A set of molecular markers, probe set and application related to apple scab disease resistance

Abstract

The present application belongs to the field of molecular genetics breeding, and particularly relates to a group of apple brown spot disease resistance related molecular markers, a probe group and application, including 4 SNP markers and 3 InDel markers. Through the combination of the two kinds of molecular markers, high resistance to brown spot disease, resistance to brown spot disease, medium sensitivity to brown spot disease and sensitivity to brown spot disease can be accurately divided into four disease resistance grades, thereby providing auxiliary selection for apple breeding.

Description

Technical Field

[0001] This invention belongs to the field of molecular genetics and breeding, specifically involving a set of molecular markers, probes and their applications related to resistance to apple brown spot disease. Background Technology

[0002] Apple brown spot is a fungal disease caused by the fungus *Dioscorea maculata* in its sexual stage and *Discodilobacter maculata* in its asexual stage. This pathogen primarily affects apple leaves, but also damages the fruit, often manifesting as necrotic spots on leaves and causing premature leaf drop, significantly impacting apple yield and quality. Apple brown spot has become the most widespread and damaging early leaf drop disease in apple production, causing substantial economic losses to the apple industry worldwide in recent years.

[0003] Currently, production mainly employs a combination of chemical and agricultural control methods. Chemical control involves spraying protective fungicides such as propineb and mancozeb in mid-to-late April. Agricultural control measures include winter orchard sanitation, thoroughly removing diseased leaves and leaves, increasing the application of organic fertilizer, appropriately reducing nitrogen fertilizer use, emphasizing pruning, and improving ventilation and light penetration in the orchard. However, existing control methods suffer from drawbacks such as high cost and inconsistent effectiveness. Therefore, improving the disease resistance of cultivars and breeding resistant varieties is the most effective control method.

[0004] Traditional apple breeding methods typically require significant time and resources, and struggle to accurately predict the phenotypic performance of new varieties. However, marker-assisted breeding can improve breeding efficiency, shorten the breeding cycle, reduce costs, and enhance the accuracy and stability of varieties. Therefore, developing relevant molecular markers is crucial for apple disease resistance breeding. Apple brown spot disease resistance is a quantitative trait controlled by multiple genes, including major genes with significant influence. In genetic analysis and molecular marker studies of apple brown spot disease resistance, using Red Delicious and Golden Delicious hybrid seedlings as segregating populations, 17 pairs of SSR primers from 144 pairs showed polymorphism between resistance and susceptibility. Using Qin Guan, Fuji, and their hybrid F1 generations as experimental materials, RAPD markers for apple brown spot disease resistance genes were used, yielding one RAPD marker linked to the resistance gene, S428-854. Therefore, further development of other molecular markers is needed to provide more molecular markers for apple brown spot disease resistance. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides a molecular marker, probe set, and application related to resistance to apple brown spot disease.

[0006] The specific technical solution of this invention is as follows.

[0007] A group of molecular markers for resistance to apple brown spot disease, wherein the molecular markers are SNP marker group and InDel marker group;

[0008] The SNP group includes four SNP markers, namely SNP1 to SNP4; the nucleotide sequences of SNP1 to SNP4 are as follows: SEQ ID NO.1 to SEQ ID NO.4, respectively.

[0009] Specifically, SNP1 is a C to T mutation at position 24618204 bp on apple chromosome 0; SNP2 is an A to T or G to T mutation at position 13924744 bp on apple chromosome 8; SNP3 is a C to A mutation at position 27163218 bp on apple chromosome 10; and SNP4 is an A to G mutation at position 12662946 bp on apple chromosome 17.

[0010] The InDel marker group includes three InDel markers, namely InDel1 to InDel3; the nucleotide sequences of InDel1 to InDel3 are as follows: SEQ ID NO.5 to SEQ ID NO.7.

[0011] Specifically, InDel1 is a C or AT insertion at position 117948680bp of apple 11 stain; InDel2 is an AG insertion or deletion at position 7739098bp of apple 14 stain; and InDel3 is a TA insertion or deletion at position 11163770bp of apple 14 stain.

