37°C water bath, and on ice for 5 minutes. Add 800 μl of LB liquid medium (without antibiotics) and incubate at 200 rpm and 28°C with shaking for 3 hours. Centrifuge at 5000 rpm for 1 minute, discard some of the supernatant, and gently pipette the remaining cells to mix. Smear the cells on LB solid medium containing kanamycin and rifampicin, and incubate upside down at 28°C for 2-3 days to obtain Agrobacterium plasmids containing the PDS gene editing vectors BoPDS and OsPDS.

[0055] Rice genetic transformation is a well-known technique in the art, and the following is an exemplary operation.

[0056] (1) Co-cultivation stage: The Agrobacterium cultured on AB medium in advance was diluted to an OD600 of about 0.2 with AAM liquid medium containing an appropriate amount of AS to start the co-cultivation stage. The diluted bacterial solution was co-cultivated with the vigorous rice callus cultured in advance for 3 days.

[0057] (2) Screening and culture stage: The co-cultured callus tissue is cleaned with sterile water containing antibiotic Tm that has been sterilized in advance, and the surface moisture is dried at room temperature. The above operations should be performed under sterile conditions in a clean bench. The completely dried callus tissue is transferred to the screening medium supplemented with an appropriate amount of antibiotics using tweezers. The medium is changed every 10 days under light culture. The screening is performed by setting a gradient of decreasing antibiotic concentration for about 2-3 times.

[0058] (3) Differentiation stage: The active callus tissue that has been screened is transferred to the differentiation medium. The active callus tissue will gradually turn green and differentiate into seedlings.

[0059] (4) Rooting stage: Transfer the rice seedlings with a small amount of callus tissue to the rooting medium and culture them under light for about 2 weeks until most roots grow.

[0060] The genomic DNA of rice seedlings was extracted, and the transformed seedlings were identified using resistance primers. Positive rice strains were preliminarily screened out and further identified after being moved to the field.

[0061] Genetic transformation of cabbage is a well-known technique in the art, and the following is an exemplary operation.

[0062] (1) Obtaining cabbage explants

[0063] Select mature, plump, rounded cabbage seeds free of mold and lesions. Disinfect with 75% alcohol for 3 minutes, then with 8-10% sodium hypochlorite solution for 8-10 minutes. Wash three times with sterile water. Use sterile filter paper to blot the sterilized seeds in a laminar flow hood and evenly distribute them on solid MS medium. Incubate under 16-hour light / 8-hour dark conditions for 5-7 days. Cut the cabbage hypocotyls into 0.8-1 cm lengths to serve as recipients for Agrobacterium-mediated transformation.

[0064] (2) Genetic transformation of cabbage

[0065] The Agrobacterium plasmids containing the PDS gene editing vector were cultured to OD600 = 0.4-0.6, centrifuged at 6000 rpm for 10 minutes, and then resuspended in liquid MS medium as the infection solution.

[0066] Cabbage explants are infected for 8-10 minutes and incubated in co-cultivation medium at 25°C in the dark for 36-48 hours. The explants are then transferred to a selective medium containing 10 mg / L Basta and maintained under 16 hours of light and 8 hours of darkness, with the selection medium changed every two weeks. When resistant shoots reach approximately 2-3 cm in length, they are excised and transferred to a seedling growth medium containing Timentin. The buds are incubated under 16 hours of light and 8 hours of darkness for 20-30 days, followed by 20 days of rooting medium. Plants with well-developed roots are hardened in vermiculite for 7 days before being transplanted to nutrient soil.

[0067] After PCR amplification using Bar primers and detection by 1.0% agarose gel electrophoresis, T0 generation positive plants were obtained.

[0068] The Bar primer sequences are as follows:

[0069] BarH-F:5'-AAACCCACGTCATGCCAGTT-3'; SEQ ID No.31

[0070] BarH-R:5'-GTCTGCACCATCGTCAACCAC-3'; SEQ ID No.32

[0071] The screened T0 generation positive plants were subjected to first generation high-throughput sequencing, and the sequencing results were statistically analyzed.

