Electro-competent cell for amplifying CRISPR (clustered regularly interspaced short palindromic repeats) library plasmids and preparation method thereof
By introducing RecA56 gene point mutation and sorbitol and calcium chloride treatment in the host bacteria of E. coli Stbl series, electrotransfer competent cells were prepared, which solved the problems of low electrotransfer efficiency and plasmid recombination, and achieved efficient amplification of CRISPR library plasmids and stable coverage of sgRNA.
Patent Information
- Application Number
- CN202510674667.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-23
- Publication Date
- 2025-08-26
AI Technical Summary
When existing electrotransfer competent cells amplify the CRISPR library plasmid, the electrotransfer efficiency is low and easy to produce plasmid recombination, and cannot be suitable for the amplification of the CRISPR library plasmid.
By introducing the RecA56 gene point mutation in the host bacteria of E. coli Stbl series, combined with sorbitol and calcium chloride treatment, electrotransfer competent cells were prepared, which reduced the homologous recombination function of the RecA protein, and electrotransferring through the electrotransferrer to ensure the stability and efficient transformation of the plasmid.
It significantly reduces the probability of plasmid recombination, improves the electro-transfer efficiency, ensures the amplification quality of the CRISPR library plasmid and the coverage of sgRNA, and improves the reliability and accuracy of the experiment.
Smart Images

Figure CN120536331A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of bioengineering technology, and in particular to an electroporated competent cell for amplifying a CRISPR library plasmid and a preparation method thereof. Background Art
[0002] The CRISPR library is a high-throughput gene screening solution based on CRISPR / Cas9 technology. A primer pool containing multiple different sgRNA (single guide RNA) sequences is synthesized on a chip. These primers are then loaded onto a specific plasmid backbone via homologous recombination to construct the CRISPR library plasmid. This plasmid is then packaged into a lentivirus and infected with cells to be screened at a low MOI (usually <0.3). The cells are then treated with the screening factor and collected for subsequent processing.
[0003] Among them, the CRISPR library plasmid contains more than 10,000 different sgRNA sequences. During the amplification process of the CRISPR library plasmid, in order to avoid the loss of sgRNA and ensure the coverage of sgRNA, efficient electroporation competent cells are required to ensure the transformation efficiency and bacterial growth of the CRISPR library plasmid. In addition, because CRISPR library plasmids usually carry LTRs (long terminal repeats) necessary for lentiviral packaging, during the amplification process, the LTRs are highly homologous and long, and they are prone to mispairing, which can easily cause plasmid recombination problems and affect the quality of the library plasmid. However, the commercial electroporation competent cells currently used to amplify plasmids containing highly repetitive sequences generally only mutate a certain site. Using these cells to amplify CRISPR library plasmids is not suitable for the amplification of CRISPR library plasmids. Summary of the Invention
[0004] In response to the above-mentioned defects, the purpose of the present invention is to propose an electroporation competent cell for amplifying CRISPR library plasmids and a preparation method thereof, so as to solve the problem that the electroporation competent cells currently used for amplifying CRISPR library plasmids have low electroporation efficiency and are prone to plasmid recombination.
[0005] To achieve this object, the present invention adopts the following technical solutions:
[0006] A method for preparing electrocompetent cells for amplifying CRISPR library plasmids comprises the following steps:
[0007] Step 1: Transform the CRISPR-B_CR plasmid into the host bacteria of the Escherichia coli Stbl series. The CRISPR-B_CR plasmid carries the Cas9 protein expression cassette. Cultivate the host bacteria containing the CRISPR-B_CR plasmid. Cultivate the host bacteria containing the CRISPR-B_CR plasmid to OD 600The pH value is 0.4-0.8, and electrocompetent cells are prepared to obtain electrocompetent cells containing CRISPR-B_CR plasmid;
[0008] Step 2: Based on the sequence of the RecA gene, a sgRNA sequence targeting the host bacteria and a homologous recombination template sequence were designed for point mutation of the RecA 56 gene. The sgRNA sequence was constructed into the CRISPR-B_G plasmid vector to obtain a CRISPR-B_G plasmid vector containing the desired sgRNA sequence; and a double-stranded DNA fragment CRISPR-B_D of the homologous recombination template sequence was synthesized;
[0009] Step 3: Mix the double-stranded DNA fragments CRISPR-B_D and CRISPR-B_G plasmid vectors obtained in step 2 and the electroporated competent cells containing the CRISPR-B_CR plasmid obtained in step 1, transfer the mixed cell suspension to an electroporator for electroporation, and plate the electroporated bacterial solution for overnight culture. Use colony PCR to identify the strain that successfully obtained the RecA56 gene mutation. Based on the strain that obtained the RecA 56 gene mutation, culture it to OD 600 The pH value was 0.4-0.8, and electrocompetent cells were prepared to obtain electrocompetent cells for amplifying CRISPR library plasmids.
