Efficient genetic transformation and gene editing method for cabbages

Abstract

The invention relates to a cabbage efficient genetic transformation and gene editing method, which belongs to the biological breeding technology, and comprises the following steps: (1) introducing a CRISPR / Cas9 gene editing vector into a callus of a target cabbage material, (2) screening the cabbage callus into which the CRISPR / Cas9 gene editing vector is successfully introduced, and carrying out regeneration culture on the cabbage callus; (3) screening T0-generation transgenic cabbages subjected to gene editing; wherein the CRISPR / Cas9 gene editing vector contains sgRNA of a target editing gene, the PAM sequence of the CRISPR / Cas9 gene editing vector is 5 '-' NGGT '-3', and N is one of A, C and G. The method can significantly improve the gene editing efficiency and types.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for efficient genetic transformation and gene editing of cabbage. Background Art

[0002] Brassica oleracea is an important biennial herbaceous species in the Brassicaceae family. According to statistics, 3.77 million hectares of cruciferous crops, such as cabbage, broccoli, and cauliflower, are cultivated worldwide, constituting a significant agricultural resource (Li et al., 2024).

[0003] In recent years, CRISPR / Cas9 technology has been widely used in major crops such as rice, wheat, and potatoes. This technology can inhibit gene expression to develop high-yield, disease-resistant, or stress-tolerant crops (Gao, 2021; He et al., 2022).

[0004] However, the current regeneration efficiency of cabbage transgenics is low, resulting in a limited Agrobacterium-mediated transformation efficiency of less than 1.0%, which in turn affects the efficiency of CRISPR / Cas9 gene editing. Compared with the editing efficiency of rice of 68%, the editing efficiency of cabbage is lower, at only 12.9% (Li et al., 2021). Summary of the Invention

[0005] In view of the needs and current status of this field, the present invention provides a method for efficient genetic transformation and gene editing of cabbage based on research results, which is as follows:

[0006] The first aspect of the present invention provides a method for efficient genetic transformation and gene editing of cabbage, characterized in that:

[0007] (1) Introducing CRISPR / Cas9 gene editing vector into the callus tissue of target cabbage material,

[0008] (2) screening cabbage callus tissue successfully introduced with the CRISPR / Cas9 gene editing vector and regenerating and culturing it;

[0009] (3) Screening for T0 generation transgenic cabbage that has undergone gene editing;

[0010] The CRISPR / Cas9 gene editing vector contains sgRNA of the target editing gene, and its PAM sequence is 5'-'NGGT'-3', where N is one of A, C, and G.

[0011] Preferably, the method is characterized in that it further comprises introducing an expression vector expressing the fusion protein GRF5-GIF1-GRF5 before or after introducing the CRISPR / Cas9 gene editing vector into the target cabbage material;

[0012] The amino acid sequence of the fusion protein GRF5-GIF1-GRF5 has any of the following characteristics:

[0013] (1) From N to C terminus, the GRF5-1 polypeptide shown in Seq ID No. 33, the GIF1 polypeptide shown in Seq ID No. 37, and the GRF5-2 polypeptide shown in Seq ID No. 34 were linearly fused; the polypeptides were connected by 3 to 5 alanine residues;

[0014] (2) From N to C terminus, its amino acid sequence is obtained by linear fusion of the GRF5-2 polypeptide shown in Seq ID No. 34, the GIF1 polypeptide shown in Seq ID No. 37, and the GRF5-1 polypeptide shown in Seq ID No. 33; the polypeptides are connected by 3 to 5 alanine residues.

[0015] Preferably, in the method described above, the introduction of the CRISPR / Cas9 gene editing vector is carried out through Agrobacterium-mediated genetic transformation; the introduction of the expression vector expressing the fusion protein GRF5-GIF1-GRF5 is also carried out through Agrobacterium-mediated genetic transformation.

[0016] Another aspect of the present invention provides a cabbage growth regulatory factor fusion protein, characterized in that its structure is expressed as GRF5-GIF1-GRF5, and its amino acid sequence has any of the following characteristics:

[0017] (1) From N to C terminus, the GRF5-1 polypeptide shown in Seq ID No. 33, the GIF1 polypeptide shown in Seq ID No. 37, and the GRF5-2 polypeptide shown in Seq ID No. 34 were linearly fused; the polypeptides were connected by 3 to 5 alanine residues;

[0018] (2) From N to C terminus, its amino acid sequence is obtained by linear fusion of the GRF5-2 polypeptide shown in Seq ID No. 34, the GIF1 polypeptide shown in Seq ID No. 37, and the GRF5-1 polypeptide shown in Seq ID No. 33; the polypeptides are connected by 3 to 5 alanine residues.