[0072] The results show:

[0073] For rice, in OsPDS knockout rice positive editing plants, the average increase in editing types using 'NGGT' compared to 'NGGN' was 28.6%; the average increase in editing efficiency was 13.8% ( Figure 2 and Table 3 ).

[0074] Table 3 Statistical data on rice gene editing types and efficiencies using different PAM sequences

[0075]

[0076]

[0077]

[0078] For cabbage, knockout of BoPDS caused cabbage-positive edited plants to exhibit an albino phenotype, among which 'NGGN' edited plants were basically chimeras; 'NGGT' showed a higher degree of editing in cabbage plants than 'NGGN', and the editing efficiency increased from an average of 20.4% to an average of 68.7%. Figure 3 and as shown in Table 4.

[0079] Table 4 Statistical data on cabbage gene editing types and efficiency

[0080]

[0081] The results in rice and cabbage both showed that when the position after the PAM sequence 5'-NGG-3' is selected as 'T', the editing types of the CRISPR / Cas9 gene editing system can be significantly increased and the editing efficiency can be improved.

[0082] Example 2. Effect of fusion expression of GRF5-GIF1-GRF5 on the regeneration efficiency of B. oleracea

[0083] The vector used in the genetic system experiment was modified from the pCAMBIA1301 vector (purchased from Addgene TM ) empty vector pBWA(V)BS-Empty, which replaces the Hyg resistance in the original vector with Basta resistance.

[0084] The experimental material was the cabbage inbred line 'M1'.

[0085] Studies have found that overexpression of some plant growth regulators can significantly improve the efficiency of plant regeneration in transgenic tissue culture (Debernardi et al., 2020).

[0086] Through bioinformatics analysis, the research and development team of the present invention identified 19 growth regulatory factor (GRF) proteins and 1 GRF interacting factor (GIF) protein in the cabbage genome.

[0087] Two GRF5 proteins, two GRF4 proteins and one GIF1 protein were further studied. Two GRF5 proteins (Seq ID No.33 and Seq ID No.34) and two GRF4 proteins (Seq ID No.35 and Seq ID No.36) were fused with GIF1 protein (Seq ID No.37) through four alanine residues to express GRF5-GIF1-GRF5 (Seq ID No.38 or Seq ID No.39) and GRF4-GIF1-GRF4 (Seq ID No.40), respectively.

[0088] The effects of GRF5-GIF1-GRF5, GRF4-GIF1-GRF4, GRF5, and GIF1 as well as the blank control on cabbage regeneration efficiency were tested. Figure 4 , that is, the nucleotide sequences encoding the four proteins (Seq ID No. 41-44) were constructed into the expression vector pBWA(V)BS-Empty respectively, and introduced into the wild-type cabbage variety M1 via Agrobacterium-mediated genetic transformation.

[0089] The genetic transformation operation was the same as S2 in Example 1.

[0090] The results showed that the average regeneration efficiency of the cabbage transformants expressing GRF5-GIF1-GRF5 was increased by 55.2%. Figure 4 .

[0091] Table 5 Nucleotide sequences or amino acid sequences involved in the examples

[0092]

[0093]

[0094]

[0095]

[0096] Example 3 Discovery and cloning of the gene BoBPM6, and construction of a gene editing vector

[0097] The inventors discovered a new differentially expressed gene in cabbage, BTB / POZ (Broad complex, Tramtrack, Bric-a-brac / Pox virus and Zinc finger)-MATH 6 (BPM6). The expression of this gene is induced by wilt and black rot, and it is speculated that it may be a susceptibility gene that induces the onset of various diseases.

[0098] To test whether this gene could be used to confer broad-spectrum disease resistance in cabbage, the inventors constructed a gene-editing vector to knock it out.

[0099] By designing primers (Table 6)

[0100] Table 6

[0101]

[0102] Using the DNA of wild-type Brassica oleracea M1 as a template, a genomic fragment of BPM6 in Brassica oleracea, BoBPM6, was obtained. The full length is 3526 bp (Seq ID No. 47); its coding region consists of 2326 bp (Seq ID No. 48), and the sequence is shown in Table 7.

