Application of verticillium dahliae sclerosome binding protein gene VdNBP gene
By constructing a knockout mutant of the VdNBP gene of the skullosome binding protein gene of Dalien, the complex pathogenic mechanism of cotton Verticillium Worm was solved, and the regulation of the growth and pathogenicity of Dalien, the development and pathogenicity of Dalien, was achieved, and a new way to prevent and treat cotton Verticillium Worm was provided.
Patent Information
- Application Number
- CN202510631399.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-16
- Publication Date
- 2025-08-22
AI Technical Summary
The pathogenic mechanism of cotton Verticillium caused by Dali's verticillium is complex, and the existing technology is difficult to effectively prevent and treat, and the interaction mechanism between pathogens and host plants is unclear.
By constructing knockout mutants of the VdNBP gene of the skurosome binding protein gene of the Mycobacterium Dali, VdNBP gene knockout mutants and complementary mutants were obtained by screening by Agrobacterium-mediated genetic transformation method (ATMT), and their functions in the growth and development of Mycobacterium Dali, pathogenicity and interaction with plants were studied.
It significantly weakens the pathogenicity of Dali's vermicelli, reduces the disease index, reduces the growth rate and spore production of mycelium, and provides a new method to prevent and treat cotton verticillium wilt.
Smart Images

Figure CN120519482A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of functional genes, and in particular relates to an application of a nucleosome binding protein gene VdNBP of Verticillium dahliae. Background Art
[0002] Verticillium wilt, caused by Verticillium dahliae Kleb., is a worldwide, soil-borne vascular fungal disease. It is one of the most widespread and serious cotton diseases worldwide and in my country, earning it the nickname "cotton cancer." Since Carpenter et al. first reported Verticillium wilt on upland cotton in Virginia, USA, in 1914, the disease has rapidly spread throughout the US and around the world. To date, Verticillium wilt has been found in major cotton-producing regions worldwide, causing significant losses to the cotton industry annually.
[0003] Verticillium dahliae Kleb. in cotton exhibits high variability. During coevolution with its host, the pathogen's heterokaryotic behavior and ecological differences can lead to physiological differentiation, resulting in the emergence of new pathogenic types. In 1966, Schnathorst divided American cotton Verticillium dahliae into two physiological races based on strain virulence and disease symptoms: the highly pathogenic, leaf-defoliating T9 strain and the weakly pathogenic, non-leaf-defoliating SS-4 strain. Schnathorst was the first to propose the existence of pathogenic differentiation in Verticillium dahliae. In the Soviet Union, V. dahliae was divided into three physiological races based on colony morphology and pathogenicity. Later, Partenko, Kasyanenko, and others further divided the species into five physiological races.
[0004] Nucleosome binding protein (NBP) is a high-mobility group protein (HMG) that belongs to the HMG superfamily. The HMG protein superfamily is the second largest chromatin-structuring compound in eukaryotes, after histones. It comprises three families: HMGA (formerly HMG-I / -Y), HMGB (formerly HMG-1 / -2), and HMGN (formerly HMG-14 / -17). The HMGB family relies on the HMG-box as a functional motif to bind non-sequence-specific DNA. HMGB proteins are characterized by an L-shaped HMG-box composed of 75 amino acid residues and three α-helices. They are named for their high mobility in polyacrylamide gel electrophoresis. The proteins encoded by NHP6A and NHP6B are highly identical to the mammalian high-mobility group proteins HMG1 and HMG2. In Saccharomyces cerevisiae, the double knockout mutants ΔNHP6A and ΔNHP6B reduce the expression of the transcription factor SUC2 gene by 50% and sharply decrease the expression of the SNR6 gene. In S. cerevisiae, NHP6A and NHP6B are downstream genes regulated by the MAPK pathway, and the proteins encoded by these genes play important roles in cell growth and morphological changes. Among HMGB family members, mitochondrial HMGB proteins play diverse roles in regulating mitochondrial DNA polymerization, recombination, and replication. Examples include HmbB (AN1267) from Aspergillus niger, Abf2 from S. cerevisiae, mtHMG1 from the filamentous fungus Podospora anserina, Gcf1 from Candida albicans and Candida parapsilosis, Ylmhb1 from Yarrowia lipolytica, and Tfam from metazoans. These proteins have similar functions in yeast, filamentous fungi, and mammals. The mitochondrial HMGB protein HmbB from A. niger contains a typical HMG-box at its C-terminus and two shadow HMG-boxes at its N-terminus. HmbB is primarily localized to mitochondria but occasionally appears in the nucleus. Deletion of HmbB in A. niger affects mycelial growth and morphology, conidia formation, and secondary metabolite production.A. niger possesses three high-mobility group box (HMGB) proteins: HmbA, HmbB, and HmbC. Studies have shown that HmbA and HmbB play roles in sensing and responding to environmental cues, while HmbC functionally interacts with VeA, a key regulator of asexual and sexual development and secondary metabolism. Within living eukaryotic cells, HMG proteins bind to chromatin, play important roles in regulating chromosome structure, controlling gene expression (transcription factors), and participating in the formation of nucleoprotein complexes. Amino acid sequence alignment of the protein encoded by the VdNBP gene of Verticillium dahliae (VdNBP) with homologous proteins (NBPs) from other fungi revealed amino acid sequences with high homologies of 74.3%-88.0%, suggesting that NBP proteins may share similar functions in fungal cells. Therefore, further investigation of the VdNBP gene is crucial for exploring the biological functions of high-mobility group proteins in fungi.
[0005] Because the pathogenicity of Verticillium dahliae is complex and the interaction between the pathogen and the host plant is unclear, identifying and functionally analyzing genes associated with pathogenicity or virulence of this fungus will help reveal the molecular pathogenesis of Verticillium dahliae. Summary of the Invention
[0006] The purpose of the embodiment of the present invention is to provide an application of the nucleosome binding protein gene VdNBP of Verticillium dahliae, aiming to solve the problems raised in the background technology.
[0007] To address the above problems, the present invention provides a use of a Verticillium dahliae nucleosome binding protein gene VdNBP in inhibiting Verticillium dahliae infection of plants. The nucleotide sequence of the VdNBP gene is shown in SEQ ID NO.1.
[0008] Preferably, the plant comprises cotton.
[0009] Another object of the present invention is to provide an application of a Verticillium dahliae nucleosome binding protein gene VdNBP gene in regulating the growth and development of Verticillium dahliae.
[0010] Preferably, the growth and development include growth rate and propagule yield; the propagules include microsclerotia and conidia.
[0011] Another object of the present invention is to provide a use of a Verticillium dahliae nucleosome binding protein gene VdNBP gene in regulating the pathogenicity of Verticillium dahliae.
[0012] Preferably, the pathogenicity includes at least one of disease index, hyphae penetration ability and host colonization ability.
[0013] Another object of the present invention is to provide an application of a Verticillium dahliae nucleosome binding protein gene VdNBP gene in preventing and treating cotton Verticillium wilt.