[0019] Preferably, the cabbage growth regulatory factor fusion protein is characterized in that its amino acid sequence is shown in Seq ID No.38.

[0020] In another aspect of the present invention, protection is sought for the nucleotide sequence encoding the cabbage growth regulatory factor fusion protein.

[0021] Preferably, the nucleotide sequence is shown as Seq ID No.41.

[0022] In another aspect of the present invention, protection is sought for an expression vector carrying the nucleotide sequence.

[0023] The present invention further provides a kit for improving the efficient genetic transformation and gene editing efficiency of cabbage, characterized in that it comprises a CRISPR / Cas9 gene editing vector, the PAM sequence of the gene editing vector is 5'-'NGGT'-3', wherein N is one of A, C, and G.

[0024] Preferably, the kit is characterized in that it further comprises an expression vector for expressing the cabbage growth regulatory factor fusion protein.

[0025] This invention improves cabbage gene editing and genetic transformation methods. Experimental data show that, using PDS gene editing as an example, replacing the last position of the PAM sequence 5'-NGG-3' in the CRISPR / Cas9 vector with a 'T' significantly increases the number of edits possible and the efficiency of the CRISPR / Cas9 gene editing system in both dicotyledonous cabbage and monocotyledonous rice. Furthermore, transforming the vector expressing the fusion protein GRF5-GIF1-GRF5 increased the average regeneration efficiency of cabbage by 55.2%. These improvements can significantly improve the efficiency of molecular breeding of cabbage. In the breeding application experiments of the cabbage disease susceptibility genes (BoDMR6, BoBPM6) discovered by the inventors at the same time, it was shown that the improved gene editing technology and genetic transformation method of the present invention were used to perform first-generation sequencing on the screened T0 generation positive plants. The conversion efficiency of bobpm6 and bodmr6 were 5.5% and 8.2%, respectively; the editing efficiency was 62.0% and 62.5%, respectively; which were significantly higher than the technical level currently reported in this field (the cabbage genetic transformation efficiency was less than 1%, and the editing efficiency was only 12.9%). BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a schematic diagram of the structure of the PDS gene editing vector constructed in the present invention to study the effects of different PAM sequences on gene editing efficiency and type;

[0027] Figure 2 The experimental results of the effects of different PAM sequences on the efficiency and type of rice gene editing are shown in Figure 2.

[0028] The upper figure shows rice plants in which the OsPDS gene was knocked out using NGGN and NGGT as PAM sequences. The red circles indicate plants that did not undergo gene editing. The lower figure shows the rice OsPDS gene editing efficiency (bar chart) and editing type (line chart). Figure 3The experimental results show the effects of different PAM sequences on the efficiency and type of cabbage gene editing.

[0029] The upper figure shows the situation of knocking out the BoPDS gene using NGGN and NGGT as PAM sequences. Mock represents a cabbage plant without gene editing. The lower figure shows the cabbage gene editing efficiency (bar chart) and editing type (line chart).

[0030] Figure 4 This is the research result of the present invention on the influence of growth condition factors on genetic transformation regeneration efficiency, wherein, in the treatment of expressing GRF5-GIF1-GRF5 fusion protein, the average regeneration efficiency of cabbage was increased by 55.2%.

[0031] Figure 5 The structure of the BoDMR6 gene cloned in the present invention and the gene editing status are shown, where light pink represents the gene coding region (exon), dark pink represents the intron region, and the red short underline target 1 at the bottom of the first exon region represents the sgRNA target region; the nucleotide sequence below represents target region 1, where the wild-type target nucleotide sequence is underlined, and the remaining four are from the T0 generation mutant that underwent gene editing. The blue broken line represents a deletion, and the yellow letters represent an insertion; ACCG before the target represents the PAM sequence.

[0032] Figure 6 The structure of the BoBPM6 gene cloned in the present invention and the gene editing status are shown, where light pink represents the gene coding region (exon), dark pink represents the intron region, and the red short underline target 1 at the bottom of the first exon region represents the sgRNA target region; the nucleotide sequence below represents target region 1, where the wild-type target nucleotide sequence is underlined, and the remaining four are from the T0 generation mutant that underwent gene editing. The blue broken line represents a deletion, and the yellow letters represent an insertion; ACCG before the target represents the PAM sequence.

