Application of gene FoUPE15 in regulation of pathogenicity of fusarium oxysporum

By constructing the knockout vector and backfilling vector of the gene FoUPE15, the pathogenicity of banana blight bacteria is reduced, the problem of prevention and treatment of banana blight is solved, and effective prevention and treatment methods are provided.

CN120519480APending Publication Date: 2025-08-22SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510420003.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-03
Publication Date
2025-08-22

AI Technical Summary

Technical Problem

There is currently no effective method to prevent and treat banana blight, especially the widespread infectious diseases caused by banana blight bacteria No. 4 (Foc4), which affects the banana industry.

Method used

The knockout vector of the gene FoUPE15 was constructed through homologous recombination, and the protoplasts of the banana blight bacteria were transformed using PEG-mediated transformation method to obtain knockout mutants of the gene FoUPE15, and the random insertion method was used to obtain the back-complement mutants, reducing the pathogenicity of the banana blight bacteria.

Benefits of technology

It significantly reduces the pathogenicity of banana blight bacteria and provides a theoretical basis for preventing and treating banana blight and a basis for product development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120519480A_ABST
    Figure CN120519480A_ABST
Patent Text Reader

Abstract

The invention discloses an application of a gene FoUPE15 in regulation and control of pathogenicity of fusarium oxysporum. A PEG (Polyethylene Glycol)-mediated transformation method is utilized, and a knockout vector of the gene FoUPE15 constructed based on homologous recombination is used for transforming a banana wilt pathogen protoplast to obtain a knockout mutant of the gene FoUPE15, and the knockout mutant is named as delta FoUPE15. On the basis of the obtained knockout mutant, a corresponding complement mutant is obtained by using a random insertion method, and the complement mutant is named as delta FoUPE15-com. Analysis on colonial morphology, cell wall integrity, pathogenicity and the like of the knockout mutant and the complementation mutant shows that the knockout gene FoUPE15 affects the cell wall integrity of the fusarium oxysporum and significantly reduces the pathogenicity of the fusarium oxysporum. The gene FoUPE15 or the protein coded by the gene FoUPE15 can be used as a target to reduce the pathogenicity of the banana wilt pathogen, so that the banana wilt can be prevented and controlled.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and more specifically relates to the application of the gene FoUPE15 in regulating the pathogenicity of banana Fusarium wilt pathogen. Background Art

[0002] Banana wilt, also known as Panama disease or yellow leaf disease, is a devastating soil-borne vascular disease caused by the banana wilt pathogen Fusarium oxysporum f.sp.cubense (Foc). Race 4 (Foc4) has the widest pathogenicity, infecting nearly all banana varieties and causing significant losses to the banana industry.

[0003] Currently, there is no effective method to control banana Fusarium wilt. Therefore, functional research on genes related to Foc4 pathogenicity is needed to provide a theoretical basis for the prevention and control of banana Fusarium wilt. Summary of the Invention

[0004] The present invention promotes the development of banana wilt prevention and treatment products and provides application of gene FoUPE15 in regulating the pathogenicity of banana wilt pathogen.

[0005] The first objective of the present invention is to provide an application of the gene FoUPE15 in regulating the pathogenicity of banana Fusarium wilt.

[0006] The second object of the present invention is to provide a use of an agent for knocking down or knocking out the gene FoUPE15 in reducing the pathogenicity of banana Fusarium wilt.

[0007] The third object of the present invention is to provide use of an agent for knocking down or knocking out the gene FoUPE15 in the preparation of a product that reduces the pathogenicity of banana Fusarium wilt.

[0008] The fourth object of the present invention is to provide an agent for knocking down or knocking out the gene FoUPE15 for use in preventing and controlling banana wilt.

[0009] A fifth object of the present invention is to provide use of an agent for knocking down or knocking out the gene FoUPE15 in the preparation of a product for preventing and controlling banana wilt.