[0014] Another object of the present invention is to provide a Verticillium dahliae mutant for preventing and controlling cotton Verticillium wilt. The method for constructing the Verticillium dahliae mutant is as follows: based on a wild-type strain of Verticillium dahliae, the VdNBP gene is knocked out.
[0015] This study clarifies the pathogenic mechanism of the VdNBP gene in Verticillium dahliae, providing a basis for controlling the disease and developing novel fungicides. Specifically, the study analyzed the expression of the VdNBP gene at different times and in different tissues. The results revealed that wild-type strains of V. dahliae expressed the highest levels of VdNBP in mycelia cultured on PDA solid medium. Based on the principle of homologous recombination, a knockout vector targeting VdNBP was constructed. Conidia of the cotton Verticillium dahliae strain V592 were transformed via Agrobacterium-mediated genetic transformation (ATMT) to screen for VdNBP knockout mutants. Simultaneously, a complementation vector targeting VdNBP was constructed to screen for VdNBP complementation mutants. Compared with the wild-type strain and the complementation mutant, the VdNBP knockout mutant produced more white mycelia, slower growth, and reduced conidia production, resulting in reduced pathogenicity to cotton. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 The results of the effects of different factors on transformation efficiency are shown in the figure; A: temperature; B: microporous filter membrane; C: co-cultured bacterial load; Figure 2 Schematic diagram of the mutant bacterial block luminescence under a fluorescence microscope; A is a schematic diagram of the mutant bacterial block luminescence under bright field white light, and the mutant bacterial block does not produce green fluorescence; B is a schematic diagram of the mutant bacterial block luminescence under blue excitation light, which can emit strong green fluorescence; Figure 3 Schematic diagram of the luminescence of mutant hyphae and spores under a fluorescence microscope; A is a schematic diagram of the luminescence of mutant hyphae under bright field white light, with no green fluorescence produced; C is a schematic diagram of the luminescence of mutant spores under bright field white light, with no green fluorescence produced; B is a schematic diagram of the luminescence of mutant hyphae under blue excitation light, which can emit clear green fluorescence; D is a schematic diagram of the luminescence of mutant spores under blue excitation light, which can emit clear green fluorescence; Figure 4 Figure 1 shows the different colony phenotypes of V592 strain mutants; 1: wild type (sclerotial type); 2: intermediate type; 3: hyphal type; 4: biofilm type; 5: red strain; 6: slow-growing strain; 1-F-6-F: back views of the colonies of the above strains with different colony phenotypes; Figure 5 The results of T-DNA insertion copy number detection are shown in Figure 2; M: DNA molecular weight standard; hybridization probe is 32 P-labeled EGFP fragment (shown in the right panel); Figure 6 The following are the results of obtaining mutants with reduced pathogenicity and T-DNA insertion copy number analysis; A and B: Pathogenicity determination of the mutant Mut.2 and symptoms of cotton seedlings 30 days after inoculation; C: Southern hybridization analysis, T-DNA copy number analysis in the Mut.2 mutant strain and copy number analysis of the MGen2 gene in V592 genomic DNA; Figure 7 Figure 2 is the result of cloning and expression analysis of the mutant gene MGen2; Figure 8 This is a comparison of the relative expression levels of the VdNBP gene in the mycelium, conidia, and sclerotia of the wild-type strain V592; Figure 9 This is a comparison of the relative expression levels of the VdNBP gene of the V592 strain cultured in Cha's medium for different time periods; Figure 10 The figure is a comparison of the relative expression levels of the VdNBP gene in V592 strain cultured with cotton root system for different time periods; Figure 11 The figure shows the comparison of the relative expression levels of VdNBP gene in strain V592 under cotton root induction and non-induction culture conditions; Figure 12 Colony morphology diagram of the Verticillium dahliae ΔVdNBP mutant, the complemented mutant and the wild-type strain V592 constructed in the present invention; Figure 13 The microscopic observation results of microsclerotia formation of the Verticillium dahliae ΔVdNBP mutant, the complemented mutant and the wild-type strain V592 constructed in the present invention; Figure 14 The results of spore production determination of the Verticillium dahliae ΔVdNBP mutant, the complemented mutant and the wild-type strain V592 constructed in the present invention are shown; Figure 15 Figure 2 is a microscopic observation result of the sporangium stalks of the Verticillium dahliae ΔVdNBP mutant, the complemented mutant and the wild-type strain V592 constructed in the present invention; Figure 16 Magnified images of microscopic observations of conidiophores of the Verticillium dahliae ΔVdNBP mutant, complemented mutant, and wild-type strain V592 constructed in the present invention; A: 100-fold magnification; B: 400-fold magnification; in the figure, from left to right are V592, 5ΔNBP-40, 7NBP-11, and 5NBP-2.
[0017] Figure 17 Figures 1 and 2 show the expression analysis, colony morphology, and pathogenicity determination results of the wild-type V592 strain, VdNBP gene knockout mutant, and T-DNA insertion mutant. Figure A shows the expression analysis results of the wild-type V592 and mutants. Figure B shows the colony morphology of the wild-type V592 and mutants. Figure C shows the pathogenicity determination results of the wild-type V592 and mutants. Figure 18 This is a graph showing the results of testing the pathogenicity of the Verticillium dahliae ΔVdNBP mutant constructed in the present invention and the wild-type strain V592 to cotton. DETAILED DESCRIPTION
[0018] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.
[0019] In the early stage of the present invention, cotton roots were used to induce the expression of Verticillium dahliae related genes. Analysis revealed that the VdNBP gene was expressed in large quantities in the early stage of induction. Sequence alignment showed that the gene belonged to the high mobility group protein superfamily.
[0020] The embodiment of the present invention provides a T-DNA insertion method for screening pathogenic genes. A gene involved in the pathogenicity of Verticillium dahliae was screened out. Its sequence was analyzed and named as VdNBP gene, which is a Verticillium dahliae nucleosome binding protein gene.
[0021] Specifically, in an embodiment of the present invention, the nucleotide sequence of the VdNBP gene is shown in SEQ ID NO: 1. In order to clarify whether the knockout of the VdNBP gene affects the conidia formation of Verticillium dahliae, the present invention constructed a Verticillium dahliae mutant ΔVdNBP with the VdNBP gene knocked out based on the wild-type strain V592, and performed gene complementation on the basis of ΔVdNBP to obtain the complemented mutant ECVdNBP. The method for constructing the VdNBP gene-knockout mutant ΔVdNBP of Verticillium dahliae was completed using the principle of homologous recombination. For details, please refer to the existing technology for obtaining knockout, complementation and overexpression mutants (WANG S, XING H, HUA C, GUO HS, ZHANG J. An improved single-step cloning strategy simplifies the Agrobacterium tumefaciens- mediated transformation (ATMT)-based gene-disruption method for Verticillium dahliae. Phytopathology, 2016, 106(6): 645-652.).