[0033] Figure 7 The results of the disease resistance study of bodmr6 plants with BoDMR6 gene editing are shown, among which the disease index of black rot inoculated with fungus was reduced from 79.3 to 55.1; the disease index of clubroot inoculated with fungus was reduced from 90.7 to 57.6 (significant).

[0034] Figure 8 The results of the disease resistance study of bobpm6 plants with BoBPM6 gene editing are shown, among which the disease index of wilt, black rot, and clubroot inoculation decreased from 65.4 to 14.5 (significant), from 53.8 to 20.9 (significant), and from 63.1 to 55.7, respectively. DETAILED DESCRIPTION

[0035] The present invention is further described below by specific implementation methods and accompanying drawings, but the present invention is not limited to the following examples. In the following examples, unless otherwise specified, the experimental methods used are conventional methods in the art and conventional commercially available reagents are used.

[0036] Experimental materials used in this study:

[0037] The rice genetic transformation material in this experiment was Nipponbare;

[0038] The wild-type cabbage variety 'M1' is an inbred line material, which is preserved by the applicant's unit and can be provided for verification testing;

[0039] The CRISPR / Cas9 vector used for rice was pVS1, purchased from Addgene™;

[0040] The CRISPR / Cas9 vector used for cabbage was pYLCRISPR / Cas9-35S-B, purchased from Addgene. TM ;

[0041] Example 1. Construction of CRISPR / Cas9 editing vector and the effect of PAM sequence on gene editing efficiency and editing type

[0042] The inventors observed in their research that Cas9 (ScCas9) from Streptococcus canis requires a spacer adjacent motif (PAM) sequence such as 5'-NNG-3', after which any base can be selected; however, when the base after the PAM sequence is "T", the editing efficiency is higher ( http: / / crispor.tefor.net / ).

[0043] To test whether the "T" after the SpCas9 PAM sequence can enhance the editing efficiency of CRISPR / Cas9 technology, the inventors constructed CRISPR / Cas9 gene editing vectors (OsPDS and BoPDS) for rice and cabbage, respectively, to knock out the phytoene dehydrogenase gene PDS.

[0044] S1. Construction of PDS gene editing vector

[0045] To construct the PDS editing vectors for knockout knockout of cabbage and rice, 5'-NGGN-3' and 5'-NGGT-3' were selected as the PAM sequences of rice and cabbage, respectively, where 'N' represents the other three bases except 'T'.

[0046] Based on the selected target sites and PAM sequences, target introduction sequence sgRNAs and their adapter primers were designed (Table 1). After synthesis, they were ligated into pVS1 to obtain the rice PDS gene editing vector OsPDS. Similarly, based on the selected target sites and PAM sequences, target introduction sequence sgRNAs and their adapter primers were designed (Table 2). After synthesis, they were ligated into the pYLCRISPR / Cas9-35S-B(Bol) vector to obtain the cabbage PDS gene editing vector BoPDS.

[0047] Schematic diagram of CRISPR / Cas9 construct Figure 1 Shown: Figure A is a schematic diagram of the CRISPR / Cas9 construct OsPDS for rice PDS editing; NGGN (N1-N3) and NGGT (T1-T3) represent the locations of the target sites; Figure B is a schematic diagram of the CRISPR / Cas9 construct BoPDS for cabbage PDS editing; NGGN (N1-N2) and NGGT (T1-T2) represent the locations of the target sites.

[0048] Table 1. Rice PDS gene sgRNA sequences

[0049]

[0050]

[0051] Table 2. sgRNA sequences of PDS genes in Brassica oleracea and rice

[0052]

[0053] Effects of S2.5'-NGGT-3' PAM sequence on CRISPR / Cas9 editing efficiency and diversity of editing types

[0054] The rice editing vector OsPDS and cabbage editing vector BoPDS constructed by S1 were introduced into the rice variety Nipponbare and the wild cabbage variety M1 through Agrobacterium-mediated genetic transformation, respectively.