[0010] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0011] The nucleotide sequence of the gene FoUPE15 described in the present invention is shown in SEQ ID NO.1, and the amino acid sequence of the protein FoUPE15 encoded thereby is shown in SEQ ID NO.2. Protein FoUPE15 does not contain an N-terminal signal peptide, a transmembrane domain, or a GPI anchor site, and software predicts that the protein is an effector. To explore the function of gene FoUPE15, the present invention, based on the principle of homologous recombination, constructed a knockout vector for gene FoUPE15 using the upstream and downstream homologous arms of gene FoUPE15. Foc4 protoplasts were transformed via PEG-mediated transformation to obtain a knockout mutant of gene FoUPE15, named ΔFoUPE15. Based on ΔFoUPE15, a corresponding complement mutant was obtained using a random insertion method, named ΔFoUPE15-com. Analysis revealed that the knockout mutant ΔFoUPE15 showed no significant differences in colony morphology and growth rate, conidia and hyphae morphology, conidia production, germination rate, cell wall integrity, and resistance to hyperosmotic and oxidative stress compared to the wild type. However, its pathogenicity was significantly reduced compared to the wild type. Furthermore, the pathogenicity of the complemented mutant ΔFoUPE15-com was restored to wild-type levels. This indicates that the FoUPE15 gene is associated with the pathogenicity of Fusarium wilt and could be used to develop products to control banana Fusarium wilt.

[0012] The present invention seeks to protect the use of the gene FoUPE15 in regulating the pathogenicity of banana wilt pathogen.

[0013] Specifically, the amino acid sequence of the protein encoded by the gene FoUPE15 is shown in SEQ ID NO.2.

[0014] Specifically, the application is the application of the gene FoUPE15 in reducing the pathogenicity of banana Fusarium wilt pathogen; the application is achieved by knocking down or knocking out the gene FoUPE15 in banana Fusarium wilt pathogen.

[0015] In a specific embodiment of the present invention, the nucleotide sequence of the gene FoUPE15 is shown as SEQ ID NO.1.

[0016] Because knocking out the gene FoUPE15 of banana wilt pathogen can significantly reduce the pathogenicity of banana wilt pathogen, and knocking down or knocking out the gene has similar effects, the present invention also claims the use of an agent for knocking down or knocking out the gene FoUPE15 to reduce the pathogenicity of banana wilt pathogen.

[0017] The present invention also claims protection for the use of an agent for knocking down or knocking out the gene FoUPE15 in preparing a product for reducing the pathogenicity of banana wilt fungus.

[0018] Specifically, the banana wilt pathogen is banana wilt pathogen race 4.

[0019] The present invention also claims protection for the use of an agent for knocking down or knocking out the gene FoUPE15 in preventing and controlling banana wilt.

[0020] The present invention also claims protection for the use of an agent for knocking down or knocking out the gene FoUPE15 in the preparation of a product for preventing and controlling banana wilt.

[0021] Specifically, the control of banana wilt disease is achieved by reducing the pathogenicity of banana wilt pathogens.

[0022] Specifically, the banana wilt pathogen is banana wilt pathogen race 4.

[0023] Specifically, the reagent for knocking down the gene FoUPE15 is an siRNA, dsRNA, shRNA, miRNA or antisense nucleic acid that uses the transcript of the gene FoUPE15 as the target sequence and can inhibit the expression or transcription of the gene FoUPE15; the reagent for knocking out the gene FoUPE15 is a knockout vector of the gene FoUPE15 constructed based on homologous recombination.

[0024] In a specific embodiment of the present invention, the knockout vector is constructed based on the filamentous fungus expression vector pCT74; the knockout vector contains upstream and downstream homologous fragments of the gene FoUPE15.

[0025] In a specific embodiment of the present invention, the upstream homologous fragment of the gene FoUPE15 is amplified using primers FoUPE15-AF and FoUPE15-AR; the nucleotide sequences of the primers FoUPE15-AF and FoUPE15-AR are shown in SEQ ID NOs. 3 and 4, respectively.

[0026] In a specific embodiment of the present invention, the downstream homologous fragment of the gene FoUPE15 is amplified using primers FoUPE15-BF and FoUPE15-BR; the nucleotide sequences of the primers FoUPE15-BF and FoUPE15-BR are shown in SEQ ID NOs. 5 and 6 respectively.

[0027] The present invention has the following beneficial effects:

[0028] The present invention transforms banana wilt pathogen protoplasts with a knockout vector for the gene FoUPE15 constructed through homologous recombination via PEG-mediated transformation, resulting in a banana wilt pathogen knockout mutant of the gene FoUPE15, named ΔFoUPE15. Based on this knockout mutant, a corresponding complementing mutant, named ΔFoUPE15-com, was obtained using a random insertion method. Analysis of the colony morphology, cell wall integrity, and pathogenicity of the knockout and complementing mutants revealed that knocking out the gene FoUPE15 did not affect the colony morphology or spore production of banana wilt pathogens, but did affect the cell wall integrity of banana wilt pathogens, significantly reducing their pathogenicity. This indicates that the gene FoUPE15 or its encoded protein can be targeted to reduce the pathogenicity of banana wilt pathogens, thereby achieving control of banana wilt disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Schematic diagram of the construction of the knockout vector for the banana Fusarium wilt pathogen gene FoUPE15.