[0012] This invention developed four SNP markers and three InDel markers related to apple brown spot disease resistance, totaling seven major markers. Experiments showed that using these seven major markers can effectively and accurately predict apple brown spot disease resistance, yielding four resistance levels: highly resistant, resistant, moderately susceptible, and susceptible. The Pearson correlation coefficient r between the resistance level and the measured leaf drop rate of brown spot disease was 0.539, indicating high accuracy of the detection results. This provides a new method for screening and breeding superior disease-resistant germplasm.

[0013] A second aspect of the present invention provides a probe set for amplifying the aforementioned molecular marker, wherein the probe sequence of Chr00_24618204 is shown in SEQ ID NO.8;

[0014] The probe sequence of SNP1 is shown in SEQ ID NO.8;

[0015] The probe sequence of SNP2 is shown in SEQ ID NO.9;

[0016] The probe sequence of SNP3 is shown in SEQ ID NO.10;

[0017] The probe sequence for SNP4 is shown in SEQ ID NO.11;

[0018] The probe sequence of InDel1 is shown in SEQ ID NO.12;

[0019] The probe sequence of InDel2 is shown in SEQ ID NO.13;

[0020] The probe sequence of InDel3 is shown in SEQ ID NO.14.

[0021] A third aspect of the present invention provides a kit comprising the aforementioned probe set.

[0022] The fourth aspect of this invention provides the application of the probe set in apple breeding.

[0023] The fifth aspect of the present invention provides the application of the probe set described herein in identifying resistance to apple brown spot disease.

[0024] The sixth aspect of the present invention provides the use of the kit in identifying resistance to apple brown spot disease.

[0025] The seventh aspect of this invention provides the application of the kit in apple breeding.

[0026] The eighth aspect of the present invention provides a method for identifying resistance to apple brown spot disease, comprising the following steps:

[0027] The target sequence was captured using the aforementioned probe set, and after genotyping via Illumina sequencing, the resistance of the test samples to apple brown spot disease was determined according to the following criteria:

[0028] When the genotype at 27163218bp on chromosome 10 is CT or TT, the genotype at 7739098bp on chromosome 14 is delAG / delAG, the genotype at 11163770bp on chromosome 14 is TA / delTA or delTA / delTA, and the genotype at 12662946bp on chromosome 17 is AG, the child is considered highly resistant to apple brown spot disease.

[0029] If the genotype of 24618204 bp on chromosome 0 is CT or TT, the genotype of 13924744 bp on chromosome 8 is AT, TT, or GT, and the genotype of 7739098 bp on chromosome 14 is AG or delAG, then the individual is considered resistant to apple brown spot disease.

[0030] When the genotype C / insAT is found at 7948680 bp on chromosome 11, the disease is identified as susceptible to apple brown spot disease.

[0031] The remaining plants are moderately susceptible to brown spot disease.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] This invention develops seven major molecular markers related to resistance to apple brown spot disease, including four SNP markers and three InDel markers. These markers are suitable for marker-assisted selection of apple brown spot resistance in seedlings, molecular-assisted evaluation of apple germplasm resources for resistance to the disease, screening of superior resistant germplasm, and design of breeding programs. Furthermore, the invention offers high accuracy and low cost. Using these seven major markers, resistance to apple brown spot disease can be effectively predicted, yielding four resistance levels: highly resistant, resistant, moderately susceptible, and susceptible. The Pearson correlation coefficient (r) between the resistance level and the measured leaf drop rate of brown spot disease is 0.539, indicating high accuracy in the prediction results. This provides a new approach for screening and breeding superior resistant germplasm. Attached Figure Description

[0034] Figure 1 Seven molecular markers associated with resistance to apple brown spot disease should be used for marker-assisted prediction. Detailed Implementation

[0035] To enable those skilled in the art to better understand and implement the technical solutions of this invention, the invention will be further described below with reference to specific embodiments and accompanying drawings. Unless otherwise specified, all reagents used in this invention are commercially available, and all methods used are conventional techniques in the art.

