Application of Zanthoxylum bungeanum miR167b gene in regulating plant growth and development
By overexpressing the miR167b gene of Sichuan pepper in plants, the growth and development of plants were regulated, which solved the problem of low efficiency in traditional breeding and achieved effects such as dwarfing of plants and seedless fruits, providing new gene resources and strategies for Sichuan pepper breeding.
Patent Information
- Application Number
- CN202510757467.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-09
- Publication Date
- 2026-06-26
- Estimated Expiration
- 2045-06-09
AI Technical Summary
Traditional breeding methods are inefficient and time-consuming. Apomixis in Sichuan pepper makes it difficult to introduce genetic diversity and integrate superior traits. There is a lack of effective technical means to overcome breeding obstacles.
By overexpressing the miR167b gene of Sichuan pepper in plants, plant growth and development were regulated, including reduced plant height, changes in fruit shape, decrease in fruit size and weight, high fruit set rate, seedless fruit, reduced number of inner chambers, and ovule abortion.
The study achieved dwarfing, fruit shape alteration, seedlessness, and high fruit set rate in miR167b overexpression plants, revealing the apomixis mechanism of Sichuan pepper and providing gene resources and strategies for woody plant breeding, thereby improving breeding efficiency.
Smart Images

Figure CN120519502B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to Sichuan pepper. miR167b The application of genes in regulating plant growth and development. Background Technology
[0002] Sichuan peppercorn( Zanthoxylum Zanthoxylum bungeanum (also known as Nine-leaf Green Zanthoxylum) is a shrub or small tree belonging to the genus Zanthoxylum in the Rutaceae family. It is a distinctive economic tree species in my country with significant economic and ecological value. However, Zanthoxylum bungeanum 'Nine-leaf Green' is a purely female plant with apomixis, a characteristic that prevents genetic improvement through traditional sexual hybridization, severely restricting the breeding process and variety optimization. While apomixis, as a form of asexual reproduction, helps maintain genetic stability, it limits the introduction of genetic diversity and the integration of superior traits in breeding. Currently, the molecular mechanisms of apomixis in Zanthoxylum bungeanum 'Nine-leaf Green' are not fully understood, and effective technical means are lacking to overcome its breeding obstacles. Furthermore, traditional breeding methods are not only costly but also have unreliable results, introducing numerous uncertainties, posing a serious challenge to the sustainable development of this industry. Summary of the Invention
[0003] The technical problem to be solved by this invention is: to provide Sichuan pepper. miR167b The application of genes in regulating plant growth and development can solve the technical problems of low efficiency and long cycle in traditional breeding methods.
[0004] To achieve the above objectives, the technical solution adopted by the present invention is: to provide Sichuan pepper. miR167b The application of genes in regulating plant growth and development miR167b The nucleotide sequence of the precursor is shown in SEQ ID NO: 1.
[0005] Based on the above technical solution, the present invention can be further improved as follows:
[0006] Furthermore, its application is as follows: through overexpression miR167b Genes are used to regulate plant growth and development.
[0007] Furthermore, through overexpression miR167b Genes are used to regulate the floral organs and fruits of plants.
[0008] Furthermore, the growth and development are as follows: plant height decreases, fruit shape changes, fruit size and weight decrease, fruit set rate is high, the fruit is seedless, the number of inner chambers of the fruit decreases, and ovules abort.
[0009] Furthermore, the plant is a dicotyledonous plant.
[0010] Furthermore, the plant is the tomato.
[0011] The present invention also discloses a method comprising miR167b Gene overexpression vectors.
[0012] The present invention also discloses a method comprising miR167b Preparations that regulate plant growth and development using genes or overexpression vectors.