[0103] i. Construction of CRISPR / Cas9 editing vector for BoBPM6:

[0104] (1) Select pYLCRISPR / Cas9-35S-B (Bol) as the gene editing vector framework;

[0105] (2) 5'-'NGGT'-3' was selected as the PAM sequence of the B. oleracea BPM6 editing vector;

[0106] (3) Then, the following sgRNA and its adapter primers were designed for the BoBPM6 gene:

[0107] BoBPM6 sgRNA: Seq ID No.49, see Figure 5

[0108] BB6-F:cagtGGTCTCatgca CTCCAAGTCCGTGACGCAGAG ttttaga, Seq ID No.50

[0109] BB6-R:cagtGGTCTCaaaac TCTGCGTCACGGACTTGGAG ,Seq ID No.51

[0110] After the synthetic adapter primer was annealed into a double strand, it was enzyme-digested and ligated to the pYLCRISPR / Cas9-35S-B vector to obtain the BoBPM6 gene editing vector.

[0111] Example 4. BoBPM6 gene editing of cabbage materials

[0112] The BPM6 gene editing vector constructed in Example 3 and the expression vector for the GRF5-GIF1-GRF5 fusion protein (Seq ID No. 38) constructed in Example 2 were transformed into the wild-type cabbage variety M1 through Agrobacterium-mediated genetic transformation:

[0113] Transform Agrobacterium using the standard procedure: Add 1 μg of plasmid to 100 μl of competent Agrobacterium cells, mix thoroughly, and incubate on ice, then in liquid nitrogen, in a 37°C water bath, and on ice for 5 minutes. Add 800 μl of LB liquid medium (without antibiotics) and incubate at 200 rpm and 28°C for 3 hours. Centrifuge at 5000 rpm for 1 minute, discard some of the supernatant, and gently pipette the remaining cells to mix. Smear the cells onto LB solid medium containing kanamycin and rifampicin, and incubate upside down at 28°C for 2-3 days.

[0114] The genetic transformation method was the same as S2 in Example 1.

[0115] The screened T0 generation positive plants were subjected to first generation sequencing, and the transformation efficiency of bobpm6 was 5.5%; the editing efficiency was 62.0%;

[0116] Where transformation efficiency = number of positive plants / number of infected explants;

[0117] Editing efficiency = number of edited plants / number of positive plants.

[0118] The transformation efficiency was significantly higher than the 1% cabbage transformation efficiency and 12.9% editing efficiency reported in existing literature.

[0119] T1 generation seeds were obtained by self-pollination and randomly selected for first generation sequencing. The results showed that bobpm6 had three types of editing ( Figure 5 ).

[0120] Example 5. Disease resistance test of BoBPM6 gene-edited material

[0121] The T1 generation cabbage material obtained in Example 4 was inoculated with pathogens of wilt, black rot, and clubroot (three major diseases of cabbage).

[0122] Black rot is artificially inoculated by spraying:

[0123] (1) Preparation of bacterial liquid: The preserved black rot fungus (Xanthomonas campestris pv. Campestris) was streaked and activated, and the activated black rot fungus was added to the liquid PSA medium in the form of a bacterial mass using an inoculation loop. The culture was incubated in a shaker at 28°C and 200 rpm for 16 h in the dark. The OD was adjusted with sterile water. 600 After the value reaches 0.2, it is ready for inoculation.

[0124] (2) Inoculation process: When the seedlings have grown to 4-5 true leaves, they can be prepared for inoculation. The day before inoculation, move the seedlings to the inoculation site, water the seedling medium thoroughly, and use a sprayer to spray the leaves with water. Cover with a film to keep it moist until inoculation. The film should maintain more than 90% moisture, so that the water pores on the leaf margins are open before inoculation. Use a sprayer to evenly spray the bacterial solution on the leaves until the leaves are covered with the bacterial solution. Control the temperature at around 28°C.