[0036] The criteria for classifying apple brown spot disease as highly resistant, resistant, susceptible, and moderately susceptible in the following examples are as follows:

[0037] High resistance to apple brown spot disease refers to a disease index of less than 5%, meaning that the number of lesions is extremely small and the degree of leaf infection is very low.

[0038] Apple brown spot disease resistance refers to a disease index between 5% and 20%, indicating a certain degree of disease resistance, but not as strong as highly resistant varieties.

[0039] Moderately susceptible to chloasma refers to a disease index between 20% and 50%, indicating a certain degree of susceptibility to chloasma, but not a high degree of susceptibility.

[0040] Apple brown spot disease is defined as a disease index greater than 50%, indicating high susceptibility to brown spot disease and severe leaf infection.

[0041] 1. Identification of resistance phenotypes in apple brown spot disease.

[0042] Using 4792 hybrid offspring lines from four hybrid populations (Zise Mingzhu × Red Fuji, Zisai Mingzhu × Golden Delicious, Red Jade × Golden Delicious, and Red Jade × Tsugaru) and 361 germplasm resources, the field resistance to apple brown spot disease was investigated for four consecutive years. The field leaf drop rate caused by brown spot disease was used as an indicator of resistance.

[0043] Brown spot disease conidia were collected from diseased leaves in the field, and spore suspensions were prepared. In vitro inoculation identification was performed using 361 apple tree germplasm resources of detached leaves. Disease incidence and lesion area were used as detection indicators to identify disease resistance through inoculation.

[0044] (2) Discovery of resistance variation sites in apple brown spot disease.

[0045] BSA-seq was used to mine QTLs associated with resistance to apple brown spot disease in the hybrid progeny populations, yielding a total of 83 QTLs for resistance to apple brown spot disease across four populations. Genome-wide association analysis was performed on brown spot disease resistance using 253 apple germplasm resources, identifying 36 significant association intervals associated with apple brown spot disease resistance.

[0046] (3) Development of molecular markers for resistance to apple brown spot disease.

[0047] Based on variant type, gene expression level, and functional annotation, molecular markers were developed for variant sites of candidate genes in each QTL and GWAS interval associated with apple brown spot disease resistance. A total of 206 SNP and InDel molecular markers were designed, distributed across 17 chromosomes. The markers were developed using the GenoBaits strategy, capturing target sequences with DNA probes and then performing genotyping using Illumina next-generation resequencing.

[0048] (4) Estimation of the effect value of genotypes of resistance markers for apple brown spot disease and screening of major markers.

[0049] The aforementioned 206 molecular markers were selected from 1506 individual plants chosen from the four hybrid combinations and apple germplasm resources as a training population. Genotyping of these 206 molecular markers was performed using the GenoBaits strategy. The genotype effect value and marker effect value of each marker in the training population against apple brown spot disease were estimated. Markers with larger marker effect values ​​were selected, resulting in 10 SNP or InDel markers with effect values ​​greater than 20.00. Next, the genotype combination effect values ​​of the 10 SNPs or InDel markers with the largest effect values ​​were estimated. Through this estimation, 3 redundant markers were removed, and finally 4 SNPs and 3 InDel markers were determined as major markers of resistance to apple brown spot disease, namely Chr00_24618204, Chr08_13924744, Chr10_27163218, Chr11_7948680, Chr14_7739098, Chr14_11163770 and Chr17_12662946. Among them, Chr00_24618204, Chr08_13924744, Chr10_27163218, and Chr11_7948680 are SNP tags, while Chr14_7739098, Chr14_11163770, and Chr17_12662946 are InDel tags.

[0050] The nucleotide sequence of SNP1:Chr00_24618204 is shown in SEQ ID NO.1.