[0010] Preferably, the mutation site of the host bacteria of the Escherichia coli Stbl series is RecA13, the sgRNA sequence targeting the host bacteria of the Escherichia coli Stbl series is GGGGCAGGTGGTCTGCCGAT, and the homologous recombination template sequence is shown in SEQ ID No. 1;
[0011] In step 3, the mixed components are 0.5-3 μg of double-stranded DNA fragment CRISPR-B_D, 1-3 μg of CRISPR-B_G plasmid vector and 50-100 μL of electroporated competent cells containing CRISPR-B_CR plasmid.
[0012] Preferably, in step 1 and step 3, preparing electrocompetent cells comprises the following steps:
[0013] S1. Cool the entire bacterial solution containing the desired strain on ice for 10-30 minutes and centrifuge to obtain the first precipitate;
[0014] S2, pre-cooling a treatment solution containing 1-10 M sorbitol and 1-10 mM CaCl2, resuspending the first precipitate with the treatment solution, and centrifuging to obtain a second precipitate;
[0015] S3, resuspend the second precipitate with 1-10 mM Hepes buffer and centrifuge to obtain a third precipitate;
[0016] S4. Resuspend the third precipitate with 10-20% ultrapure glycerol and centrifuge to obtain a fourth precipitate;
[0017] S5. Resuspend the fourth precipitate with ultrapure glycerol at a concentration of 10-20% to obtain the corresponding electroporation competent cells.
[0018] Preferably, in step 3, the mixed components are 1-2ug of double-stranded DNA fragment CRISPR-B_D, 2ug of CRISPR-B_G plasmid, and 60-80uL of electroporated competent cells containing CRISPR-B_CR plasmid.
[0019] Preferably, in step 1, the host bacteria containing the CRISPR-B_CR plasmid are cultured at a temperature of 30°C for 12-16 hours. 600 is 0.6.
[0020] Furthermore, the centrifugation in steps S1-S4 is performed at a temperature of 4°C, a rotation speed of 4000 rpm, and a time of 20 min.
[0021] Preferably, in step 3, the voltage of the electroporator is 1-5 kV / cm.
[0022] An electroporated competent cell for amplifying a CRISPR library plasmid is prepared by the above preparation method.
[0023] The technical solution provided by the present invention can have the following beneficial effects:
[0024] This technical solution mutates two sites of the RecA gene in electrocompetent cells to reduce plasmid recombination when amplifying CRISPR library plasmids. Moreover, when preparing electrocompetent cells, the corresponding concentrations of sorbitol and calcium chloride are added to participate in centrifugal precipitation of the cells, which can reduce plasmid recombination while improving the electroporation efficiency of the cells. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 This is a diagram showing the electrophoresis results of Example 1 of the present invention.
[0026] Figure 2 This is a diagram showing the electrophoresis results of Comparative Example 1 of the present invention.
[0027] Figure 3 This is a CRISPR-B_CR plasmid map of an embodiment of the present invention.
[0028] Figure 4 This is a CRISPR-B_G plasmid vector map of an embodiment of the present invention.