[0055] Transform Agrobacterium using the standard procedure: Add 1 μg of plasmid to 100 μl of competent Agrobacterium cells, mix thoroughly, and incubate on ice, in liquid nitrogen, in a 37°C water bath, and on ice for 5 minutes. Add 800 μl of LB liquid medium (without antibiotics) and incubate at 200 rpm and 28°C with shaking for 3 hours. Centrifuge at 5000 rpm for 1 minute, discard some of the supernatant, and gently pipette the remaining cells to mix. Smear the cells on LB solid medium containing kanamycin and rifampicin, and incubate upside down at 28°C for 2-3 days to obtain Agrobacterium plasmids containing the PDS gene editing vectors BoPDS and OsPDS.

[0056] Rice genetic transformation is a well-known technique in the art, and the following is an exemplary operation.

[0057] (1) Co-cultivation stage: The Agrobacterium cultured on AB medium in advance was diluted to an OD600 of about 0.2 with AAM liquid medium containing an appropriate amount of AS to start the co-cultivation stage. The diluted bacterial solution was co-cultivated with the vigorous rice callus cultured in advance for 3 days.

[0058] (2) Screening and culture stage: The co-cultured callus tissue is cleaned with sterile water containing antibiotic Tm that has been sterilized in advance, and the surface moisture is dried at room temperature. The above operations should be performed under sterile conditions in a clean bench. The completely dried callus tissue is transferred to the screening medium supplemented with an appropriate amount of antibiotics using tweezers. The medium is changed every 10 days under light culture. The screening is performed by setting a gradient of decreasing antibiotic concentration for about 2-3 times.

[0059] (3) Differentiation stage: The active callus tissue that has been screened is transferred to the differentiation medium. The active callus tissue will gradually turn green and differentiate into seedlings.

[0060] (4) Rooting stage: Transfer the rice seedlings with a small amount of callus tissue to the rooting medium and culture them under light for about 2 weeks until most roots grow.

[0061] The genomic DNA of rice seedlings was extracted, and the transformed seedlings were identified using resistance primers. Positive rice strains were preliminarily screened out and further identified after being moved to the field.

[0062] Genetic transformation of cabbage is a well-known technique in the art, and the following is an exemplary operation.

[0063] (1) Obtaining cabbage explants

[0064] Select mature, plump, rounded cabbage seeds free of mold and lesions. Disinfect with 75% alcohol for 3 minutes, then with 8-10% sodium hypochlorite solution for 8-10 minutes. Wash three times with sterile water. Use sterile filter paper to blot the sterilized seeds in a laminar flow hood and evenly distribute them on solid MS medium. Incubate under 16-hour light / 8-hour dark conditions for 5-7 days. Cut the cabbage hypocotyls into 0.8-1 cm lengths to serve as recipients for Agrobacterium-mediated transformation.

[0065] (2) Genetic transformation of cabbage

[0066] The Agrobacterium plasmids containing the PDS gene editing vector were cultured to OD600 = 0.4-0.6, centrifuged at 6000 rpm for 10 minutes, and then resuspended in liquid MS medium as the infection solution.

[0067] Cabbage explants are infected for 8-10 minutes and incubated in co-cultivation medium at 25°C in the dark for 36-48 hours. The explants are then transferred to a selective medium containing 10 mg / L Basta and maintained under 16 hours of light and 8 hours of darkness, with the selection medium changed every two weeks. When resistant shoots reach approximately 2-3 cm in length, they are excised and transferred to a seedling growth medium containing Timentin. The buds are incubated under 16 hours of light and 8 hours of darkness for 20-30 days, followed by 20 days of rooting medium. Plants with well-developed roots are hardened in vermiculite for 7 days before being transplanted to nutrient soil.

[0068] After PCR amplification using Bar primers and detection by 1.0% agarose gel electrophoresis, T0 generation positive plants were obtained.

[0069] The Bar primer sequences are as follows:

[0070] BarH-F:5'-AAACCCACGTCATGCCAGTT-3'; SEQ ID No.31

[0071] BarH-R:5'-GTCTGCACCATCGTCAACCAC-3'; SEQ ID No.32

[0072] The screened T0 generation positive plants were subjected to first generation high-throughput sequencing, and the sequencing results were statistically analyzed.

[0073] The results show:

[0074] For rice, in OsPDS knockout rice positive editing plants, the average increase in editing types using 'NGGT' compared to 'NGGN' was 28.6%; the average increase in editing efficiency was 13.8% ( Figure 2 and Table 3 ).