[0051] SEQ ID NO.1: AGAGTTCAACTTCAATTCTACTACCTACTCGGTGAGCAGGCCATTGACGTTGCCAGGTTTGAAAGGCCACACAGAGTCTGTGCATTGTGACCCTACTAGTTCGCGAACGGAGTATATCGTTCACCTGGGGGGTTCAGACTTTTGCCTTGTCCAGACTGCCATGGAGAGCTGCAGAAGTGATTGTCAACCACTGTGGGTC ACTCACGTTCCGAATCGTCATTGCAAGTGGAGGAGGAAGCTATATCGAGACCTTGCATTCGACGCCATGTGATGTGGACATCAGCGGGGCTAGTTCCGTATTAGGTATAGCTTCGCAAAGTAAGTTGCTTTGTTCTTTTTCTTCTTCCCTATTTTCAATGCCATTAGTTATACGATTTCTTTTTAATTTTATGACTCAGA.

[0052] SNP2: The nucleotide sequence of Chr08_13924744 is shown in SEQ ID NO.2.

[0053] SEQ ID NO.2: TCTCTCTCTCACTTCCTCCCTCCCATCTATGAAGTTCCGGGGCACCCAGAGGACACCCAACCTAGGTTCGGCAAACCATGGGTGTGCGAGCTCAGGTCCGGCCACCTCCAGCCGTTTCACTACTAATCACAGGTAGCAACCTCTTCATTTTGTCTTTACCTTCAATTTCCTAGTTAGATCGTAGGGTATATGGGAGTTTTTCCAACAACCGGAGCACGGAAGGCTCCGGACTCCTTCCCCGGTGAGGAATGGGTCAGTGACCCAAGTCGAGTGAACCTAGGCCATTTGGGCCGTATATAGAACTCGGGCCCTAAGCCCATTTAAACCCAACCCAAAACCCTTAGAGGCTTTGGCCTTCGGGCCATGTGAACCTAGGCCCAAGCCCAGAGAACCTAGACCCA.

[0054] SNP3: The nucleotide sequence of Chr10_27163218 is shown in SEQ ID NO.3.

[0055] SEQ ID NO.3: TGTATGTCTGTAAATAGTTTAACTACTTATTATATTGTCACTTGGTTTTATGGTGATTTCAATTTCTTTATGGTATTTGATCGAGCAAGTTATTCCATGTGTGAACCTTGACGTTCTCTACGCCACCTATTTTCTGATATCCATGTATTGGGCTTGAAAATTCATTCATGTGAGAAGATGTGTTGAGAGTATGAACCCTTAGTAAAATTTGCCAATTAATTTTATAAGATACCTCAAATTATTCAAAATATATTAATTTTATGGGATACTTCAAATTCTTCAACAATATTAAACCATATGATGCATTGTAAAACAATTACTAAAAGAAAGTTCGAAGTACACACCTAACATAGTGGCGGAGCTACTAAGGGACCAGTATGGTCCCTGGTCCATACTGCCTT.

[0056] SNP4: The nucleotide sequence of Chr17_12662946 is shown in SEQ ID NO.4.

[0057] SEQ ID NO.4: ATGGATGCATCAAAGCTGAAGAAAGAGTTCCCTGAACTGCTTCCGATTAAGGAATCGCTGATTAAATACGTGTTTGAACCCAACAAGAAAACATTTGCAGGTGGAGCAGCAATTTAAGAGTCTCATGAAGTGGACCTCGATACCGATCCTATACATTTATTTATTTATTTTTCTTGTGGGAAATCGCTAGGGGTTTAGTTGTTCTCATGTTGTGATTCCATCAGTGTCTGTGATAGCTTAGGTTAATTTCATAAGTTGGTGCTATTGGTTCTGGTTTGGCTATTGTGATATAAGAAGCTTTGGAATTGCTTCGGAAATATTTGAAGGGTCTACTGTAAGTTGGGGCATCGTAATTTTCAGATATGTAATAAATTAATTATTTTTATTTATACAAGTTCTTT.

[0058] InDel1: The nucleotide sequence of Chr11_7948680 is shown in SEQ ID NO.5.