[0029] Figure 5This is a comparison chart of the electroporation results of the competent cells of the present invention and the competent cells treated with conventional glycerol.
[0030] Figure 6 This is a diagram showing the results of culture in Example 1 of the present invention.
[0031] Figure 7 This is a diagram showing the results of culture in Example 2 of the present invention.
[0032] Figure 8 This is a diagram showing the results of culture in Example 3 of the present invention.
[0033] Figure 9 It is a result diagram after culturing Comparative Example 1 of the present invention.
[0034] Figure 10 It is a result diagram after cultivation of Comparative Example 2 of the present invention.
[0035] Figure 11 It is a result diagram after cultivation of Comparative Example 3 of the present invention. DETAILED DESCRIPTION
[0036] The technical solution of the present invention is further illustrated below through specific implementation methods.
[0037] For ease of understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.
[0038] If no specific techniques or conditions are specified in the examples, the experiments were carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. All reagents or instruments used without specifying the manufacturer are commercially available conventional products.
[0039] A method for preparing electrocompetent cells for amplifying CRISPR library plasmids comprises the following steps:
[0040] Step 1: Transform the CRISPR-B_CR plasmid into the host bacteria of the Escherichia coli Stbl series. The CRISPR-B_CR plasmid carries the Cas9 protein expression cassette. Cultivate the host bacteria containing the CRISPR-B_CR plasmid. Cultivate the host bacteria containing the CRISPR-B_CR plasmid to OD 600 The pH value is 0.4-0.8, and electrocompetent cells are prepared to obtain electrocompetent cells containing CRISPR-B_CR plasmid;
[0041] Step 2: Based on the sequence of the RecA gene, a sgRNA sequence targeting the host bacteria and a homologous recombination template sequence were designed for point mutation of the RecA 56 gene. The sgRNA sequence was constructed into the CRISPR-B_G plasmid vector to obtain a CRISPR-B_G plasmid vector containing the desired sgRNA sequence; and a double-stranded DNA fragment CRISPR-B_D of the homologous recombination template sequence was synthesized;
[0042] Step 3: Mix the double-stranded DNA fragments CRISPR-B_D and CRISPR-B_G plasmid vectors obtained in step 2 and the electroporated competent cells containing the CRISPR-B_CR plasmid obtained in step 1, transfer the mixed cell suspension to an electroporator for electroporation, and plate the electroporated bacterial solution for overnight culture. Use colony PCR to identify the strain that successfully obtained the RecA56 gene mutation. Based on the strain that obtained the RecA 56 gene mutation, culture it to OD 600 The pH value was 0.4-0.8, and electrocompetent cells were prepared to obtain electrocompetent cells for amplifying CRISPR library plasmids.
[0043] In the existing technology, the CRISPR library plasmid needs to be packaged into a lentivirus and then infect the cells to be screened with a low MOI (Multiplicities of Infection). Therefore, the CRISPR library plasmid carries the long terminal repeat sequence required for lentivirus packaging. The long terminal repeat sequences are highly homologous and long in length, and are prone to mispairing with each other. The use of existing commercially available electroporation competent cells cannot effectively reduce the probability of mispairing, and is prone to plasmid recombination problems, and cannot be applied to the amplification of CRISPR library plasmids. In actual production, compared with other types of strains, the Stbl series of Escherichia coli strains are better at inhibiting homologous recombination. The Stbl series of Escherichia coli strains are usually used to amplify plasmids containing highly repetitive sequences, but they cannot effectively avoid the occurrence of plasmid recombination. When using the E. coli Stbl series of strains to amplify CRISPR library plasmids, the recombination bands will become more and more serious with the increase in the number of plasmid amplification generations, such as Figure 1 As shown, from left to right are the plasmid gel images of P0, P1 and P2 generations after electroporation and amplification using Escherichia coli Stbl series strains. As the amplification generation increases to P2, the proportion of recombinant bands marked by red boxes is as high as more than 70%, and the probability of recombination is high.