[0022] This study used the highly pathogenic Verticillium dahliae strain V592 from Xinjiang cotton as the starting material and constructed a T-DNA insertion mutant library containing 15,000 transformants using Agrobacterium-mediated transformation (ATMT). Analysis of the biological characteristics, pathogenicity, and T-DNA insertion copy number of some of these mutants revealed a correlation between the mutant colony phenotype and their pathogenicity, conidia production, and T-DNA copy number. Furthermore, this study screened and identified a pathogenicity-related gene, designated VdNBP.
[0023] A series of experiments using ΔVdNBP, the complementary mutant EC-VdNBP, and the wild-type strain V592 revealed that the ΔVdNBP mutant exhibited more white hyphae, slower growth rate, and reduced conidia production. Pathogenicity analysis also revealed a significantly reduced disease index and less severe symptoms in the ΔVdNBP mutant, suggesting that the ΔVdNBP gene is involved in the growth and pathogenicity of Verticillium dahliae.
[0024] The present invention knocks out the VdNBP gene and complements its function, and studies the function of the gene in the growth and development of Verticillium dahliae and its interaction with plants. The VdNBP gene plays an important role in the growth and development, spore production and pathogenicity of Verticillium dahliae.
[0025] The following describes the effects of the VdNBP gene provided by the present invention on the growth and development, and pathogenicity of Verticillium dahliae in conjunction with specific examples, but they should not be construed as limiting the scope of protection of the present invention.
[0026] Example 1: Effects of different factors on conversion effect A single colony of Agrobacterium containing the binary vector pSULPH-GFP was picked and inoculated into MM liquid medium (containing Kan and Rif), cultured with shaking, centrifuged for 10 minutes, and the bacteria were collected; the bacteria were washed twice with IM liquid medium (10 mL each time), and then resuspended with IM liquid medium (containing AS, MES, Kan) and the concentration was adjusted to OD 600 =0.20-0.25; then shake culture for 6 h. The preserved Verticillium dahliae V592 strain was activated and inoculated into a 250 mL Erlenmeyer flask of Czapek liquid medium (containing Kan) at 26 °C and 200 r·min. -1 After shaking culture for 5 days, conidia were filtered through sterile gauze and collected by centrifugation for 10 min. The spores were washed twice with IM liquid medium (10 mL each time) and resuspended in IM liquid medium (containing AS) to adjust the concentration to 1.0 × 10 7 cfu·mL -1 Mix equal volumes of treated Agrobacterium tumefaciens suspension and V592 strain spore suspension, shake well, and spread the mixture (set four gradients of 50 μL, 100 μL, 150 μL, and 200 μL, respectively) on IM solid medium (containing AS and MES) covered with nitrocellulose membrane (NC membrane, 0.45 µm) or kraft paper, and culture in the dark for about 36 h (set two temperature gradients of 26 ℃ and 28 ℃).
[0027] The results are as follows Figure 1 As shown in the figure, it can be seen that the OD of Agrobacterium liquid 600 =0.20-0.25, co-cultivation temperature was 26 ℃ ( Figure 1 A), the microporous membrane is NC membrane ( Figure 1 B), the plating volume for co-culture was 100 μL ( Figure 1 The conversion effect is best when the C) is used, and the conversion rate can reach 300×10 -6 -1000×10 -6 Example 2: Luminescence of mutant bacterial masses, hyphae and spores under a fluorescence microscope The co-cultures on IM solid medium were harvested with sterile water and plated onto SM solid medium (containing Chl, Cef, and Car). After incubation at 26°C for four days, transformants were plated onto PDA medium (containing Chl, Cef, and Car) for further resistance screening. 264 mutants were randomly selected from the mutant library and isolated by single spore isolation. These mutants were then tested for false positives. Because the binary plasmid vector pSULPH-GFP carries a GFP reporter gene, the expression product of which, green fluorescent protein, emits green fluorescence under ultraviolet and blue excitation light, successful T-DNA insertion and expression are considered to be associated with positive transformant tissues. Therefore, transformants that exhibit green fluorescence under blue excitation light are considered positive, while those that do not are considered false positives. Finally, the positive transformants were tested for genetic stability. The positive transformants were transplanted to ordinary PDA medium and subcultured 5 times, and then transferred to PDA medium (containing Chl, Cef, and Car) for resistance testing. If the transformants could still grow normally on the resistance medium and the phenotype was stable, they were considered genetically stable and stored at -80°C.
[0028] The results are as follows Figure 2 and Figure 3 As can be seen from the figure, no green fluorescence was observed in 15 of the 264 randomly selected transformants, with a ratio of 5.68%, that is, a false positive rate of 5.68%; in addition, it was found that the green fluorescence produced by the blocks and hyphae of the sclerotial type mutants was generally stronger than that of the intermediate type, hyphae type and film type, which may be related to the colony texture structure of different phenotypic strains.
[0029] Example 3: Different colony phenotypes of V592 strain mutants The 2,667 mutant strains obtained from the same batch were statistically analyzed. The mutant strains were first transplanted onto PDA medium (containing Chl, Cef, and Car) resistance plates and cultured at 26°C for 10 days. A 1-cm diameter bacterial cake was punched from the edge of the colony using a borer. This cake was inoculated onto the center of the PDA medium plate and cultured in the dark at 26°C for 10 days. The mutant strains were then classified based on their colony morphology and the number of black microsclerotia. The classification criteria were: Sclerotia type: produces both hyphae and sclerotia, usually forming a white hyphae mass in the center of the colony, and a large number of black microsclerotia in the colony matrix; Intermediate type: produces both hyphae and sclerotia, but generally the colony only produces a small amount of aerial hyphae and a very small amount of microsclerotia; Mycelial type: only hyphae are produced without sclerotia. The colony produces well-developed white velvety aerial hyphae, and no black microsclerotia are produced even after 14 days of culture. Biofilm type: The colony is film-shaped, the hyphae grow close to the culture medium, there are very few aerial hyphae, and no black microsclerotia are produced.
[0030] The results are as follows Figure 4 As shown, the results showed that the vast majority of mutants had a colony phenotype similar to that of strain V592, namely, the sclerotial type, accounting for 2454 strains (92.01% of the total). This was followed by the intermediate type, hyphal type, and pellicle type, accounting for 4.54%, 3.19%, and 0.15% of the total, respectively. Furthermore, we selected three strains from this batch of materials with very unique phenotypes. One mutant had a bright red colony with a central white hyphae mass, produced a small amount of black microsclerotia, and exuded a large amount of red pigment into the culture medium. The other two mutants exhibited slow growth, produced a small amount of white hyphae and a large amount of black microsclerotia, and had extremely irregular colony edges.
[0031] Example 4: T-DNA insertion copy number detection A total of 151 positive mutant strains (57 sclerotial types, 20 intermediate types and 74 hyphal types) were selected from the mutant library, transplanted onto ordinary PDA medium, and cultured at 26°C for 10 days. Genomic DNA of each strain was then extracted and analyzed by Southern hybridization, with strain V592 as the control.