[0030] Figure 2 Schematic diagram of the complementation vector for the banana Fusarium wilt pathogen gene FoUPE15.

[0031] Figure 3 The results of PCR amplification of the hph gene in some hygromycin-resistant transformants are shown.

[0032] Figure 4 The results of PCR amplification of the target gene FoUPE15 in some hygromycin-resistant transformants.

[0033] Figure 5 This is the result of Southern blot analysis of knockout positive transformants using the FoUPE15 gene fragment as a probe.

[0034] Figure 6 This is the result of Southern blot analysis of knockout-positive transformants using the hph gene fragment as a probe.

[0035] Figure 7 The PCR verification results of some bleomycin-resistant complemented transformants are shown.

[0036] Figure 8 These are the results of expression level analysis of the FoUPE15 gene in the knockout mutant and complemented mutant of the banana Fusarium wilt pathogen FoUPE15.

[0037] Figure 9 The colony morphology of the knockout mutant and complement mutant of the banana Fusarium wilt gene FoUPE15 under different stress conditions.

[0038] Figure 10 These are the results of pathogenicity analysis of the knockout mutant and complemented mutant of the banana Fusarium wilt gene FoUPE15.

[0039] Figure 11 These are the disease index analysis results of the knockout mutant and complemented mutant of the banana Fusarium wilt gene FoUPE15.

[0040] Different letters in the figure indicate significant differences, p < 0.05. DETAILED DESCRIPTION

[0041] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0042] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.

[0043] The banana wilt pathogen used in the present invention is banana wilt pathogen race 4 (Foc4), more specifically FocTR4, and the test plant is a Brazilian banana (Cavendish, AAA) with 4 to 5 leaves.

[0044] The host bacteria used in the present invention are Escherichia coli DH5α or yeast strain YTK12; the cloning vector used is pMD18T vector; the gene knockout vector used is the filamentous fungus expression vector pCT74; and the gene complementation vector used is pCTZN, which is obtained by replacing the fluorescent protein gene (gfp) and hygromycin phosphotransferase gene (hph) on the vector pCT74 with the bleomycin gene.

[0045] The STC solution used in the present invention contains 10 mmol / L Tris-HCl, 1.2 mol / L sorbitol, 50 mmol / L CaCl2, and has a pH of 7.5. The PTC conversion buffer used is an STC solution containing 40% PEG4000.

[0046] Example 1 Construction of knockout mutants and complementation mutants of banana wilt pathogen gene FoUPE15

[0047] The present invention utilizes the principle of homologous recombination to knock out the gene FoUPE15 of banana wilt pathogen. The schematic diagram of the construction of the knockout vector of banana wilt pathogen gene FoUPE15 is shown in FIG. Figure 1 As shown, U in the figure refers to the upstream homology arm, and D refers to the downstream homology arm. Figure 1 It can be seen that the present invention replaces the gene FoUPE15 in banana wilt pathogen with hph and gfp through homologous recombination, thereby achieving the knockout of the gene FoUPE15.

[0048] 1. Amplification of upstream and downstream homologous fragments of gene FoUPE15

[0049] The nucleotide sequence of the gene FoUPE15 described in the present invention is shown in SEQ ID NO. 1, and the amino acid sequence of the protein FoUPE15 encoded by it is shown in SEQ ID NO. 2. Sequences approximately 1000 bp long were selected upstream and downstream of the FoUPE15 gene (respectively designated as homology arm A fragment and homology arm B fragment), and corresponding amplification primers were designed, incorporating appropriate restriction sites. The nucleotide sequences of the resulting primers are shown in Table 1.

[0050] Table 1 Primers for amplification of homology arm A and B fragments of gene FoUPE15

[0051] Primer name SEQ ID NO Primer sequence (5'-3') Restriction site FoUPE15-AF 3 GCTCTAGAACCGCAAGTGATAGTGGTGA Xba I FoUPE15-AR 4 CGGAATTCTTGACATTGCTTTGAATAACAATCC EcoR I FoUPE15-BF 5 CCGCTCGAGAGACGACCCCGCGGTTAG Xho I FoUPE15-BR 6 CGGGGTACCAGAACTTCTTCTGTATCAAAGGCA Kpn I

[0052] Note: The underlined sequence is the enzyme recognition site.