[0044] The RecA protein expressed by the RecA gene can promote base pairing between two homologous DNA molecules. It recognizes and binds to single-stranded DNA to form a protein-DNA filamentous complex, and then invades double-stranded DNA to search for homologous sequences, ultimately achieving chain exchange. Because the long terminal repeat sequences are highly homologous, the RecA protein can efficiently recognize and bind to these homologous sequences, thereby promoting pairing and chain exchange between them. The currently commonly used strains of the Escherichia coli Stbl series on the market generally have only RecA1 point mutations or only RecA13 point mutations. When used to amplify CRISPR library plasmids, the probability of recombination is high under multiple amplifications, and the effect is not good. Therefore, the present invention proposes a method for preparing electroporated competent cells for amplifying CRISPR library plasmids, which introduces an additional RecA56 point mutation into the RecA gene in the strains of the Escherichia coli Stbl series by homologous recombination. In the original strains of the Escherichia coli Stbl series, the RecA protein has a low ability to hydrolyze ATP. However, it does not affect the affinity of RecA protein and ATP. The present invention adds a mutation at the RecA56 site to reduce the binding ability of RecA protein to ATP. While inhibiting the hydrolysis of ATP bound to the RecA protein, it further inhibits the binding of RecA protein to ATP, effectively reducing the homologous recombination function of RecA protein, and is better used for amplifying CRISPR library plasmids. As the number of plasmid amplification generations increases, obvious recombination will not occur, thus solving the problem that electroporated competent cells currently used for amplifying CRISPR library plasmids are prone to plasmid recombination.
[0045] The present invention designs sgRNA sequence and homologous recombination template sequence based on the sequence of RecA gene in the Stbl series of Escherichia coli host bacteria, mixes double-stranded DNA fragments CRISPR-B_D, CRISPR-B_G plasmid vector and electroporated competent cells containing CRISPR-B_CR plasmid, and the CRISPR-B_CR plasmid map is as follows Figure 3As shown, the cell membrane permeability of electroporated cells containing the CRISPR-B_CR plasmid is relatively good. Then, through electroporation, a brief high-voltage electric pulse is applied, temporarily rupturing the phospholipid bilayer of the cell membrane, forming tiny pores. These pores allow the double-stranded DNA fragments CRISPR-B_D and CRISPR-B_G plasmid vectors to enter the cell interior. During electroporation, the electric potential on the cell membrane increases, and the negatively charged double-stranded DNA fragments CRISPR-B_D and CRISPR-B_G plasmid vectors are pushed toward the cell membrane under the action of the electric field and enter the electroporated cells containing the CRISPR-B_CR plasmid through the temporarily formed micropores. At the same time, the sgRNA can guide the Cas9 protein to precisely cut the target gene with high cutting efficiency and enable simultaneous editing of multiple genes. Guided by the sgRNA in the CRISPR-B_G plasmid vector, the Cas protein recognizes and cuts a specific site in the RecA gene, generating a double-strand break. The cell then uses the double-stranded DNA fragment CRISPR-B_D to replace the RecA gene, thereby causing a site-directed mutation in the RecA56 gene, causing structural variations in the RecA protein and blocking its activity. The resulting electroporated cells are used to amplify CRISPR library plasmids, resolving the problem of plasmid recombination that is common when using currently commercially available electroporated cells to amplify CRISPR library plasmids. Mutating the RecA56 gene, in addition to the RecA13 point mutation, reduces the number of electroporated cells, but does not affect the total amount of plasmid extracted.
[0046] It is worth noting that the CRISPR-B_CR plasmid, CRISPR-B_G plasmid and double-stranded DNA fragment CRISPR-B_D are based on CRISPR-B TM The gene editing system was optimized. The CRISPR-B_CR plasmid and CRISPR-B_G plasmid came from Guangzhou Yuanjing Biotechnology Co., Ltd., specifically Yuanjing Bio's CRISPR-BTM series vectors, where CRISPR-B_CR is an enzyme that expresses the Cas9 nuclease and Red recombination system, CRISPR-B_G is the gRNA that expresses the target gene, and CRISPR-B_D is a DNA repair sequence.