[0013] The beneficial effects of this invention are as follows: This invention constructs... miR167b The gene expression vector was used to overexpress the gene in tomatoes, and it was found that... miR167b Overexpression plants were dwarfed, exhibited altered fruit shape, and had significantly smaller and heavier fruits than the wild type. They had a high fruit set rate, but the fruits were seedless with a reduced number of locules, ovule abortion, and no embryo sac formation. Further analysis revealed elevated indolebutyric acid (IBA) content in the fruits of overexpression plants, indicating... miR167b Genes can induce apomixis in fruits by regulating auxin, laying the foundation for revealing the mechanism of apomixis in Sichuan pepper and providing gene resources and basis for improving breeding strategies for woody plants. It has important theoretical value and application prospects. Attached Figure Description
[0014] Figure 1 Morphological observation of male and female flowers of Sichuan pepper at different developmental stages;
[0015] Figure 2 for miR167b Expression levels in male and female flowers of Sichuan pepper at different developmental stages;
[0016] Figure 3 for miR167b Differentiation culture of transgenic plants;
[0017] Figure 4 for miR167b Rooting culture of transgenic plants;
[0018] Figure 5 for miR167b Positive identification results of transgenic plants;
[0019] Figure 6 for miR167b Actual specimens of genetically modified and wild-type tomato plants;
[0020] Figure 7 for miR167b Statistics on plant height of genetically modified and wild-type tomatoes;
[0021] Figure 8 Wild type and miR167b Phenotypic observation of tomato fruits with gene overexpression;
[0022] Figure 9 Wild type and miR167b Longitudinal diameter analysis of tomato fruits with overexpressed genes;
[0023] Figure 10 Wild type and miR167b Diameter analysis of tomato fruits with overexpressed genes;
[0024] Figure 11 Wild type and miR167b Weight analysis of tomato fruits with overexpressed genes;
[0025] Figure 12 Wild type and miR167b Cross-section of a tomato fruit with overexpressing genes;
[0026] Figure 13 Wild type and miR167b Statistics on the number of seeds in tomato fruits with overexpressed genes;
[0027] Figure 14 Wild type and miR167b Comparison of cross-sections of genetically modified tomato fruits; Figure (A) shows the internal structure of a wild-type tomato (WT) fruit, and Figure (B) shows... miR167b Genetically modified tomatoes ( miR167b -OX1) Internal structure of the fruit;
[0028] Figure 15 for miR167b Comparison of IAA content in transgenic tomatoes and wild-type tomatoes;
[0029] Figure 16 for miR167b Comparison of IBA content in transgenic tomatoes and wild-type tomatoes;
[0030] Figure 17 for miR167b Comparison of TRP content in transgenic tomatoes and wild-type tomatoes;
[0031] Figure 18 for miR167b Comparison of Indole content in genetically modified tomatoes and wild-type tomatoes. Detailed Implementation
[0032] The specific embodiments of the present invention are described below to facilitate understanding of the invention by those skilled in the art. Unless otherwise specified, specific conditions are applied according to conventional conditions or the manufacturer's recommendations. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various modifications are obvious as long as they fall within the spirit and scope of the invention as defined and determined by the appended claims. All inventions utilizing the concept of this invention are protected.
[0033] miR167b The nucleotide sequence of the precursor is as follows:
[0034] ATTCGTGCACTAGTAGTAGTTGAAGCTGCCAGCATGATCTGAACTTTCCTTGACCTCCATCTCTAGGGAAAGGCCAGATCATCTGGCAGTTTCACCTATTGATGGTAGCATGGCCAGAAACCCTAATTTCTTTCCTCCACCAGATCGTTCTCAACAAACCCAGTAGGTTTTGGCAGATGAAAAACCCTAGAAACAGGTATC (SEQ ID NO: 1).
[0035] Example 1: Construction of overexpression vector
[0036] Construct containing miR167b The recombinant expression vector was used to transform the microbial transformant, ultimately preparing the engineered bacterium (Agrobacterium tumefaciens GV3101); specifically:
[0037] (1) Design amplification primers SEQ-F and SEQ-R for miRNA167b precursor, and amplify it from Sichuan pepper DNA using PCR. miR167b Precursor sequence; the nucleotide sequences of amplification primers SEQ-F and SEQ-R are as follows:
[0038] SEQ-F: AGAATTCGAGCTCGGTACCCATTCGTGCACTAGTAGTAGTTG (SEQ ID NO: 2);
[0039] SEQ-R: GTCGACTCTAGAGGATCCCCGATACCTGTTTCTAGGGTTTTTCA (SEQ ID NO: 3);
[0040] (2) Once the band size is confirmed to be consistent with the expected size by gel electrophoresis, the PCR product is recovered by gel extraction. Simultaneously, the BGPlant-Express MCS vector plasmid is extracted, digested with Sma I, and reacted at 37℃ and 65℃ for 5 min and 10 min respectively. Then, gel electrophoresis is performed, the target fragment is recovered, and diluted 3-5 times before direct use. Next, the fragment is ligated using In-Fusion ligase. miR167bThe precursor was ligated into the enzyme-digested and recovered vector BG Plant-Express MCS and reacted at 50℃ for 15-60 min. Then, it was transformed into *E. coli* TransT1 competent cells, plated, and single clones were selected for colony PCR verification. After successful verification, the colonies were sent to the company for sequencing verification. Only after correct sequencing was the strain considered positive, indicating successful construction of the overexpression vector BG- miR167b .