[0032] 1. Collection of fungal hyphae and conidia Ten bacterial cakes with a diameter of 1 cm were taken from the edge of the colony and inoculated into a 100 mL Erlenmeyer flask containing 100 mL of Cha's liquid medium (containing Kan) at 26°C and 200 r·min. -1 The mixture was shaken and cultured for 3 days. Centrifuged in a 50 mL centrifuge tube (12000 r·min -1 , centrifuged for 5 min) to collect the mycelium and conidia mixture, and then the mixture was divided into 2 mL centrifuge tubes and centrifuged at 12000 r·min -1 , centrifuge for 5 minutes, discard the supernatant and store it at -80℃ for later use.
[0033] 2. Large-scale extraction of fungal genomic DNA (CTAB method, for Southern blot hybridization) Basic steps for large-scale extraction of genomic DNA: 1) Grind the collected material (mycelium and conidia mixture) under low-temperature liquid nitrogen conditions until powdery. Aliquot 0.2 g into 2.0 mL centrifuge tubes containing 700 μL of extraction and lysis buffer (100 mmol / L Tris-HCl, pH 8.0, 50 mmol / L EDTA, pH 8.0, 1.5 mol / L NaCl, and 2% CTAB). Immediately vortex mix, then incubate in a 65°C water bath for 1 hour (mixing every 15 minutes). 2) Add 200 μL of 5 mol / L KAC (potassium acetate) to each tube, mix thoroughly by inversion, and place on ice for 20 minutes. 3) Add an equal volume of phenol / chloroform / isoamyl alcohol (25 / 24 / 1) mixture to each tube, mix thoroughly by inversion, and then centrifuge at 12,000 rpm for 10 min. Pipette the supernatant into a new tube and repeat twice. 4) Add equal volumes of chloroform / isoamyl alcohol (24 / 1) to each tube, mix thoroughly by inversion, and then spin at 12000 r·min. -1 Centrifuge for 10 min and transfer the supernatant to a new tube; 5) Add 0.6 volumes of isopropanol (pre-chilled at -20°C) to each tube, gently invert to mix (a flocculent precipitate will appear at this point), and let it settle at -20°C for 60 minutes. Then, centrifuge at 12,000 rpm at 4°C for 10 minutes to allow the precipitate to settle to the bottom of the tube. Discard the supernatant. 6) Wash the precipitate twice with 70% ethanol (1 mL each time) and once with anhydrous ethanol (1 mL), then centrifuge at 4°C, 12,000 rpm. -1 Centrifuge for 2 minutes, discard excess ethanol, open the tube cap, and air-dry for 10 minutes; 7) Finally, dissolve the precipitate (genomic DNA) in 100 μL TE and store at -20°C until use. 3. Genomic DNA concentration determination and quality testing 1) DNA concentration determination: The extracted genomic DNA was digested with RNAase at 37°C for 1 hour, and then its concentration was measured using a concentration meter. A 260 / 280 value between 1.8 and 2.0 indicates that the extracted genomic DNA is relatively pure.
[0034] 2) DNA quality test: Mix 2 μg of genomic DNA with an appropriate amount of bromophenol blue and electrophorese on a 0.9% agarose gel in 0.5 × TBE electrophoresis buffer (generally at 150 V for 30 minutes). Stain the gel with EB stain for 10 minutes. Observe the brightness uniformity of the genomic DNA bands using a UV imager and take a picture.
[0035] 4. Southern blot hybridization Basic steps of Southern blot hybridization: 1) Genomic DNA Enzyme Digestion and Electrophoresis: 10 µg of genomic DNA was digested with an appropriate restriction endonuclease (BamH1) at 37°C overnight (enzyme digestion system: 30 µL Butter, 20 µL endonuclease, 30 µg of genomic DNA, and double-distilled water to 300 µL). The digested product was then precipitated with isopropanol at -20°C and washed with 70% ethanol. The product was then fully dissolved in 40 µL of sterile distilled water and electrophoresed on a 0.9% agarose gel (20 cm × 20 cm) at 40 V overnight. 2) Agarose gel treatment: After overnight electrophoresis, when bromophenol blue reaches 2 cm from the bottom edge, reverse the positive and negative poles and run the gel in reverse for 5 minutes. The gel is then photographed in a UV imager. The gel is then decolorized, denatured, and neutralized in sequence. Specific steps: First, decolorize the gel with 0.2 mol / L HCl (approximately 20 minutes). Complete decolorization is indicated by the bromophenol blue turning from blue to yellow. Next, denaturate the gel with denaturing solution (0.5M NaOH, 1.5M NaCl) for DNA denaturation (approximately 30 minutes). The treatment is complete when the bromophenol blue turns from yellow back to blue. Finally, neutralize the gel with neutralizing solution (0.5M Tris-HCl, 1.5M NaCl, concentrated hydrochloric acid adjusted to pH = 7.2) (approximately 30 minutes). 3) Transfer of DNA blot: Transfer the DNA blot from the agarose gel to a Hybond N+ nylon membrane using upward capillary transfer using 20× SSC as the transfer buffer. Refer to the protocol in Molecular Cloning. 4) Prehybridization: Fix the DNA to the nylon membrane by UV crosslinking (UV intensity automatically reduced from 1200 to 0, crosslinking once on both the front and back sides). Then, lay the membrane face-up against the wall of the hybridization tube. Remove any bubbles and add approximately 10 mL of prehybridization buffer (100 mL system formula: 5 mL 100× Denhart's, 25 mL 20× SSPE, 2.5 mL 20% SDS, 200 μL ssDNA, 67.5 mL deionized water). Prehybridize with rotation in a 65°C hybridization oven for at least 1 hour. 5) DNA probe labeling: Take 25 ng of DNA probe, which is a 720-bp fragment of the EGFP gene sequence on the T-DNA. Then, label the probe DNA with α-[³²P]dCTP according to the probe labeling kit (Promega). 6) Southern hybridization: Add the probe labeled with α-[³²P]dCTP to the prehybridization buffer and hybridize overnight at 65°C (usually 12 hours). 7) Washing the hybridization membrane: Discard the hybridization solution and wash the membrane at 65°C with the following wash solutions to remove any free radioactive signal: 2× SSC / 0.1% SDS, 15 minutes each, two washes; 0.2× SSC / 0.2% SDS, 5 minutes each, one wash. 8) Scanning and imaging: After washing the hybridization membrane, wrap it with cellophane and place it in a phosphor screen dark folder with the front side of the membrane facing the phosphor screen. Expose overnight (usually 12 hours is sufficient). Finally, scan the hybridization signal on the phosphor screen with a Storm 840 scanner (Amersham Biosciences).
[0036] The results are as follows Figure 5 The results showed that a total of 131 mutants successfully hybridized. Of these, 93 had single T-DNA insertions, with a single insertion rate of approximately 70.99%. Another 33 had double insertions and 5 had triple insertions, with probabilities of 25.19% and 3.82%, respectively. Statistical analysis of the hybridization results by strain type revealed that the single T-DNA insertion rate of sclerotial mutants was 80.00%, significantly higher than that of intermediate (69.23%) and hyphal (64.71%) mutants. This difference may be explained by the fact that the more genes mutated in the wild-type strain's genome, the greater the degree of morphological change in the mutant.