[0075] Table 3 Statistical data on rice gene editing types and efficiencies using different PAM sequences

[0076]

[0077]

[0078]

[0079] For cabbage, knockout of BoPDS caused cabbage-positive edited plants to exhibit an albino phenotype, among which 'NGGN' edited plants were basically chimeras; 'NGGT' showed a higher degree of editing in cabbage plants than 'NGGN', and the editing efficiency increased from an average of 20.4% to an average of 68.7%. Figure 3 and as shown in Table 4.

[0080] Table 4 Statistical data on cabbage gene editing types and efficiency

[0081]

[0082]

[0083] The results in rice and cabbage both showed that when the position after the PAM sequence 5'-NGG-3' is selected as 'T', the editing types of the CRISPR / Cas9 gene editing system can be significantly increased and the editing efficiency can be improved.

[0084] Example 2. Effect of fusion expression of GRF5-GIF1-GRF5 on the regeneration efficiency of B. oleracea

[0085] The vector used in the genetic system experiment was modified from the pCAMBIA1301 vector (purchased from Addgene TM ) empty vector pBWA(V)BS-Empty, which replaces the Hyg resistance in the original vector with Basta resistance.

[0086] The experimental material was the cabbage inbred line 'M1'.

[0087] Studies have found that overexpression of some plant growth regulators can significantly improve the efficiency of plant regeneration in transgenic tissue culture (Debernardi et al., 2020).

[0088] Through bioinformatics analysis, the research and development team of the present invention identified 19 growth regulatory factor (GRF) proteins and 1 GRF interacting factor (GIF) protein in the cabbage genome.

[0089] Two GRF5 proteins, two GRF4 proteins and one GIF1 protein were further studied. Two GRF5 proteins (Seq ID No.33 and Seq ID No.34) and two GRF4 proteins (Seq ID No.35 and Seq ID No.36) were fused with GIF1 protein (Seq ID No.37) through four alanine residues to express GRF5-GIF1-GRF5 (Seq ID No.38 or Seq ID No.39) and GRF4-GIF1-GRF4 (Seq ID No.40), respectively.

[0090] The effects of GRF5-GIF1-GRF5, GRF4-GIF1-GRF4, GRF5, and GIF1 as well as the blank control on cabbage regeneration efficiency were tested. Figure 4, that is, the nucleotide sequences encoding the four proteins (Seq ID No. 41-44) were constructed into the expression vector pBWA(V)BS-Empty respectively, and introduced into the wild-type cabbage variety M1 via Agrobacterium-mediated genetic transformation.

[0091] The genetic transformation operation was the same as S2 in Example 1.

[0092] The results showed that the average regeneration efficiency of the cabbage transformants expressing GRF5-GIF1-GRF5 was increased by 55.2%. Figure 4 .

[0093] Table 5 Nucleotide sequences or amino acid sequences involved in the examples

[0094]

[0095]

[0096]

[0097]

[0098] Example 3 Discovery and cloning of the gene BoBPM6, and construction of a gene editing vector

[0099] The inventors discovered a new differentially expressed gene in cabbage, BTB / POZ (Broad complex, Tramtrack, Bric-a-brac / Pox virus and Zinc finger)-MATH 6 (BPM6). Studies have reported that the expression of this gene is induced by wilt and black rot. The inventors speculate that it may be a susceptibility gene that induces the onset of various diseases.

[0100] Previous studies have confirmed that DMR6 is a conserved susceptibility (S) gene, and inactivation of the tomato DMR6 gene can confer broad-spectrum disease resistance (Thomazella et al., 2021); the inventors speculate that inactivation or expression inhibition of DMR6 in cabbage may also confer broad-spectrum disease resistance.

[0101] To test whether the BPM6 and DMR6 genes of cabbage can be used to confer broad-spectrum disease resistance in cabbage, the inventors constructed gene editing vectors to knock them out.

[0102] By designing primers (Table 6)

[0103] Table 6

[0104]

[0105] Using wild-type M1 cabbage DNA as a template, genomic fragments of BPM6 and DMR6 were obtained from Brassica oleracea. BoBPM6 is 3526 bp long (Seq ID No. 49), with a coding region consisting of 2326 bp (Seq ID No. 50). BoDMR6 is 6757 bp long (Seq ID No. 51), with a coding region consisting of 1026 bp (Seq ID No. 52). Sequences are shown in Table 7.