[0053] The genomic DNA of Foc4 was extracted using the OMEGA Fungal DNA Kit. The obtained genomic DNA was used as a template and PCR amplification was performed with primers FoUPE15-AF and FoUPE15-AR to obtain the homologous arm A fragment (FoUPE15-A) of the FoUPE15 gene. The homologous arm B fragment (FoUPE15-B) of the FoUPE15 gene was obtained by PCR amplification with primers FoUPE15-BF and FoUPE15-BR.

[0054] The PCR reaction system used to amplify the homology arm fragments is shown in Table 2.

[0055] Table 2 PCR reaction system used to amplify homology arm fragments

[0056] Template DNA 1.0μL FoUPE15-AF / BF (10 μmol / L) 1.0μL FoUPE15-AR / BR (10 μmol / L) 1.0μL <![CDATA[10×Ex Taq Buffer(Mg 2+ plus)]]> 5.0μL dNTPs (2.5 mmol / L) 4.0μL Ex Taq (5U / μL) 0.5μL <![CDATA[ddH2O]]> 37.5μL Total 50.0μL

[0057] The PCR reaction conditions were as follows: 94°C for 5 min; 98°C for 10 s, 57°C for 30 s, and 72°C for 1 min, for a total of 30 cycles; and 72°C for 10 min.

[0058] After the PCR reaction was completed, the PCR amplification products were cleaned and recovered using the OMEGA Cycle Pure Kit.

[0059] 2. Construction of knockout vector for gene FoUPE15

[0060] Referring to the instructions of the pMD18-T Vector Cloning Kit (TakaRa), FoUPE15-A and FoUPE15-B were ligated with the pMD18T vector, respectively, to obtain recombinant vectors pMD18T-FoUPE15-A and pMD18T-FoUPE15-B. 1 μL of the pMD18T vector was added with 4 μL of the above-mentioned PCR recovered product (homologous arm A fragment or homologous arm B fragment) and 5 μL of solution I, and the ligation was carried out at 16°C overnight. The ligation product was transformed into Escherichia coli DH5α, spread on LB solid medium (containing 50 μg / mL Amp), and then cultured in a 37°C incubator for 8-12 h. Transformants with Amp resistance were selected, and the recombinant vector DNA was extracted for enzyme digestion and sequencing identification. The identified recombinant vectors were used in subsequent experiments.

[0061] pMD18T-FoUPE15-A and pCT74 vector were digested with restriction enzymes EcoR I and Xba I, respectively, to recover the homology arm A fragment and the linearized pCT74 vector. The homology arm A fragment was ligated with the digested pCT74 vector using T4 DNA ligase and transformed into E. coli DH5α to obtain the recombinant plasmid pCT74-FoUPE15-A. Following the same procedure, pMD18T-FoUPE15-B and pCT74-FoUPE15-A were digested with Xho I and Kpn I, and the B fragment and recombinant plasmid were recovered. The B fragment was ligated with pCT74-FoUPE15-A using T4 DNA ligase and transformed into E. coli DH5α. After enzyme digestion and identification, the gene knockout vector pCT74-FoUPE15-KO was obtained.

[0062] 3. Amplification of FoUPE15 complementation fragment

[0063] Construction of the complementation vector for the FoUPE15 gene of banana wilt pathogen Figure 2 A promoter sequence of approximately 1500 bp in length was selected upstream of the FoUPE15 gene, and a terminator sequence of approximately 500 bp in length was selected downstream. The corresponding amplification primers were designed and suitable restriction sites were introduced. The nucleotide sequences of the designed primers are shown in Table 3.

[0064] Table 3 Primers for amplification of the complemented fragment of gene FoUPE15

[0065] Primer name Primer sequence (5'-3') Restriction site FoUPE15-comF CGGAATTCGATGGTTCTTGTCTCGCGGTT EcoR I FoUPE15-comR GCTCTAGAAACAATTCTGAAAGGAGCTGTTGTT Xba I

[0066] Using Foc4 genomic DNA as a template, primers FoUPE15-comF and FoUPE15-comR were used for PCR amplification to obtain the complementation fragment of the FoUPE15 gene (FoUPE15-com). The PCR reaction system used to amplify the complementation fragment of the FoUPE15 gene is shown in Table 4.