[0037] Example 5: Acquisition of attenuated virulence mutants and analysis of T-DNA insertion copy number 93 mutants with single T-DNA insertions were obtained as materials. The pathogenicity of each mutant strain was tested 2-3 times, and mutant strains with significantly reduced pathogenicity were screened out. The T-DNA insertion copy number analysis of the selected mutant strains was performed by Southern hybridization to further determine the T-DNA insertion copy number in the mutant genome. The genomic DNA used for Southern hybridization was digested with Xba1 and EcoR1, and molecular hybridization was performed using EGFP labeled with α-[³²P]dCTP as a probe.
[0038] The results are as follows Figure 6 Results show that pathogenicity testing of 93 mutants harboring single-copy T-DNA insertions revealed a mutant strain with severely reduced pathogenicity, designated Mut.2. Southern hybridization with the probe revealed that the T-DNA insertions in all Mut.2 strains were single-copy.
[0039] Example 6: Cloning and expression analysis of the mutant gene MGen2 1. Analysis of T-DNA insertion sites of mutant genes: Using the genomic DNA of the mutant strain as a template, the flanking sequences of the T-DNA insertion site of the mutant strain were obtained by TAIL-PCR amplification and gene sequencing, respectively. BLAST homology sequence alignment analysis was performed in the whole genome library of Verticillium dahliae (http: / / www.broadinstitute.org / annotation / genome / verticillium_dahliae / Blast.html?sp=Sblastn) to predict the genes in the mutant strain genome that may cause mutations. Sequencher 4.7 Demo and other software were then used to perform sequence alignment analysis between the obtained mutant gene sequences and the flanking sequences of the T-DNA insertion site to predict the location of the T-DNA insertion in the mutant strain genome.
[0040] 2. Cloning of mutant genes Based on the obtained gene sequence of possible mutations, specific primers for the gene were designed, and the full-length gene sequence (from the start codon to the stop codon) was amplified and sequenced by PCR using the genomic DNA of the V592 strain as a template, thereby cloning the mutant gene.
[0041] 3. Analysis of mutant gene copy number Based on the sequence of the mutant gene, primers specific for an exon of the gene were designed. The exon sequence was amplified by PCR and used as a hybridization probe. Genomic DNA from the V592 strain was extracted and digested with BamHI, PstⅠ, and SalⅠ. Southern hybridization was then performed using the mutant gene exon sequence labeled with α-[³²P]dCTP as a probe to determine the copy number of the mutant gene in the V592 strain's genomic DNA.
[0042] 4. Analysis of mutant gene expression in mutant strains The total RNA of the mutant strain was extracted, and then the exon sequence of the mutant gene labeled with α-[³²P]dCTP was used as a probe to perform Noothern hybridization on the total RNA of the mutant strain to analyze the expression of the mutant gene in the mutant strain.
[0043] 5. Tissue-specific expression analysis of mutant genes The preserved Verticillium dahliae V592 strain and mutant strain were cultured on ordinary PDA medium at 26 ℃ for 10 days. Ten bacterial cakes with a diameter of 1 cm were taken from the edge of the colony and inoculated into a 500 mL triangular flask containing 200 mL of Cha's liquid medium (containing Kan) at 26 ℃ and 200 r·min- 1 The mixture was shaken and cultured for 3 days. Centrifuged in a 50 mL centrifuge tube (12000 r·min -1, centrifuged for 5 min) to collect hyphae, conidia and the mixture of the two, and then divided them into 2 mL centrifuge tubes, and centrifuged at 12000 r·min -1 The supernatant was discarded and stored at -80°C until use. Total RNA from the V592 strain and the mutant strain was then extracted. Northern hybridization was performed on the total RNA from the V592 strain and the mutant strain using the mutant gene exon sequence labeled with α-[³²P]dCTP as a probe to analyze the tissue-specific expression of the mutant gene in the V592 strain and the mutant strain.
[0044] 6. Correlation analysis between the expression level of mutant genes and culture time The preserved Verticillium dahliae V592 strain was cultured on ordinary PDA medium at 26°C for 10 days. Twenty bacterial cakes with a diameter of 1 cm were taken from the edge of the colony and inoculated into a 1 L triangular flask containing 800 mL of Cha's liquid medium (containing Kan) at 26°C and 200 r·min. -1 After shaking culture, the mixture of mycelium and conidia cultured for 1, 2, 3, 4, and 5 days (100 mL each time) was taken and centrifuged in a 50 mL centrifuge tube (12000 r min -1 , centrifuge for 5 min), and then dispense into 2 mL centrifuge tubes, and centrifuge at 12000 r·min -1 The supernatant was discarded and stored at -80°C until use. Total RNA of the V592 strain was then extracted and Noothern hybridization was performed on the total RNA of the V592 strain using the mutant gene exon sequence labeled with α-[³²P]dCTP as a probe to analyze the correlation between the expression level of the mutant gene in the V592 strain and the culture time. The results are as follows Figure 7 As shown, the results showed that the T-DNA in the Mut. mutant strain was inserted in the transcribed region (first exon) of the MGen2 gene, 45 bp away from the start codon, encoding 248 amino acids; The expression level of MGen2 gene in the Mut.2 mutant strain was severely downregulated compared with that in the V592 strain. Tissue-specific expression analysis showed that the expression level of MGen2 gene in hyphae was significantly higher than that in spores.
[0045] Example 7: Relative expression levels of the VdNBP gene in mycelia, conidia, and sclerotia of the wild-type strain V592; Wild-type V592 bacterial plugs were cultured in 100 mL of Czapek-Dox liquid medium for 3 days, then filtered through four layers of gauze to collect spores. Meanwhile, wild-type V592 tissue cultured on PDA and BMM solid media for 2 and 20 days, respectively, was gently scraped using a sterilized glass slide to obtain hyphae and microsclerotia. The spores, hyphae, and microsclerotia were snap-frozen in liquid nitrogen, followed by RNA extraction and cDNA synthesis. qPCR reactions were prepared using SYBR Select Master Mix, using the internal reference gene β-tubulin (DQ266153). Each reaction was repeated in triplicate. Data were processed and analyzed using the 2-ΔΔCt method using SPSS 26.0 software.
[0046] The results are as follows Figure 8 The results showed that the expression level of VdNBP gene was highest in hyphae and lower in spores and microsclerotia, indicating that the nucleosome binding protein gene VdNBP may play a certain role in the spores, hyphae and microsclerotia of Verticillium dahliae.