[0059] SEQ ID NO.5: TTTTTTTAGGAAAGCATTCCAACTGTTTTTCTAGAAAGTATTTGGATTTTTTATATCCCGAATCAAAGTGTGAATGTCCCTTAGAAGCGTGGCATGCTCGTTTTGATCAGGAGCGGGGTGGACAACTTCAGCCGGTGCTTGCGTCTGCGGCGGCACCTTGTGAGTTGCAGTATGTTGTGGATCTGCCGCCTGCAGTAGTG CThe underlined bases contain AT insertions, indicating that the apple variety is susceptible to susceptible brown spot disease.

[0060] The nucleotide sequence of InDel2:Chr14_7739098 is shown in SEQ ID NO.6.

[0061] SEQ ID NO.6: TACCTTTCTGGTTGTGCCACTGCCACGAACCACTTGCCTTCGCAAAGCTTCGCACTCGAACTCGTCCAACAGATCCTCCGCATCAAGGAACACATCTTTAAGTTGTTGTAGCCAACTGCGTAGGTCACCGTTACGTGCTTGCTTCTCTTGGGCATCCACGAGCGTCTTTGATTATGGACACGGTGCGTCCAAGTTTCTGC AG The underlined bases contain the missing AG, indicating a dominant and highly resistant apple variety to brown spot disease.

[0062] The nucleotide sequence of InDel3:Chr14_11163770 is shown in SEQ ID NO.7.

[0063] SEQ ID NO.7: GATGATATCGGAGTGAAAAAGGTTTGCATTTTGTTTTTCTTTGACATGTACATATGATGTCTCTCGATGTTATTGCCCTATATTGTGTAATATTCACCGGAACAGATTCGGTCACGCGTGGGAATTCGCCCAAATTTACTCTTCTTGGCAGTTGGAGATATGTGATGAATTGCGGCTTTCAGTGCCCTGGTTTTCGTGTG TA The underlined bases contain a TA deletion, indicating that the apple variety exhibits dominant high resistance to brown spot disease.

[0064] The GenoBaits probe sequence information corresponding to the four major-effect SNPs and three InDel markers is as follows:

[0065] The probe sequence for SNP1 is shown in SEQ ID NO.8:

[0066] TTCACCTGGGGGGTTCAGACTTTTGCCTTGTCCAGACTGCCATGGAGAGCTGCAGAAGTGATTGTCAACCACTGTGGGTCACCACGTTCCGAATCGTCATTGCAAGTGGA.

[0067] The probe sequence for SNP2 is shown in SEQ ID NO.9:

[0068] ACTACTAATCACAGGTAGCAACCTCTTCATTTTGTCTTTTACCTTCAATTTCCTAGTTAGATCGTAGGGTATATGGGAGTTTTACCAACAACCGGAGCACGGAAGGCTCCG.

[0069] The probe sequence for SNP13 is shown in SEQ ID NO.10:

[0070] TACGCCACCTATTTTCTGATATCCATGTATTGGGCTTGAAAATTCATTCATGTGAGAAGATGTGTTGAGAGTATGAACCCTTCGTAAAATTTGCCAATTAATTTTATAAG.

[0071] The probe sequence for SNP4 is shown in SEQ ID NO.11:

[0072] AGTCTCATGAAGTGGACCTCGATACCGATCCTATACATTTATTTATTTATTTTTCTTGTGGGAAATCGCTAGGGGTTTAGTTATTCTCATGTTGTGATTCCATCAGTGTC.

[0073] The probe sequence for InDel1 is shown in SEQ ID NO.12:

[0074] AGGAGCGGGTGGACAACTTCAGCCGGGTGCTTGCGTCTGCGGCGGCACCTTGTGAGTTGCAGTATGTTGTGGATCTGCCGCCTGCAGTAGTGCCTCGTTATCCACATTAA.

[0075] The probe sequence for InDel2 is shown in SEQ ID NO.13:

[0076] TAGCCAACTGCGTAGGTCACCGTTACGTGCTTGCTTCTCTTGGGCATCCACGAGCGTCTTTGATTATGGACACGGTGCGTCCAAGTTTCTGCAGATCCGCTTGAACACCC.