[0067] Table 4 PCR reaction system used to amplify the complementation fragment of gene FoUPE15

[0068] Template DNA 1.0μL FoUPE15-comF (10 μmol / L) 1.0μL FoUPE15-comR (10 μmol / L) 1.0μL <![CDATA[10×Ex Taq Buffer(Mg 2+ plus)]]> 5.0μL dNTPs (2.5 mmol / L) 4.0μL Ex Taq (5U / μL) 0.5μL <![CDATA[ddH2O]]> 37.5μL Total 50.0μL

[0069] The PCR reaction conditions were as follows: 94°C for 5 min; 98°C for 10 s, 57°C for 30 s, and 72°C for 3 min, for a total of 30 cycles; and 72°C for 10 min.

[0070] After the PCR reaction was completed, the PCR amplification products were cleaned and recovered using the OMEGA Cycle Pure Kit.

[0071] 4. Construction of the complementation vector for gene FoUPE15

[0072] The complementing fragment FoUPE15-com and the pCTZN vector were double-digested with restriction endonucleases Xba I and Eco RI, respectively, to recover the FoUPE15-com fragment and pCTZN vector. The FoUPE15-com fragment was ligated with pCTZN using T4 DNA ligase and transformed into Escherichia coli DH5α to obtain the recombinant plasmid pCTZN-FoUPE15-com. The gene complementing vector pCTZN-FoUPE15-com was identified by enzyme digestion.

[0073] 5. Preparation of Foc4 Protoplasts

[0074] Foc4 was inoculated into Czapek medium (sodium nitrate 3 g, potassium phosphate dihydrate 1 g, potassium chloride 0.5 g, magnesium sulfate heptahydrate 0.5 g, ferrous sulfate heptahydrate 0.018 g, sucrose 30 g, and diluted to 1 L with distilled water) and cultured at 28°C and 150 rpm for 3 days. The culture solution was filtered through a 200-mesh cell sieve, centrifuged at 4°C and 10,000 × g for 10 min, and the supernatant was discarded. The precipitate was resuspended and diluted with CM medium (tryptone 2 g, yeast extract 1 g, casein hydrolysate 1 g, 20 × nitrate 50 mL, glucose 10 g, 1000 × vitamin 1 mL, 1000 × trace elements 1 mL, diluted to 800 mL, pH 6.5, diluted to 200 mL) to prepare a Foc4 conidia suspension. The prepared conidia suspension was inoculated into CM medium to a final conidia concentration of 1 × 10 6 / mL; shake culture at 28 ° C and 150 rpm, filter with a cell sieve, rinse with 0.8 mol / L NaCl solution 3 to 5 times to obtain fresh mycelium; add an appropriate amount of enzymatic solution at a volume mass ratio of enzyme solution to mycelium of 10:1, and enzymatic hydrolysis at 30 ° C and 120 rpm for 3 hours to obtain protoplast enzymatic solution; filter the enzymatic solution of the previous step with filter paper, rinse with 0.8 mol / L NaCl solution 2 to 3 times, centrifuge at 4 ° C and 2000 rpm, and discard the supernatant; add pre-cooled STC solution to resuspend the precipitate, centrifuge, and discard the supernatant; then add pre-cooled STC to resuspend the precipitate to obtain Foc4 protoplast suspension, so that the final protoplast concentration is about 1×10 7 pieces / mL.

[0075] The protoplasts of the banana Fusarium wilt knockout mutant were prepared by referring to the above-mentioned steps for preparing Foc4 protoplasts.

[0076] 6. Protoplast transformation

[0077] The following description takes the protoplast transformation of the knockout vector of the gene FoUPE15 as an example.

[0078] The knockout vector pCT74-FoUPE15-KO was digested to obtain a linear fragment of pCT74-FoUPE15-KO; the linearized fragment was mixed with 200 μL of prepared Foc4 protoplasts; 200 μL of PTC transformation buffer was added, mixed, and placed on ice for 5 minutes; 800 μL of PTC transformation buffer was added, mixed, and placed on ice; 25 mL of pre-cooled STC was added and mixed; centrifuged at 4°C, 4000 rpm for 15 minutes, and washed with 3 mL After resuspending the precipitate in PDA liquid regeneration medium (200.0 g potato, 274 g sucrose, distilled water to 1 L), shake culture at 28°C and 100 rpm for 16 h; centrifuge at 4°C and 4000 rpm for 15 min, add PDA solid regeneration medium, mix well, pour into plates, and culture in the dark at 28°C for 2-3 days; pick hygromycin-resistant transformants, transfer them to PDA medium containing hygromycin, culture in the dark at 28°C for 3-4 days, and pick single colonies for identification.

[0079] The transformation of the complementing vector of gene FoUPE15 was the same as above. The protoplasts used for transformation were the protoplasts of the banana wilt pathogen knockout mutant. The antibiotic used for screening transformants was bleomycin at a concentration of 200 μg / mL.