[0047] Example 8: Relative expression levels of VdNBP genes in strain V592 cultured in Czapek medium for different periods of time On a clean bench, wild-type V592 bacterial suspension, which had been shaken at 26°C for 3 days, was filtered through four layers of gauze into a 50-mL centrifuge tube and centrifuged at 8000 rpm for 10 min in a high-speed centrifuge at 4°C. The suspension was resuspended in Czapek-Dox liquid medium and evenly distributed into conical flasks containing 100 mL of Czapek-Dox liquid medium. The suspension was cultured for 8, 12, 24, 36, and 48 h, collected, and snap-frozen in liquid nitrogen. RNA was extracted and cDNA synthesized. qPCR reactions were prepared using SYBR Select Master Mix, using β-tubulin (DQ266153) as the internal reference gene. Each reaction was repeated three times. Data were processed and analyzed using the 2-ΔΔCt method using SPSS 26.0 software.
[0048] The results are as follows Figure 9 As shown in the results, the nucleosome binding protein gene VdNBP was upregulated over time, with the highest expression level at 10 h of induction, indicating that the VdNBP gene plays an important role in the early stage of Verticillium dahliae infection of the host.
[0049] Example 9: Relative expression levels of the VdNBP gene in cotton root system during root induction culture of the V592 strain at different times; Select several full-grained Junmian No. 1 seeds, remove the seed coat, treat them with 0.1% HgCl2 for 3 min on a clean bench, wash them three times with sterile water, and place them on sterilized filter paper to dry the surface moisture; use an alcohol lamp to burn tweezers and wait for the temperature to drop before picking up the seeds and placing them in a tissue culture bottle containing 50 mL MS solid culture medium, about 4-5 seeds per bottle, and place them in a 28°C incubator in the dark for 7 days, during which time the seedlings are supported once.
[0050] On a clean bench, the wild-type V592 bacterial suspension that had been shaken at 26°C for 3 days was filtered through four layers of gauze into a 50 mL centrifuge tube and centrifuged at 8000 r / min at 4°C for 10 min. The bacteria were resuspended in Czapek-Dox liquid medium and evenly distributed into conical flasks containing 100 mL Czapek-Dox liquid medium. Cotton roots cultured in MS solid medium were inoculated into each conical flask and cultured at 26°C and 200 r / min for 8 h, 10 h, 12 h, and 24 h, respectively. V592 bacterial suspension without cotton root induction at different times was used as a control. The induced bacterial suspension was collected and quickly frozen in liquid nitrogen for RNA extraction and cDNA synthesis. The SYBR Select Master The qPCR reaction system was prepared using a PCR product mix. The internal reference gene was β-tubulin (DQ266153). Each reaction was repeated three times. The data were processed and analyzed for significance using the 2-ΔΔCt method and SPSS 26.0 software.
[0051] The results are as follows Figure 10 The results showed that the nucleosome binding protein gene VdNBP was upregulated with increasing induction time, with the highest expression level at 10 h of induction, indicating that the VdNBP gene plays an important role in the early stage of Verticillium dahliae infection of the host.
[0052] Example 10: Relative expression levels of the VdNBP gene in V592 strain under cotton root induction and non-induction culture conditions Select several full-grained Junmian No. 1 seeds, remove the seed coat, treat them with 0.1% HgCl2 for 3 min on a clean bench, wash them three times with sterile water, and place them on sterilized filter paper to dry the surface moisture; use an alcohol lamp to burn tweezers and wait for the temperature to drop before picking up the seeds and placing them in a tissue culture bottle containing 50 mL MS solid culture medium, about 4-5 seeds per bottle, and place them in a 28°C incubator in the dark for 7 days, during which time the seedlings are supported once.
[0053] On a clean bench, wild-type V592 culture, which had been shaken at 26°C for 3 days, was filtered through four layers of gauze into a 50-mL centrifuge tube and centrifuged at 8000 rpm for 10 min in a high-speed centrifuge at 4°C. The culture was resuspended in Czapek-Dox liquid medium and evenly distributed into conical flasks containing 100 mL of Czapek-Dox liquid medium. Cotton roots cultured in MS solid medium were inoculated into each conical flask and incubated at 26°C at 200 rpm for 10 h. V592 culture without cotton root induction at different times was used as a control. The induced culture was collected and quickly frozen in liquid nitrogen. RNA was extracted and cDNA synthesized as in 2.2.3. qPCR reactions were prepared using SYBR Select Master Mix with β-tubulin (DQ266153) as the internal reference gene. Each reaction was replicated three times, and data were analyzed using the 2-ΔΔCt method using SPSS software. 26.0 Complete processing and significance analysis.
[0054] The results are as follows Figure 11 The results showed that the expression of VdNBP gene increased sharply at 10 h, which was about 20 times higher than that in other periods and about 10 times higher than that in non-induced conditions, indicating that the expression of VdNBP gene in Verticillium dahliae was induced by the host and may be related to host interaction.
[0055] Example 11: This example provides a method for constructing a mutant of Verticillium dahliae with the VdNBP gene knocked out, ΔVdNBP, as follows: Primers were designed based on the upstream and downstream homology arms of the VdNBP gene (nucleotide sequence shown in SEQ ID NO: 1) to construct a knockout vector. The wild-type strain V592 was used as the initial strain to construct a mutant, and the VdNBP gene-knockout mutant 5ΔNBP-40 of Verticillium dahliae was obtained.
[0056] The specific construction process is as follows: (1) Amplification of the homology arms of the target gene Two pairs of primers were designed using the upstream and downstream homology arms of the VdNBP gene. Genomic DNA from the deciduous strain V592 was used as a template, and I-5 2× High-Fidelity Master Mix was used to amplify the upstream and downstream homology arms of the VdNBP gene. Primers VdNBP-sf and VdNBP-sr amplified the upstream homology arm of the VdNBP gene, while primers VdNBP-xf and VdNBP-xr amplified the downstream homology arm of the VdNBP gene. The PCR reaction system consisted of 25 μL of I-5 2× High-Fidelity Master Mix, 1 μL each of VdNBP-s(x)-f / VdNBP-s(x)-r, and 1 μL of DNA, added to a 0.2 mL PCR tube and made up to 50 μL with ddH2O. The PCR reaction procedure was as follows: preheat at 98°C for 1 minute, melt at 98°C for 15 seconds, anneal at 60°C for 15 seconds, extend at 72°C for 15 seconds, hold at 72°C for 5 minutes, and terminate at 20°C for 2 minutes. 30 cycles were repeated from the melt to the extension phase. 3-5 μL of PCR product was electrophoresed on a 1% agarose gel containing Goldenview buffer. The gel was visualized and photographed using a UV gel imager. The remaining PCR product with the correct band was purified using the OMEGA Biotech Gel Extraction Kit and the concentration was determined.
[0057] Among them, the upstream and downstream homology arm primers are as follows: VdNBP-sf (nucleotide sequence shown in SEQ ID NO: 2), specifically: CTTGCTGAGGTCTTAATTAA ACCTAAGGTACCTACAGCA; VdNBP-sr (nucleotide sequence shown in SEQ ID NO: 3), specifically: AGTGCTGAGGCATTAATTAA TCAGCGGTAGAAGCGA; VdNBP-xf (nucleotide sequence shown in SEQ ID NO: 4), specifically: CCCGCTGAGGACTTAATTAAGAGGCATTGACGTCCTA; VdNBP-xr (nucleotide sequence shown in SEQ ID NO: 5), specifically: CTCGCTGAGGGTTTAATTAAACAAACCCTTTCAACCTTTGCCA.