[0106] i. Construction of CRISPR / Cas9 editing vector for BoBPM6:

[0107] (1) Select pYLCRISPR / Cas9-35S-B as the gene editing vector framework;

[0108] (2) 5′-'NGGT'-3′ was selected as the PAM sequence of the B. oleracea BPM6 editing vector;

[0109] (3) The following sgRNA and its adapter primers were then designed for the BoDMR6 and BoBPM6 genes:

[0110] BoDMR6 sgRNA:ACCG TCCACGTCTCTCCCAAGTTT , Seq ID No.53, see Figure 5

[0111] BD6-F:cagtGGTCTCatgca TCCACGTCTCTCCCAAGTTT gttttaga,Seq ID No.54

[0112] BD6-R:cagtGGTCTCaaaac AAACTTGGGAGAGACGTGGA CGGT, Seq ID No.55

[0113] BoBPM6 sgRNA: CTCCAAGTCCGTGACGCAGA CGG, Seq ID No.56, see Figure 6

[0114] BB6-F:cagtGGTCTCatgca CTCCAAGTCCGTGACGCAGAG ttttaga, Seq ID No.57

[0115] BB6-R:cagtGGTCTCaaaac TCTGCGTCACGGACTTGGAG ,Seq ID No.58

[0116] After the synthetic adapter primer was annealed into a double strand, it was enzyme-cut and ligated to the pYLCRISPR / Cas9-35S-B vector to obtain the BoDMR6 gene editing vector and the BoBPM6 gene editing vector.

[0117] Example 4. BoBPM6 gene editing of cabbage materials

[0118] The BPM6 gene editing vector constructed in Example 3 and the expression vector for the GRF5-GIF1-GRF5 fusion protein (Seq ID No. 38) constructed in Example 2 were transformed into the wild-type cabbage variety M1 through Agrobacterium-mediated genetic transformation:

[0119] Transform Agrobacterium using the standard procedure: Add 1 μg of plasmid to 100 μl of competent Agrobacterium cells, mix thoroughly, and incubate on ice, then in liquid nitrogen, in a 37°C water bath, and on ice for 5 minutes. Add 800 μl of LB liquid medium (without antibiotics) and incubate at 200 rpm and 28°C for 3 hours. Centrifuge at 5000 rpm for 1 minute, discard some of the supernatant, and gently pipette the remaining cells to mix. Smear the cells onto LB solid medium containing kanamycin and rifampicin, and incubate upside down at 28°C for 2-3 days.

[0120] The genetic transformation method was the same as S2 in Example 1.

[0121] The screened T0 generation positive plants were sequenced for the first generation, and the genetic transformation efficiencies of bobpm6 and bodmr6 were 5.5% and 8.2%, respectively; the editing efficiencies were 62.0% and 62.5%, respectively;

[0122] Transformation efficiency = number of positive plants / number of infected explants; editing efficiency = number of edited plants / number of positive plants.

[0123] The transformation efficiency was significantly higher than the 1% cabbage transformation efficiency and 12.9% editing efficiency reported in existing literature.

[0124] T1 seeds were obtained by self-pollination and randomly selected for first-generation sequencing: 4 and 3 editing types were obtained for bodmr6 and bobpm6, respectively ( Figure 5 and Figure 6 );

[0125] Example 5. Disease resistance test of BoBPM6 gene-edited material

[0126] The T1 generation cabbage material obtained in Example 4 was inoculated with pathogens of wilt, black rot, and clubroot (three major diseases of cabbage).

[0127] Black rot is artificially inoculated by spraying:

[0128] (1) Preparation of bacterial liquid: The preserved black rot fungus (Xanthomonas campestris pv. Campestris) was streaked and activated, and the activated black rot fungus was added to the liquid PSA medium in the form of a bacterial mass using an inoculation loop. The culture was incubated in a shaker at 28°C and 200 rpm for 16 h in the dark. The OD was adjusted with sterile water. 600 After the value reaches 0.2, it is ready for inoculation.

[0129] (2) Inoculation process: When the seedlings have grown to 4-5 true leaves, they can be prepared for inoculation. The day before inoculation, move the seedlings to the inoculation site, water the seedling medium thoroughly, and use a sprayer to spray the leaves with water. Cover with a film to keep it moist until inoculation. The film should maintain more than 90% moisture, so that the water pores on the leaf margins are open before inoculation. Use a sprayer to evenly spray the bacterial solution on the leaves until the leaves are covered with the bacterial solution. Control the temperature at around 28°C.