[0080] 7. PCR verification analysis of knockout mutants of the FoUPE15 gene

[0081] Genomic DNA from a single colony of the hygromycin-resistant transformant was extracted according to the instructions of the OMEGA Fungal DNA Kit. PCR amplification of the hph gene fragment was performed using primers hph-F / R. Then, PCR amplification of the FoUPE15 gene fragment was performed using primers FoUPE15-F / R. The nucleotide sequences of these primers are shown in Table 5.

[0082] Table 5 PCR validation analysis primers for knockout mutants

[0083] Primer name Primer sequence (5'-3') hph-F TGCTGCTCCATACAAGCCAA hph-R GACATTGGGGAGTTCAGCGA FoUPE15-F TGCTGACAGCGCATATAGGG FoUPE15-R TGGTATCCCGCAATGCCAAT

[0084] The PCR reaction system used for PCR verification analysis of the knockout mutant of the gene FoUPE15 is shown in Table 6.

[0085] Table 6 PCR reaction system used for PCR verification analysis of knockout mutants

[0086] Template DNA 1 μL FoUPE15-F / hph-F (10 μmol / L) 1 μL FoUPE15-R / hph-R (10 μmol / L) 1 μL 2×T5 Super PCR Mix 12.5μL <![CDATA[ddH2O]]> 9.5μL Total 25.0μL

[0087] The PCR reaction conditions were as follows: 98°C for 3 min; 98°C for 10 s, 57°C for 10 s, and 72°C for 8 s, for a total of 30 cycles; and 72°C for 5 min to obtain the amplified product.

[0088] The present invention used homologous recombination to transform pCT74-FoUPE15-KO into Foc4 protoplasts, and obtained 18 hygromycin-resistant transformants. After extracting transformant DNA, PCR analysis was performed on the transformants using hph gene-specific primers. It was found that 10 transformants contained the hph gene. The PCR amplification results of the hph gene in some hygromycin-resistant transformants are shown in Figure 2. Figure 3 As shown. Further using FoUPE15 gene specific primers, the 10 transformants amplified by PCR to hph gene were subjected to FoUPE15 PCR verification analysis. The results are shown as follows Figure 4 As shown. Figure 4 It can be seen that the FoUPE15 gene was not amplified in four hygromycin-resistant transformants (ΔFoUPE15-6, ΔFoUPE15-10, ΔFoUPE15-11, and ΔFoUPE15-18), indicating that these four transformants were knockout-positive transformants.

[0089] 8. Southern blot analysis of FoUPE15 knockout mutants

[0090] Primers FoUPE15-F / R were used to amplify the target gene (FoUPE15) probe, and hph-F / R was used to amplify the hph gene probe. Southern blot analysis was performed on knockout-positive transformants in which the hph gene was amplified but the FoUPE15 gene was not amplified using the two gene probes. The experiment was performed according to the instructions of DIG High Prime DNA Labeling and Detection Starter Kit I (Roche).

[0091] The PCR amplification system of the gene probe is shown in Table 7.

[0092] Table 7 PCR amplification system of gene probes

[0093] Template DNA 1.0 μL FoUPE15-F / hph-F (20 μmol / L) 1.0μL FoUPE15-R / hph-R (20 μmol / L) 1.0μL <![CDATA[10×Ex Taq Buffer(Mg 2+ plus)]]> 5.0μL dNTPs (2.5 mmol / L) 4.0μL Ex Taq (5U / μL) 0.5μL <![CDATA[ddH2O]]> 37.5μL Total 50.0μL

[0094] The PCR reaction conditions were as follows: 94°C for 5 min; 98°C for 10 s, 55°C for 30 s, and 72°C for 30 s, for a total of 30 cycles; and 72°C for 5 min to obtain the amplified product.

[0095] The results of Southern blot analysis of knockout positive transformants using the FoUPE15 gene fragment as a probe are shown in the following figure. Figure 5 The results of Southern blot analysis of knockout positive transformants using hph gene fragment as probe are shown in Figure 6 As shown. Figure 5 and Figure 6 It can be seen that when the gene FoUPE15 fragment was used as a probe for hybridization, the wild type Foc4 had a single hybridization band, while the knockout positive transformants tested did not show any hybridization bands ( Figure 5 ). When hybridization was performed using gene hph as a probe, the wild type Foc4 had no hybridization band, while the knockout positive transformants detected all had single copy bands ( Figure 6 ). This further demonstrated that a knockout mutant of the gene FoUPE15 was successfully obtained.