[0125] (3) Resistance survey and resistance level classification: Resistance evaluation criteria: Level 0, no symptoms on inoculated leaves; Level 1, less than 5% of the leaf area; Level 3, 5-15% of the leaf area; Level 5, 15-30% of the leaf area; Level 7, 30-50% of the leaf area; Level 9, greater than 50% of the leaf area. DI = Σ(number of leaves with disease level × extreme disease level) / (total number of leaves surveyed × highest disease level) × 100. Highly resistant (HR), 0 < DI ≤ 10; resistant (R), 10 < DI ≤ 30; moderately resistant (MR), 30 < DI ≤ 50; susceptible (S), 50 < DI ≤ 70; highly susceptible (HS), DI > 70.

[0126] The wilt pathogen is artificially inoculated using the root dipping method:

[0127] (1) Preparation of bacterial liquid: The preserved Fusarium oxysporum f.sp. Conglutinans was added to liquid CM culture medium and cultured in a shaker at 28°C in the dark for 3 days. The mycelium was filtered through gauze and the remaining spores were adjusted to 1×10 6 / mL concentration and prepare the inoculum.

[0128] (2) Inoculation process: After the seedlings have grown to 3 true leaves, they can be inoculated. Before inoculation, the seedlings are pulled out of the seedling tray and the roots are cleaned. The roots are completely immersed in the bacterial solution. After 15 minutes, the seedlings are taken out and transplanted into a seedling bowl filled with soil and moved to a temperature-controlled greenhouse. The temperature is controlled at 23-29°C.

[0129] (3) Resistance survey and resistance level classification: Resistance evaluation criteria: Level 0, no symptoms; Level 1, one leaf slightly yellowed; Level 2, 1-2 leaves moderately yellowed; Level 3, half of the leaves severely yellowed or wilted; Level 4, all leaves except the heart leaf severely yellowed or wilted; Level 5, all leaves severely yellowed or the plant died. The level of leaf lesions on the investigated materials was calculated, and the average disease index (DI) was calculated. The resistance level was classified according to the disease index. DI = [Σ(each disease level × number of diseased plants at the corresponding level) / (total number of investigated plants × highest disease level)] × 100. Highly resistant (HR), 0 < DI ≤ 10; resistant (R), 10 < DI ≤ 30; moderately resistant (MR), 30 < DI ≤ 50; susceptible (S), 50 < DI ≤ 70; highly susceptible (HS), DI > 70.

[0130] Clubroot disease is artificially inoculated by root irrigation:

[0131] (1) Preparation of bacterial solution: The brassica oleracea roots stored in a -20°C refrigerator were activated at room temperature for 12 h. After adding three times the volume of sterile water, the solution was fully crushed using a juicer. The solution was filtered through gauze and the filtrate was collected into a 50 ml centrifuge tube. The solution was centrifuged at 600 rpm for 10 min and the supernatant was collected. The solution was then centrifuged at 3500 rpm for 10 min and resuspended in sterile water. The spore concentration was adjusted to 2 × 10 7 cfu / mL.

[0132] (2) Inoculation process: Inoculate the cabbage seedlings when they have grown to two true leaves. Use a knife to cut the roots of each plant twice, then use a pipette to draw 2 mL of bacterial solution and inject it into the roots of the seedlings. Move the seedlings to a temperature-controlled greenhouse and control the temperature at 18-25°C.

[0133] (3) Resistance investigation and resistance level classification: Resistance evaluation criteria: Grade 0 = no symptoms on the roots; Grade 1 = no symptoms on the main root, small nodules on the lateral roots; Grade 2 = slightly enlarged main root, larger tumors on the lateral roots; Grade 3 = severely enlarged main root, obvious lateral roots; Grade 4 = extremely severely enlarged main root, almost no lateral roots. DI = ∑(number of diseased plants at each level × corresponding disease grade) / (total number of investigated plants × highest disease grade) × 100. Resistance evaluation criteria: Immune (I): DI = 0; Highly resistant (HR): 0 < DI ≤ 5; Resistant (R): 5 < DI ≤ 20; Moderately resistant (MR): 20 < DI ≤ 30; Susceptible (S): 30 < DI ≤ 60; Highly susceptible (HS): DI > 60.