[0041] (3) Shake the positive strain to extract plasmid, and then add BG- containing the recombinant expression vector. miR167b The plasmid was transformed into Agrobacterium tumefaciens GV3101. Single clones were selected and verified by colony PCR on plates containing 100 μg / mL kanamycin and 50 μg / mL rifampin. The strains that passed the verification were the engineered bacteria for the recombinant expression vector.
[0042] Figure 1 This study presents morphological observations of female and male flowers at different developmental stages of Sichuan pepper. FFS1 represents the period of female flower primordium formation, FFS2 represents the period of female flower growth and differentiation, MFS1 represents the period of male flower primordium formation, MFS2 represents the period of male flower growth and differentiation, and MFS3 represents the period of male flower organ formation. Figure 1 As can be seen, female flowers consist of only two whorls of floral organs: the pistil and the sepals; male flowers consist of only the male flower and the sepals.
[0043] Figure 2 for miR167b The expression levels in male and female flowers of Sichuan pepper at different developmental stages were varied by... Figure 2 It can be seen that, miR167b Expression differs significantly between male and female flowers; as female flowers develop, miR167b Expression was significantly downregulated; during male flower development, miR167b The expression is on the rise.
[0044] Example 2: Obtaining transgenic plants
[0045] Will contain BG- miR167b Agrobacterium was transferred into Micro-Tom tomatoes. Tomato explants were then transformed using the leaf disc method with Agrobacterium containing the recombinant plasmid BG-miRNA167b. Co-culture, induced shoot and root formation were then performed. The specific steps are as follows:
[0046] (1) Sterilization and sowing of seeds
[0047] Take an appropriate amount of wild-type tomato seeds and place them in a sterile tissue culture bottle. Add 75% anhydrous ethanol for 30 seconds to sterilize, and rinse three times with sterile water. Then add 1.5% sodium hypochlorite solution for 15 minutes to sterilize, and rinse five times with sterile water. Place the tissue culture bottle in a shaker and shake until the seeds germinate. Finally, evenly sow the germinated seeds on pre-prepared MS solid medium and place it in a light incubator for cultivation.
[0048] (2) Cutting of explants
[0049] After about 14-20 days, when the first pair of true leaves have grown to about 2-5 mm, cut the cotyledons and hypocotyls into segments and place them in a pre-culture medium in the dark for one day.
[0050] (3) Activation and infection of Agrobacterium
[0051] Add 50-60 μL of pre-preserved Agrobacterium glycerol culture to 20 mL of LB liquid medium containing antibiotics (20 μL Kan and 20 μL Rif), then incubate at 200 rpm for 1-2 days in a 28°C constant temperature shaker until the culture reaches OD. 600 =Approximately 1.0, secondary activation to OD 600 When the bacterial culture reaches approximately 0.8, remove the bacterial suspension, centrifuge at 6000 rpm for 10 min, and collect the bacterial cells. Then resuspend the bacterial suspension in KCMS liquid medium to OD0.8. 600 =0.1, and finally, soak the explants that have been pre-cultured for one day in the above diluted Agrobacterium bacterial solution for 20 minutes, absorb the bacterial solution with filter paper, and then transfer the explants to the co-culture medium to co-culture Agrobacterium and explants for 2 days.
[0052] (4) Differentiation culture and rooting culture
[0053] The co-cultured explants were transferred to differentiation medium and cultured in a light incubator. The differentiation medium was changed every half month. The cultured specimens were then observed... Figure 3 As shown. Adventitious buds awaiting differentiation form seedlings, which are then cut and transferred to a rooting medium. After rooting... Figure 4 Then, the seedlings can be transferred to a smart greenhouse for hardening off and soil cultivation, under the following conditions: day and night lengths of 16 hours and 8 hours respectively, day and night temperature of 22°C, and light intensity of 250 μmol·m⁻². -2 ·s -1 The relative humidity is 80%, and watering should be done on time and nutrient solution should be applied regularly.