[0096] 9. PCR verification analysis of complementation mutants of the FoUPE15 gene

[0097] Genomic DNA of a single colony of the bleomycin-resistant complemented transformant was extracted, and the gene fragment FoUPE15 was amplified by PCR using primers FoUPE15-F / R. The PCR reaction system used was the same as in Table 6. The PCR reaction conditions were as follows: 98°C for 3 min; 98°C for 10 s, 58°C for 10 s, and 72°C for 1 min, for a total of 30 cycles; and 72°C for 5 min to obtain the amplified product.

[0098] The present invention used the random insertion method to transform the complementation vector pCTZN-FoUPE15-com into the protoplasts of the knockout mutant ΔFoUPE15, and obtained 10 bleomycin-resistant complementation transformants. The PCR verification results of some bleomycin-resistant complementation transformants are shown in Figure 2. Figure 7 As shown. Figure 7 It can be seen that 4 bleomycin-resistant complementing transformants can amplify the target gene fragment, indicating that these 4 transformants are complementing mutants.

[0099] 10. RT-qPCR analysis of knockout and complement mutants of the FoUPE15 gene

[0100] Total RNA was extracted from mycelia of Foc4, the knockout mutant, and the complementing mutant, and converted to cDNA. The resulting cDNA was used as a template for RT-qPCR analysis of the relative expression levels of the gene FoUPE15 in these Foc4, knockout mutant, and complementing mutants, with FoTublin serving as an internal reference gene. The primers used for RT-qPCR analysis are shown in Table 8.

[0101] Table 8 Primers used in RT-qPCR analysis

[0102] Primer name Primer sequence (5'-3') qRTFoUPE15-F TACGAAGAGCGACGACTGGA qRTFoUPE15-R GCGTTATACGAAGCCGTGAC qFoTublin-F CCTCGTCGATCTTGAGCCTG qFoTublin-R CTGGAAACCCTGGAGGCAAT

[0103] The present invention uses RT-qPCR method to analyze the relative expression levels of FoUPE15 in knockout mutants and complement mutants with FoTublin as internal reference gene. Figure 8 As shown. Figure 8 It can be seen that the gene FoUPE15 is almost not expressed in the knockout mutant, while the expression level of the gene FoUPE15 in the complement mutant is restored to the Foc4 wild-type level, indicating that the present invention has successfully obtained the knockout mutant (ΔFoUPE15) and complement mutant (ΔFoUPE15-com) of the gene FoUPE15.

[0104] Example 2 Phenotypic observation and stress resistance analysis of knockout mutants and complement mutants of the FoUPE15 gene

[0105] 1. Phenotypic observation of knockout mutants and complement mutants of the FoUPE15 gene

[0106] (1) Colony morphology observation and hyphae diameter measurement

[0107] Conidia of Foc4, knockout mutant and complement mutant were inoculated in the center of PDA, CM and MM culture medium plates, respectively. After inverted culture at 28°C in the dark for 5 days, the colony morphology was observed and the colony diameter was measured by the cross method.

[0108] The colony morphology and growth rate of ΔFoUPE15 were not significantly different from those of Foc4 and the complementing mutant. Based on the lack of differences in colony phenotype, ΔFoUPE15-6, ΔFoUPE15-18, and ΔFoUPE15-18-com-1 (hereafter referred to as ΔFoUPE15-com) were selected for subsequent experiments.

[0109] (2) Fluorescence observation of conidia and hyphae morphology

[0110] PDA bacterial masses of Foc4, knockout mutants and complemented mutants were inoculated into Czapek medium and cultured for 3 days. The slides were then made and observed under an electric inverted fluorescence microscope, with Foc4 and Foc4-GFP as controls.

[0111] Microscopic observation results showed that there was no obvious difference in the morphology of conidia and hyphae of ΔFoUPE15 compared with Foc4 wild type and ΔFoUPE15-com.

[0112] (3) Determination of spore production

[0113] Conidia of Foc4, knockout mutants and complemented mutants were inoculated into Czapek medium and cultured in a shaker at 28°C and 120 rpm for 3 days. The conidia production was counted using a hemocytometer.

[0114] The results of conidia production assay showed that there was no significant difference in conidia production between ΔFoUPE15 and Foc4 wild type and ΔFoUPE15-com.