[0077] The probe sequence for InDel3 is shown in SEQ ID NO.14:

[0078] TGGGAATTCGCCCAAATTTACTCTTCTTGGCAGTTGGAGATATGTGATGAATTGCGGCTTTCAGTGCCCTGGTTTTCGTGTGTATGTAAAAATCGAGTTTTGGAACAAGG.

[0079] (5) Apple Brown Spot Disease Resistance Marker-Assisted Selection Method

[0080] The distribution of the seven major marker genotypes for resistance to apple brown spot disease and their resistance allelic variations are as follows:

[0081] Chr00_24618204 has three genotypes: CC, CT, and TT. When the genotype is CT or TT, it indicates that the apple variety is dominantly resistant to brown spot disease.

[0082] Chr08_13924744 has 6 genotypes: AA, AG, AT, TT, GT, and GG. When the genotype is AT, TT, or GT, it indicates that the apple variety is dominantly resistant to brown spot disease.

[0083] Chr10_27163218 has three genotypes: CC, CA, and CT. When the genotype is CA, it indicates that the apple variety is dominant and highly resistant to brown spot disease.

[0084] There are four genotypes at Chr11_7948680: CC, CT, TT, and C / insAT. When the genotype is C / insAT, it indicates that the apple variety is susceptible to symptomatic brown spot disease.

[0085] There are 7 genotypes at Chr14_7739098: AA, AG, AT, GG, TT, delAG, and AG / delAG. When the genotype is delAG / delAG, it indicates that the apple variety is dominant and highly resistant to brown spot disease. When the genotype is AG / delAG, it indicates that the apple variety is resistant to apple brown spot disease.

[0086] There are a total of 6 genotypes at Chr14_11163770: CC, TC, TT, TA, TA / delTA, and delTA. When the genotype is TA / delTA or delTA / delAG, it indicates that the apple variety is dominant and highly resistant to brown spot disease.

[0087] There are a total of 5 genotypes at Chr17_12662946, namely AA, AG, AT, TT and ATTCTCATG / delATTCTCATG. When the genotype is AG, it indicates that the apple variety is dominant and highly resistant to brown spot disease.

[0088] The seven markers for resistance to apple brown spot disease mentioned above exhibit complementary epistatic effects. Based on their non-allelic interactions, the following criteria are used to determine and select apple brown spot disease resistance in apple germplasm resources or hybrid progeny:

[0089] 1) When the genotype at 27163218bp on chromosome 10 is CT or TT, or the genotype at 7739098bp on chromosome 14 is delAG / delAG, or the genotype at 11163770bp on chromosome 14 is TA / delTA or delTA, or the genotype at 12662946bp on chromosome 17 is AG, the germplasm resources or hybrid offspring will show high resistance to apple brown spot disease.

[0090] 2) After excluding the above-mentioned highly resistant single plants, if the genotype of 24618204 bp on chromosome 0 is CT or TT, or the genotype of 13924744 bp on chromosome 8 is AT, TT, or GT, or the genotype of 7739098 bp on chromosome 14 is AG or delAG, then the germplasm resources or hybrid offspring will show resistance to apple brown spot disease.

[0091] 3) After excluding the above-mentioned highly resistant and resistant single plants, when the genotype C / insAT is 7948680bp on chromosome 11, the germplasm resources or hybrid offspring show susceptibility to apple brown spot disease.

[0092] 4) After excluding the above-mentioned highly resistant, resistant, and susceptible individual plants, the remaining individual plants showed moderate susceptibility to brown spot disease.

[0093] Detailed Implementation Plan

[0094] (1) DNA extraction, library construction and target site capture sequencing

[0095] Leaves of the material to be tested were collected, and genomic DNA was extracted. The genome was precisely quantified using the Qubit® dsDNAHSAssayKit. Enzyme digestion and DNA library construction were performed using the GenoBaits® DNA Library Prep Kit for ILM. Adapters were then added using the GenoBaits® Barcode for ILM Kits. Finally, molecular hybridization and target site capture were performed using the GenoBaits® DNA Hybridization kit for ILM, corresponding to the seven major markers for apple brown spot disease mentioned above.