[0058] (2) The knockout vector used in this experiment was pGKO-HPT. The vector plasmid was linearized with PacⅠ using the following enzyme digestion system: 5 μL of PacⅠ, 35 μL of vector plasmid, 5 μL of 1×Cutsmart, and ddH2O was added to 50 μL. The enzyme digestion was performed in a 37°C water bath for 10-12 h. The next day, 3-5 μL of PCR product was electrophoresed on a 1% agarose gel containing Goldenview. The enzyme digestion bands were observed under a UV gel imager. The target fragment was carefully cut out and the linearized vector fragment was purified using the Gel Extraction Kit from OMEGA Biotechnology. After verification by gel electrophoresis, the purified vector fragment was aliquoted and its concentration was determined. It was then stored in a -20°C refrigerator for future use to avoid repeated freezing and thawing.
[0059] (3) In-fusion cloning: The upstream and downstream homology arms of the target gene obtained after amplification and purification and the vector fragment obtained after linearization and purification were ligated using in-fusion enzyme. The system is as follows: 3 μL each of the purified products of the upstream and downstream homology arms of the target gene, 1 μL each of 5×CE Multis Buffer and Exnase Multis, and 2 μL of the linearized vector. The above solution was placed in a 37°C water bath for 30 min, placed on ice for subsequent experiments or temporarily stored in a -20°C refrigerator, and heat-shocked to transform E. coli and extract the recombinant plasmid.
[0060] (4) Agrobacterium-mediated genetic transformation Electroporation of Agrobacterium: Remove the recombinant plasmid and competent Agrobacterium cells from a -20°C freezer and a -80°C freezer, respectively, and quickly thaw on ice. Add 1 μL of the recombinant plasmid to the competent Agrobacterium cells and incubate on ice for 10 minutes. Wipe dry the walls of a sterilized, pre-chilled electroporation cup, add the mixture, and perform a brief electroporation in an electroporator. Add 500 μL of antibiotic-free LB liquid medium, pipette to mix thoroughly, and remove the mixture from the electroporation cup. Place the tube in a 1.5 mL centrifuge tube and shake at 200 rpm at 28°C for 45 minutes. Centrifuge briefly, discard 500 μL of the supernatant, and thoroughly mix the remaining culture with a pipette. Spread the culture evenly onto LB solid medium containing Kan and Rif antibiotics in a laminar flow hood. Incubate in a 28°C incubator in the dark for 2–3 days. Screen for positive transformants using PCR, and shake the correct colonies to obtain the Agrobacterium culture. Take 100 μL of Agrobacterium tumefaciens liquid to 10 mL of IMAS (containing Kan) liquid medium, shake at 200 rpm in a 28 ° C shaker until the OD600 value is about 0.5, thaw the collected conidia of Verticillium dahliae on ice in advance, mix the conidia of Verticillium dahliae and Agrobacterium in a 1:1 ratio; evenly spread 200 μL of the mixture on the sterilized IMAS solid medium, repeat 3 times, and use the plate coated with only the conidia of Verticillium dahliae as the positive control, and the plate coated with only the bacterial solution of the recombinant plasmid of Agrobacterium tumefaciens as the negative control After 48 hours, the filter paper was removed from the IMAS solid medium and placed on a PDA plate (containing HygB, Cef, Car, and F2dU). The plate was incubated in the dark at 26°C for 5–7 days. Once transformants emerged, a single fungal colony was picked on a clean bench and streaked onto PDA (containing Cef and HygB). The plate was incubated in the dark at 26°C for approximately 10 days. During this time, the fungal growth on the plate was continuously monitored. Only homologous recombination knockout transformants would grow on this resistant plate, while false-positive transformants would not. Once positive transformants emerged, single spores were isolated and used for subsequent testing. Ultimately, two knockout transformants were obtained.
[0061] Example 12: This example provides a VdNBP gene complementation mutant EC of Verticillium dahliae - The construction method of VdNBP is as follows: Verticillium dahliae mutant constructed using Example 11 Δ VdNBP was used as the initial strain, and two VdNBP gene complementation mutants of Verticillium dahliae, 7NBP-11 and 5NBP-2, were constructed.
[0062] The vector used was p1300-Neo-oLiC-Cas9-TtrpC. Xba I and Bam HI double enzyme digestion linearization preparation 50 µL Xba I and Bam HI double enzyme digestion system: p1300-Neo-oLiC-Cas9-TtrpC 20 μL, Xba I 1 μL, Bam HI 1 μL, 1× M buffer 2.5 μL, ddH2O 25.5 μL. Enzyme digestion was performed overnight at 37°C, and the target band was recovered the next day by gel excision. Complementary recombinant plasmids were constructed using the ClonExpress II One-Step Cloning Kit. p1300-Neo-oLiC-Cas9-TtrpC and the VdNBP gene were ligated using Exnase II. The single-fragment ligation system for p1300-NeO-LiC-Cas9-TtrpC was as follows: 5× CE II buffer 2 μL, p1300-Neo-oLiC-Cas9-TtrpC 200 ng, target gene fragment 80 ng, Exnase II 1 μL, ddH2O up to 10 μL, and ligation was incubated at 37°C for 30 min.
[0063] The remaining methods are the same as those for knockout. The difference from the acquisition of positive transformants of knockout mutants is that the acquisition of knockout mutants is to use 1.0×10 conidia of wild type V592 of Verticillium dahliae to 6 conidia / mL and Agrobacterium containing knockout vector were mixed in equal proportions, and the positive transformants of complementary mutants were obtained by adding 1.0×10 conidia of VdNBP knockout mutant to the culture medium. 6 conidia / mL is mixed with Agrobacterium containing the complementary vector in equal proportions; secondly, the first screening culture medium of the positive transformants of different complementary mutants of the resistance screening culture medium is PDA+HygB+Cef+Tim+G418, and the second screening culture medium is PDA+Cef+G418.
[0064] Example 13: Determination of Colony Growth Rate: A VdNBP gene-knockout mutant of Verticillium dahliae, a prepared VdNBP gene-complemented mutant, and wild-type strain V592 were cultured. Mycelial picks were inoculated in the center of PDA culture medium and incubated in the dark at 22°C. Colony diameters of all strains were measured on days 5 and 9 after inoculation, and the average colony growth rate was calculated according to the following formula.
[0065] The average growth rate of the colony = (colony growth speed = (average colony growth diameter on the 9th day - average colony growth diameter on the 5th day) / 4).
[0066] Three replicates were set for each strain, and the colony morphology was recorded by taking photos on the 15th day.