[0115] 2. Stress resistance analysis of knockout and complement mutants of FoUPE15

[0116] Conidia of Foc4, knockout mutants, and complemented mutants were inoculated onto PDA medium containing different stress factors (1 mol / L NaCl, 1 mol / L sorbitol, 0.02% SDS, 30 mmol / L H2O2, 100 μg / mL fluorescent whitening agent (CFW), and 200 μg / mL Congo red (CR)). The cells were incubated in the dark at 28°C for 5 days. The colony diameters were measured using the cross-hatch method, and the inhibition rate of colony growth under different stresses was calculated. The colony inhibition rate was calculated according to the following formula: colony inhibition rate (%) = (colony diameter of control group - colony diameter of treated group) / colony diameter of control group × 100%.

[0117] The colony morphology of the knockout mutant of the gene FoUPE15 under different stress conditions is as follows Figure 9 As shown. Figure 9It can be seen that knocking out the banana wilt pathogen gene FoUPE15 does not affect its sensitivity to NaCl, sorbitol, H2O2, CFW and CR, but is sensitive to SDS stress, indicating that the gene FoUPE15 does not affect the osmotic pressure resistance and antioxidant capacity of banana wilt pathogen, but may affect its cell wall integrity.

[0118] Example 3 Pathogenicity Analysis of Knockout and Complementary Mutants of FoUPE15

[0119] Brazilian bananas at the 4-leaf stage with the same growth status were selected and conidia (1×10 5 The roots of banana seedlings were inoculated with a suspension of 1000 ng / mL (1000 ng / mL) of the same substance. A water-treated group served as a control. After 40 minutes of treatment, the seedlings were transplanted into sterile nutrient soil and cultured in a plant incubator at 25 ± 1°C under a 12-hour light / dark cycle. After 28 days, the disease on the leaves and bulbs of the banana seedlings was observed, and the disease index was calculated and statistically analyzed. Disease grading standards were based on the method of Huang Yonghui (2016) (Table 9).

[0120] Table 9 Banana wilt disease classification standard (Huang Yonghui, 2016)

[0121]

[0122] The disease index is calculated as follows: disease index = ∑ (disease level × number of plants with disease level) / (highest level × total number of plants surveyed) × 100

[0123] The results of pathogenicity analysis of knockout mutants and complementation mutants of banana wilt pathogen FoUPE15 are as follows: Figure 10 The disease index analysis results of the knockout mutant and complement mutant of banana wilt pathogen FoUPE15 are shown in Figure 2. Figure 11 As shown. Figure 10 It can be seen that the leaves of the banana plant treated with water did not turn yellow and its bulbs did not turn brown. The leaves of the banana plant inoculated with Foc4 and ΔFoUPE15-com turned yellow and the bulbs turned brown. However, the yellowing of the leaves and browning of the bulbs of the banana plant inoculated with ΔFoUPE15 were reduced ( Figure 10 ), the disease index statistical results also showed that FoUPE15 knockout significantly reduced the pathogenicity of Foc4 ( Figure 11 ).

[0124] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. Application of gene FoUPE15 in regulating the pathogenicity of banana wilt pathogen, characterized in that: The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that The application is the application of the gene FoUPE15 in reducing the pathogenicity of banana Fusarium wilt pathogen; the application is achieved by knocking down or knocking out the gene FoUPE15 in banana Fusarium wilt pathogen.

3. Use of an agent for knocking down or knocking out the gene FoUPE15 according to claim 1 in reducing the pathogenicity of banana wilt fungus.

4. Use of an agent for knocking down or knocking out the gene FoUPE15 according to claim 1 in the preparation of a product for reducing the pathogenicity of banana wilt pathogen.

5. The use according to claim 3 or 4, characterized in that: The banana wilt pathogen is banana wilt pathogen race 4.

6. Use of an agent for knocking down or knocking out the gene FoUPE15 according to claim 1 in preventing and controlling banana wilt.

7. Use of an agent for knocking down or knocking out the gene FoUPE15 according to claim 1 in the preparation of a product for preventing and controlling banana wilt.

8. The use according to claim 6 or 7, characterized in that: The control of banana wilt disease is achieved by reducing the pathogenicity of banana wilt pathogens.

9. The application according to claim 8, characterized in that: The banana wilt pathogen is banana wilt pathogen race 4.

10. The use according to any one of claims 3, 4, 6, and 7, characterized in that: The reagent for knocking down the gene FoUPE15 is siRNA, dsRNA, shRNA, miRNA or antisense nucleic acid that uses the transcript of the gene FoUPE15 as the target sequence and can inhibit the expression or transcription of the gene FoUPE15; the reagent for knocking out the gene FoUPE15 is a knockout vector of the gene FoUPE15 constructed based on homologous recombination.