[0130] (3) Resistance survey and resistance level classification: Resistance evaluation criteria: Level 0, no symptoms on inoculated leaves; Level 1, less than 5% of the leaf area; Level 3, 5-15% of the leaf area; Level 5, 15-30% of the leaf area; Level 7, 30-50% of the leaf area; Level 9, greater than 50% of the leaf area. DI = Σ(number of leaves with disease level × extreme disease level) / (total number of leaves surveyed × highest disease level) × 100. Highly resistant (HR), 0 < DI ≤ 10; resistant (R), 10 < DI ≤ 30; moderately resistant (MR), 30 < DI ≤ 50; susceptible (S), 50 < DI ≤ 70; highly susceptible (HS), DI > 70.

[0131] The wilt pathogen is artificially inoculated using the root dipping method:

[0132] (1) Preparation of bacterial liquid: The preserved Fusarium oxysporum f.sp. Conglutinans was added to liquid CM culture medium and cultured in a shaker at 28°C in the dark for 3 days. The mycelium was filtered through gauze and the remaining spores were adjusted to 1×10 6 / mL concentration and prepare the inoculum.

[0133] (2) Inoculation process: After the seedlings have grown to 3 true leaves, they can be inoculated. Before inoculation, the seedlings are pulled out of the seedling tray and the roots are cleaned. The roots are completely immersed in the bacterial solution. After 15 minutes, the seedlings are taken out and transplanted into a seedling bowl filled with soil and moved to a temperature-controlled greenhouse. The temperature is controlled at 23-29°C.

[0134] (3) Resistance investigation and resistance level classification: Resistance evaluation criteria: Grade 0, asymptomatic; Grade 1, 1 leaf slightly yellowed; Grade 2, 1 - 2 leaves moderately yellowed; Grade 3, half of the leaves severely yellowed or wilted; Grade 4, all leaves severely yellowed or wilted except the heart leaf; Grade 5, all plant leaves severely yellowed or the plant died. Investigate the leaf disease spot level of the inoculated materials, calculate the average disease index (Disease index, DI), and classify the resistance level based on the disease index. DI = [Σ (each disease grade × the number of diseased plants at the corresponding grade) / (total number of investigated plants × the highest disease grade)] × 100. Highly resistant (HR), 0 < DI ≤ 10; Resistant (R), 10 < DI ≤ 30; Moderately resistant (MR), 30 < DI ≤ 50; Susceptible (S), 50 < DI ≤ 70; Highly susceptible (HS), DI > 70.

[0135] Artificial inoculation of clubroot disease was carried out by root irrigation method:

[0136] (1) Preparation of bacterial suspension: The clubroot of cabbage stored in a -20°C refrigerator was pre-activated at room temperature for 12 h, then added with three times the volume of sterile water and thoroughly crushed using a juicer. Filtered with gauze and collected the filtrate into a 50 ml centrifuge tube, centrifuged at 600 rpm for 10 min and collected the supernatant. Then, centrifuged at 3500 rpm for 10 min to collect the bacteria and resuspended with sterile water. Adjust the spore concentration to 2x10 7 cfu / mL under the microscope.

[0137] (2) Inoculation process: Inoculate when the cabbage seedlings grow to 2 true leaves. After scratching the roots of each plant with a knife twice, use a pipette to suck 2 mL of bacterial suspension and inject it into the roots of the seedlings, and then move the seedlings to a temperature-controlled greenhouse with the temperature controlled at 18 - 25°C.

[0138] (3) Resistance investigation and resistance level classification: Resistance evaluation criteria: Grade 0 = asymptomatic roots; Grade 1 = asymptomatic main root, small nodules on lateral roots; Grade 2 = slightly enlarged main root, larger tumors on lateral roots; Grade 3 = severely enlarged main root, obvious lateral roots; Grade 4 = extremely severely enlarged main root, almost no lateral roots. DI = ∑ (number of diseased plants at each level × corresponding disease level) / (total number of investigated plants × highest disease level) × 100. Resistance evaluation criteria: Immune (I): DI = 0; Highly resistant (HR): 0 < DI ≤ 5; Resistant (R): 5 < DI ≤ 20; Moderately resistant (MR): 20 < DI ≤ 30; Susceptible (S): 30 < DI ≤ 60; Highly susceptible (HS): DI > 60.