[0096] (2) Sequencing of target sites and marker genotyping

[0097] The captured target library was sequenced using an Illumina sequencer with the PE150 strategy at a sequencing depth of 1000×~1200×. The obtained reads were analyzed and genotyped using the GDDH13.1 reference genome.

[0098] (3) Marker-assisted markers for resistance to apple brown spot disease

[0099] Based on the genotyping data of 7 major markers, the resistance of the tested materials to apple brown spot disease was judged according to the following criteria:

[0100] 1) When the genotype at 27163218bp on chromosome 10 is CT or TT, or the genotype at 7739098bp on chromosome 14 is delAG / delAG, or the genotype at 11163770bp on chromosome 14 is TA / delTA or delTA / delTA, or the genotype at 12662946bp on chromosome 17 is AG, the germplasm resources or hybrid offspring exhibit high resistance to apple brown spot disease, denoted as HR.

[0101] 2) After excluding the above-mentioned highly resistant single plants, if the genotype of 24618204 bp on chromosome 0 is CT or TT, or the genotype of 13924744 bp on chromosome 8 is AT, TT, or GT, or the genotype of 7739098 bp on chromosome 14 is AG / delAG, then its germplasm resources or hybrid offspring exhibit resistance to apple brown spot disease, denoted as R.

[0102] 3) After excluding the above-mentioned highly resistant and resistant single plants, when the genotype C / insAT is 7948680bp on chromosome 11, the germplasm resources or hybrid offspring show susceptibility to apple brown spot disease, denoted as S.

[0103] 4) After excluding the above-mentioned highly resistant, resistant, and susceptible individual plants, the remaining individual plants showed moderate susceptibility to brown spot disease and were denoted as MS.

[0104] A total of 1506 materials from four different apple varieties—highly resistant, resistant, susceptible, and moderately susceptible—were selected. The four SNP markers and three InDel markers mentioned above were used to test the resistance of these 1506 materials. Furthermore, the genotyping criteria based on seven major markers were used to determine the resistance of the 1506 materials. Specific test results are as follows: Figure 1As shown, the Pearson correlation coefficient r between the disease resistance grading value and the measured leaf drop rate of brown spot disease was 0.539 (n=1055). Comparing the test results with the actual brown spot disease resistance, it was found that when the test result genotype was any one of CT, TT, delAG / delAG, TA / delTA, delTA / delTA, or AG, the corresponding actual apple varieties were highly resistant to apple brown spot disease. When the test result genotype was any one of CT, TT, AT, TT, GT, or AG / delAG, the corresponding actual apple varieties were resistant to apple brown spot disease. When the test result genotype was C / insAT, the corresponding actual apple varieties were susceptible to apple brown spot disease. Plants in other cases were moderately susceptible to brown spot disease. These results demonstrate that the test results in this invention are consistent with the actual test results and the actual brown spot disease resistance of apples, indicating that the method in this invention can accurately determine the brown spot disease resistance level of apples.

[0105] Although preferred embodiments of the invention have been described, those skilled in the art, once they have learned the basic inventive concept, can make other changes and modifications to these embodiments.