[0134] The investigation results show that:

[0135] Compared with the wild-type cabbage, the disease indices of bobpm6 plants inoculated with Fusarium wilt, black rot, and clubroot decreased from 65.4 to 14.5 (significantly), from 53.8 to 20.9 (significantly), and from 63.1 to 55.7 ( Figure 6 );

[0136] The above experimental results indicate that the BoBPM6 gene is a sensitive gene inducing the onset of various cabbage diseases. Knocking out or inhibiting the expression of this gene can obtain new germplasms with broad-spectrum disease resistance. The application of the BoBPM6 gene provided by the present invention in cabbage disease-resistant breeding and the supporting optimized gene editing and genetic transformation systems provide strong technical support for cabbage disease-resistant breeding.

[0137] Table 7

[0138]

[0139]

[0140]

Claims

1. The artificial sequence of the cabbage susceptibility gene BPM6, whose nucleotide sequence is shown in Seq ID No.

47.

2. A method for breeding cabbage for disease resistance based on the cabbage susceptibility gene BPM6, characterized in that: The following steps are involved: (1) Perform gene editing on the BPM6 gene in the target cabbage material to knock out or inactivate the gene, or inhibit the expression of the gene; The nucleotide sequence of the cabbage susceptibility gene BPM6 is shown in Seq ID No. 47; (2) Screening cabbage materials with edited BPM6 genes for regeneration culture to obtain cabbage germplasm materials with improved disease resistance.

3. The method according to claim 2, characterized in that The gene editing refers to the introduction of CRISPR / Cas9 gene editing vector into the target cabbage material; Among them, the sgRNA sequence of the CRISPR / Cas9 gene editing vector is taken from the BPM6 gene coding region sequence shown in Seq ID No.

48.

4. The method according to claim 3, characterized in that The sgRNA sequence of the CRISPR / Cas9 gene editing vector is shown in Seq ID No.

49.

5. The method according to claim 3, characterized in that The PAM sequence of the CRISPR / Cas9 gene editing vector is 5'-NGGT-3', where N is one of A, C, and G.

6. The method according to any one of claims 2 to 5, characterized in that: The invention also includes introducing an expression vector expressing the fusion protein GRF5-GIF1-GRF5 while performing gene editing on the target cabbage material; The amino acid sequence of the fusion protein GRF5-GIF1-GRF5 is as follows (1) or (2): (1) From N to C terminus, the GRF5-1 polypeptide shown in Seq ID No. 33, the GIF1 polypeptide shown in Seq ID No. 37, and the GRF5-2 polypeptide shown in Seq ID No. 34 were linearly fused; the polypeptides were connected by 3 to 5 alanine residues; (2) From N to C terminus, the amino acid sequence is a linear fusion of the GRF5-2 polypeptide shown in Seq ID No. 34, the GIF1 polypeptide shown in Seq ID No. 37, and the GRF5-1 polypeptide shown in Seq ID No. 33; the polypeptides are connected by 3 to 5 alanine residues; Preferably, the amino acid sequence of the fusion protein GRF5-GIF1-GRF5 is shown in Seq ID No.38, and its coding sequence is shown in Seq ID No.

41.

7. The BPM6 gene-edited cabbage material obtained by the method according to any one of claims 2 to 6, characterized in that: The cabbage material refers to cells and / or tissues.

8. A CRISPR / Cas9 gene editing vector, characterized in that: The sgRNA sequence was taken from the BPM6 gene coding region sequence shown in Seq ID No.

48.

9. The gene editing vector according to claim 8, characterized in that The sgRNA sequence is shown in Seq ID No.

49.

10. The gene editing vector according to claim 8, characterized in that Its PAM sequence is 5'-NGGT-3'.

Citation Information

Patent Citations

  • Cell proliferation-related polypeptides and uses therefor

    CN101018864A

  • Brassica oleracea BoDMP9 gene and application thereof in female parent haploid induction

    CN116445497A