[0139] The investigation results show that:

[0140] Compared with wild-type cabbage, the disease index of bodmr6 plants inoculated with wilt, black rot, and clubroot decreased from 79.0 to 78.4 (significant), from 79.3 to 55.1 (significant), and from 90.7 to 57.6 (significant), respectively ( Figure 7 );

[0141] Compared with wild-type cabbage, the disease index of bobpm6 plants inoculated with wilt, black rot, and clubroot decreased from 79.0 to 78.4 (significant), from 79.3 to 55.1 (significant), and from 90.7 to 57.6 (significant), respectively ( Figure 8 );

[0142] These experimental results demonstrate that the BoDMR6 and BoBPM6 genes are sensitive genes that induce the onset of various cabbage diseases. Knocking out or inhibiting the expression of these genes can yield new germplasm with broad-spectrum disease resistance. Combined with the optimized gene editing and genetic transformation systems provided by this invention, this technology provides powerful technical support for disease-resistant cabbage breeding.

[0143] Table 7

[0144]

[0145]

[0146]

[0147]

Claims

1. A method for efficient genetic transformation and gene editing of cabbage, characterized in that: (1) Introducing CRISPR / Cas9 gene editing vector into the callus tissue of target cabbage material, (2) screening cabbage callus tissue successfully introduced with the CRISPR / Cas9 gene editing vector and regenerating and culturing it; (3) Screening for T0 generation transgenic cabbage that has undergone gene editing; The CRISPR / Cas9 gene editing vector contains sgRNA of the target editing gene, and its PAM sequence is 5'-'NGGT'-3', where N is one of A, C, and G.

2. The method according to claim 1, characterized in that It also includes introducing an expression vector expressing the fusion protein GRF5-GIF1-GRF5 before, during, or after the CRISPR / Cas9 gene editing vector is introduced into the target cabbage material; The amino acid sequence of the fusion protein GRF5-GIF1-GRF5 has any of the following characteristics: (1) From N to C terminus, the GRF5-1 polypeptide shown in Seq ID No. 33, the GIF1 polypeptide shown in Seq ID No. 37, and the GRF5-2 polypeptide shown in Seq ID No. 34 were linearly fused; the polypeptides were connected by 3 to 5 alanine residues; (2) From N to C terminus, its amino acid sequence is obtained by linear fusion of the GRF5-2 polypeptide shown in Seq ID No. 34, the GIF1 polypeptide shown in Seq ID No. 37, and the GRF5-1 polypeptide shown in Seq ID No. 33; the polypeptides are connected by 3 to 5 alanine residues.

3. The method according to claim 2, wherein the CRISPR / Cas9 gene editing vector is introduced through Agrobacterium-mediated genetic transformation; the expression vector expressing the fusion protein GRF5-GIF1-GRF5 is also introduced through Agrobacterium-mediated genetic transformation.

4. A cabbage growth regulatory factor fusion protein, characterized in that Its structure is represented as GRF5-GIF1-GRF5, and its amino acid sequence has any of the following characteristics: (1) From N to C terminus, the GRF5-1 polypeptide shown in Seq ID No. 33, the GIF1 polypeptide shown in Seq ID No. 37, and the GRF5-2 polypeptide shown in Seq ID No. 34 were linearly fused; the polypeptides were connected by 3 to 5 alanine residues; (2) From N to C terminus, its amino acid sequence is obtained by linear fusion of the GRF5-2 polypeptide shown in Seq ID No. 34, the GIF1 polypeptide shown in Seq ID No. 37, and the GRF5-1 polypeptide shown in Seq ID No. 33; the polypeptides are connected by 3 to 5 alanine residues.

5. The cabbage growth regulatory factor fusion protein according to claim 4, characterized in that Its amino acid sequence is shown in Seq ID No.

38.

6. A nucleotide sequence encoding the cabbage growth regulatory factor fusion protein according to claim 4 or 5.

7. The nucleotide sequence according to claim 6, as shown in Seq ID No.

41.

8. An expression vector for expressing the cabbage growth regulatory factor fusion protein according to claim 4 or 5, which is loaded with the nucleotide sequence according to claim 6 or 7.

9. A kit for improving the efficiency of efficient genetic transformation and gene editing of cabbage, characterized in that: It contains a CRISPR / Cas9 gene editing vector, the PAM sequence of which is 5'-'NGGT'-3', wherein N is one of A, C, and G.

10. The kit according to claim 9, characterized in that The invention further comprises the expression vector shown in claim 8.

Images