[0106] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A group of molecular markers associated with resistance to apple brown spot disease, characterized in that, The molecular markers are the SNP molecular marker group and the InDel molecular marker group; The SNP molecular marker set includes four SNP molecular markers, namely SNP1 to SNP4; the nucleotide sequences of SNP1 to SNP4 are shown in SEQ ID NO.1 to SEQ ID NO.4 respectively. The apple reference genome version is GDDH13.1; Specifically, SNP1 is located at 24,618,204 bp on apple chromosome 0, with a base polymorphism of C to T; SNP2 is located at 13,924,744 bp on apple chromosome 8, with a base polymorphism of A to T or G to T; SNP3 is located at 27,163,218 bp on apple chromosome 10, with a base polymorphism of C to A; and SNP4 is located at 12,662,946 bp on apple chromosome 17, with a base polymorphism of A to G. The InDel molecular marker group includes three InDel molecular markers, namely InDel1 to InDel3; the nucleotide sequences of InDel1 to InDel3 are shown in SEQ ID NO.5 to SEQ ID NO.7 respectively. Specifically, InDel1 is located at 117948680bp on apple chromosome 11 and is a C or AT insertion; InDel2 is located at 7739098bp on apple chromosome 14 and is either AG present or deleted; InDel3 is located at 11163770bp on apple chromosome 14 and is either TA present or deleted. When the genotype at 27163218bp of chromosome 10 is CT or TT, the genotype at 7739098bp of chromosome 14 is delAG / delAG, the genotype at 11163770bp of chromosome 14 is TA / delTA or delTA / delTA, and the genotype at 12662946bp of chromosome 17 is AG, the child is considered highly resistant to apple brown spot disease. When the genotype at 24618204bp on chromosome 0 is CT or TT, the genotype at 13924744bp on chromosome 8 is AT, TT, or GT, and the genotype at 7739098bp on chromosome 14 is AG or delAG, it is determined to be resistant to apple brown spot disease. When the genotype is C / insAT at 7948680bp on chromosome 11, it is determined to be susceptible to apple brown spot disease. The remaining plants are moderately susceptible to brown spot disease; where del indicates deletion and ins indicates insertion.

2. The application of a probe set for detecting the molecular markers of claim 1 in apple brown spot resistance-assisted breeding or identification of apple brown spot resistance, characterized in that, The probe sequence of SNP1 is shown in SEQ ID NO.8; The probe sequence of SNP2 is shown in SEQ ID NO.9; The probe sequence of SNP3 is shown in SEQ ID NO.10; The probe sequence for SNP4 is shown in SEQ ID NO.11; The probe sequence of InDel1 is shown in SEQ ID NO.12; The probe sequence of InDel2 is shown in SEQ ID NO.13; The probe sequence of InDel3 is shown in SEQ ID NO.14; When the genotype at 27163218bp of chromosome 10 is CT or TT, the genotype at 7739098bp of chromosome 14 is delAG / delAG, the genotype at 11163770bp of chromosome 14 is TA / delTA or delTA / delTA, and the genotype at 12662946bp of chromosome 17 is AG, the child is considered highly resistant to apple brown spot disease. When the genotype at 24618204bp on chromosome 0 is CT or TT, the genotype at 13924744bp on chromosome 8 is AT, TT, or GT, and the genotype at 7739098bp on chromosome 14 is AG or delAG, it is determined to be resistant to apple brown spot disease. When the genotype is C / insAT at 7948680bp on chromosome 11, it is determined to be susceptible to apple brown spot disease. The remaining plants are moderately susceptible to brown spot disease; where del indicates deletion and ins indicates insertion.

3. A method for identifying resistance to apple brown spot disease, characterized in that, Includes the following steps: The target sequence was captured using the probe set described in claim 2, and after genotyping via Illumina sequencing, the resistance of the test sample to apple brown spot disease was determined according to the following criteria: When the genotype at 27163218bp of chromosome 10 is CT or TT, the genotype at 7739098bp of chromosome 14 is delAG / delAG, the genotype at 11163770bp of chromosome 14 is TA / delTA or delTA / delTA, and the genotype at 12662946bp of chromosome 17 is AG, the child is considered highly resistant to apple brown spot disease. When the genotype at 24618204bp on chromosome 0 is CT or TT, the genotype at 13924744bp on chromosome 8 is AT, TT, or GT, and the genotype at 7739098bp on chromosome 14 is AG or delAG, it is determined to be resistant to apple brown spot disease. When the genotype is C / insAT at 7948680bp on chromosome 11, it is determined to be susceptible to apple brown spot disease. The remaining plants are moderately susceptible to brown spot disease; where del indicates deletion and ins indicates insertion.

Images