[0067] Morphological observation of mycelium: Different strains of Verticillium dahliae were cultured by streaking on PDA plates, and then a sterilized cover slip was inserted obliquely into the streaked area. The plates were cultured in the dark at 22°C for 3 days, and the cover slip was removed to observe the mycelial growth under a microscope.
[0068] The results are as follows Figure 12 As shown, the results showed that the VdNBP gene knockout mutant (Mut.2) was significantly slower than the wild-type strain V592, and there was no significant difference in the growth rate of the complemented mutant and the wild-type strain V592, which indicated that the nucleosome binding protein gene VdNBP affected the growth rate of Verticillium dahliae.
[0069] Example 14: Determination of microsclerotia quantity The prepared VdNBP gene-knockout mutant of Verticillium dahliae, the VdNBP gene-complemented mutant prepared in Example 2, and wild-type strain V592 were cultured to obtain bacterial cakes. Approximately 10 bacterial cakes of each strain were punched out using a microporator and inoculated into Czapek liquid medium (containing Kan). The culture was shaken at 200 rpm at 26°C for 3-5 days. Conidia were collected by filtration and the conidia concentration was adjusted to 1.0×10 6 100 μL was evenly spread on a MM plate covered with cellophane (NaNO3 2 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, KCl 0.5 g, citric acid 10 mg, ZnSO4·7H2O 10 mg, FeSO4·7H2O 10 mg, NH4Fe(SO4)2·12H2O 2.6 mg, CuSO4·7H2O 0.5 mg, NnSO4·H2O 0.1 mg, H3BO3 0.1 mg, Na2MoO4·2H2O 0.1 mg, glucose 2 g, agar 1.5 g, distilled water to 1 L, autoclaved at 113°C for 20 min), cultured in the dark at 22°C for 15 d, photographed, scraped from the cellophane, weighed, and recorded in wet weight. The microsclerotia were then placed at room temperature for 48 h to dry, weigh on a balance, and record its dry weight data.
[0070] The results are as follows Figure 13 As shown, the results showed that the nucleosome binding protein knockout mutant VdNBP can produce microsclerotia, indicating that VdNBP has little effect on the formation of microsclerotia in Verticillium dahliae.
[0071] Example 15: In order to clarify whether VdNBP gene knockout affects the conidia formation of Verticillium dahliae, the specific determination method is as follows: The concentration was 1.0×10 6The knockout mutant (constructed strain), complemented mutant (constructed strain) and V592 were inoculated into Czapek-Dox liquid medium respectively, and cultured at 26°C and 200 r / min for 5 days to separate spores. 6 Inoculate 100 μL of a spore suspension containing 100 CFU / mL of spores in Czapek medium (containing Kan). Three biological replicates were set up for each strain. Cultures were shaken at 200 rpm at 26°C in a shaker. Every 24 hours, 1 mL of the suspension was aspirated. Spore concentrations were measured and recorded using a hemocytometer for 7 consecutive days.
[0072] The results are as follows Figure 14 The results showed that from the 4th day onwards, the conidia production of the VdNBP gene knockout mutant strain (Mut.2, 5△NBP-40) was significantly lower than that of the wild-type strain V592. On the 7th day, the conidia production of the VdNBP gene knockout mutant was 0.46 and 0.42 times that of the wild-type strain V592. The complementation mutant EC - The conidia production of VdNBP (7NBP-11) had no significant difference from that of the wild-type strain, indicating that nucleosome binding genes are involved in regulating the conidia production ability of Verticillium dahliae.
[0073] The conidia of the mutant was observed under a microscope. The results were as follows: Figure 15 and Figure 16 As shown in the results, it was found that V592 produced more conidia with conidia clustered at the top, while the VdNBP knockout mutant (5△NBP-40) could not produce whorled conidia, indicating that the reduced conidia production of the VdNBP mutant was related to the reduction of conidia.
[0074] Example 15: To clarify the effect of VdNBP gene knockout on the pathogenicity of Verticillium dahliae, the pathogenicity of the VdNBP gene knockout mutant to cotton was determined using the wild-type strain V592 and the complemented mutant as controls. The pathogenicity determination method is as follows: The knockout mutants, complemented mutants, and V592 constructed above were inoculated into Czapek-Dox liquid medium at 26°C and shaken at 200 rpm for 5 days. After the fifth true leaf of the cotton seedlings grew, 200 mL of 1.0 × 10 7CFU / mL of bacterial solution, with three replicate hydroponic boxes per strain (a total of 36 cotton seedlings). Observe daily after inoculation, counting disease indices every three days from the onset of disease, and generally recording until one month after disease onset. Disease grading is as follows: Grade 0: No disease; Grade 1: Disease on 1-2 cotyledons; Grade 2: Disease on 1 true leaf; Grade 3: Disease on 2 true leaves; Grade 4: Disease on 3 or more true leaves. Disease index is calculated using the following formula: Disease index = [ΣNumber of diseased plants at each grade × Grade number / (Total number of plants × Highest disease grade)] × 100.
[0075] The disease index is the average of three repeated biological experiments.
[0076] The results are as follows Figure 17 and Figure 18 As shown, the VdNBP knockout mutant exhibited reduced pathogenicity compared to the wild-type strain V592. On day 26 of inoculation, the disease index of the wild-type strain V592 was 97.92, while that of the VdNBP knockout mutant was lower than that of V592, indicating that nucleosome-binding protein genes are involved in the pathogenicity of Verticillium dahliae.
[0077] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be determined by the appended claims.
Claims
1. Use of the Verticillium dahliae nucleosome binding protein gene VdNBP gene in inhibiting Verticillium dahliae infection of plants, characterized in that: The nucleotide sequence of the VdNBP gene is shown in the sequence listing SEQ ID NO.
1.
2. The use according to claim 1, characterized in that The plants include cotton.
3. The application of the Verticillium dahliae nucleosome binding protein gene VdNBP gene in regulating the growth and development of Verticillium dahliae is characterized by: The nucleotide sequence of the VdNBP gene is shown in the sequence listing SEQ ID NO.
1.
4. The use according to claim 3, characterized in that The growth and development include growth rate and propagule yield; the propagule includes microsclerotia and conidia.
5. The use of the Verticillium dahliae nucleosome binding protein gene VdNBP gene in regulating the pathogenicity of Verticillium dahliae, characterized in that: The nucleotide sequence of the VdNBP gene is shown in the sequence listing SEQ ID NO.
1.
6. The use according to claim 5, characterized in that The pathogenicity includes at least one of disease index, hyphae penetration ability and host colonization ability.
7. Application of the Verticillium dahliae nucleosome binding protein gene VdNBP gene in preventing and treating cotton Verticillium wilt, characterized in that: The nucleotide sequence of the VdNBP gene is shown in the sequence listing SEQ ID NO.
1.
8. A mutant of Verticillium dahliae for preventing and treating cotton Verticillium wilt, characterized in that: The method for constructing the Verticillium dahliae mutant is as follows: based on the wild-type strain of Verticillium dahliae, the VdNBP gene is knocked out.