[0054] Positive seedlings were identified by PCR, and the results were as follows: Figure 5 As shown, the band sizes are all around 200 bp, consistent with the size of the miRNA167b precursor, indicating that the obtained plants are positive. miR167b Transgenic strains.
[0055] Example 3 Overexpression miR167b Phenotypic characteristics identification of transgenic plants
[0056] 1. Phenotypic identification of positive plants
[0057] Wild-type plants and four obtained plants were observed using a Canon EOS 5D Mark digital camera (Tokyo, Japan). miR167b Transgenic plants ( miR167b -OX1、 miR167b -OX2、 miR167b -OX3 and miR167b -OX4) morphological characteristics, and record wild type and miR167b Height of transgenic plants. Observation of wild-type plants and... miR167b The morphological characteristics of the fruits of transgenic plants were recorded, and the characteristics of wild-type tomato plants and... miR167b The longitudinal and transverse diameters and weight of the fruits from genetically modified tomato plants.
[0058] (1) miR167b Overexpression affects tomato plant height
[0059] like Figure 6 and Figure 7 As shown, miR167b Overexpression of [specific ingredient] resulted in significant dwarfing of tomato plants; the average height of wild-type plants was 19.6 cm. (4 [unclear text - likely referring to a specific type of plant]) miR167b The average height of the transgenic plants was 6.75 ± 1.15 cm, which was only about one-third of that of normal plants (WT).
[0060] (2) miR167b Overexpression affects tomato fruit morphology
[0061] like Figures 8-11 As shown, m iR167b Overexpression of this compound led to changes in tomato fruit shape, with significantly lower longitudinal and transverse diameters and weight compared to the wild type (WT). Further observation revealed that wild-type tomato plants could produce seeds normally. miR167b The transgenic plants exhibited seedless fruit. Figure 12 The fruit setting rate increased significantly. Figure 13 ).
[0062] 2. Anatomical analysis of transgenic fruit
[0063] Secure miR167b Genetically modified tomatoes ( miR167bSamples of -OX1 and wild-type tomato fruit (WT) were sequentially immersed in environmentally friendly dewaxing and clearing solution I for 20 min, environmentally friendly dewaxing and clearing solution II for 20 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, and 75% ethanol for 5 min, and finally rinsed with tap water. The washed samples were then stained with safranin solution for 2 h, and excess dye was washed away with tap water. Next, they were sequentially immersed in 50%, 70%, and 80% ethanol solutions for 3-8 s for decolorization, then stained with 1% Fast Green solution for 6-20 s, dehydrated with anhydrous ethanol in three separate baths, sectioned, cleared in xylene for 5 min, and mounted with neutral resin. Finally, they were observed and photographed under an optical microscope, and images were acquired.
[0064] Figure 14 for miR167b Comparison of fruit slices from transgenic and wild-type tomato plants. In the image, letter C represents the placenta, letter D represents the septum, letter V represents the ventricle, letter Es represents the embryo sac, letter Ov represents the ovule, and letter AOv represents ovule abortion. The image shows that the WT plant's fruit has normal development, containing the ventricle, placenta, and ovule. Figure 14 A); and miR167b Overexpression plants showed a decrease in the number of inner chambers in their fruits, ovule abortion, and more pronounced changes in fruit shape. The tissue cells at the junction of the septum and pericarp were more dense, and the septum was significantly thickened. Figure 14 B).
[0065] 3. Detection of plant hormone content in transgenic plants
[0066] Wild-type and miR167b Transgenic plants ( miR167b -OX1) Plant hormone content in fruits, wild type and miR167b Each group of transgenic plant fruit samples had 3 replicates.
[0067] Compared to the wild type, miR167b The content of indole-3-acetic acid (IAA) in the fruits of transgenic tomato plants decreased significantly, while the contents of indole-3-butyric acid (IBA), L-tryptophan (TRP), and indole increased significantly. Figures 15-18 ),show miR167b It regulates apomixis by affecting auxin levels.
Claims
1. Sichuan peppercorns miR167b The application of genes in regulating plant growth and development is characterized by, Through overexpression miR167b Genes that reduce plant height, alter fruit shape, decrease fruit size and weight, increase fruit set rate, eliminate seeds inside the fruit, reduce the number of inner chambers, and cause ovule abortion; the plant in question is tomato. miR167b The nucleotide sequence of the precursor is shown in SEQ ID NO: 1.