[0047] In addition, the CRISPR-B_G plasmid vector contains a high-copy number replicon, capable of massive replication in host cells. This not only improves the stability and delivery efficiency of the plasmid itself, but also ensures sufficient expression of sgRNA and Cas9 protein, thereby increasing the success rate of further targeting the RecA56 locus. Before preparing electrocompetent cells, culture the cells to an OD600 of 0.4-0.8 to ensure cell viability, which is beneficial for preparing electrocompetent cells.
[0048] Further explanation: the sgRNA sequence was constructed into the CRISPR-B_G plasmid vector through homologous recombination. Colony PCR identification was to pick a single colony obtained by plating the electroporated bacterial solution on a plate and culturing it overnight. The colony was suspended in a small amount of liquid and then heat-treated to lyse the cells and release DNA. Specific primers were used to amplify the target DNA fragment through PCR, thereby quickly identifying whether the single colony contained the target gene and then identifying the strain that successfully obtained the RecA56 gene mutation.
[0049] Preferably, the mutation site of the host bacteria of the Escherichia coli Stbl series is RecA13, the sgRNA sequence targeting the host bacteria of the Escherichia coli Stbl series is GGGGCAGGTGGTCTGCCGAT, and the homologous recombination template sequence is shown in SEQ ID No. 1;
[0050] In step 3, the mixed components are 0.5-3 μg of double-stranded DNA fragment CRISPR-B_D, 1-3 μg of CRISPR-B_G plasmid vector and 50-100 μL of electroporated competent cells containing CRISPR-B_CR plasmid.
[0051] Specifically, the host bacteria of the Escherichia coli Stbl series carry a RecA13 site mutation, which changes an amino acid in the RecA protein and reduces the activity of the RecA protein. The mutation at the RecA13 site can reduce the ability of the RecA protein to hydrolyze ATP without affecting the affinity of the RecA protein and ATP. It is mainly used for lentiviral plasmid amplification. On the basis of the mutation, the strain containing the RecA13 site mutation is used for transformation, and the final effect is better.
[0052] At the same time, according to the sequence of the RecA gene, the sgRNA sequence targeting the host bacteria and the homologous recombination template sequence were designed. The sgRNA sequence targeting the wild-type strain of Stbl3 was GGGGCAGGTGGTCTGCCGAT. The sgRNA sequence was constructed into the CRISPR-B_G plasmid vector. The CRISPR-B_G plasmid vector map is shown in Figure 2. Figure 4 The homologous recombination template sequence is shown in SEQ ID No. 1. Based on the RecA13 site mutation, the RecA gene was further mutated. The efficiency of constructing the resulting point mutation strain using different sgRNAs or homologous recombination vectors was significantly different. Using the above-mentioned sgRNAs and homologous recombination vectors, the desired point mutation strain can be efficiently obtained.
[0053] By precisely designing the sgRNA sequence, it is ensured that it binds highly specifically to the target site of the RecA gene, avoiding non-specific editing in the genome, significantly reducing off-target effects, and improving the accuracy of gene editing. The designed homologous recombination template sequence can promote gene editing in cells through the homologous recombination repair mechanism, especially when repairing double-strand breaks caused by Cas9 cutting. Compared with traditional RecA-mediated homologous recombination, the homologous recombination template sequence can achieve efficient recombination on shorter homologous arms (such as 36bp), is independent of the RecA protein, does not conflict with the purpose of further point mutations, and ensures that the target gene can be accurately replaced or inserted, achieving scarless editing and reducing the risk of editing failure.
[0054] In addition, the mixed components are 0.5-3 μg of double-stranded DNA fragment CRISPR-B_D, 1-3 μg of CRISPR-B_G plasmid vector and 50-100 μL of electroporated competent cells containing CRISPR-B_CR plasmid. Too high amounts of double-stranded DNA fragment CRISPR-B_D and CRISPR-B_G plasmid vector will cause bacterial toxicity, but too low an amount of DNA fragment cannot guarantee the efficiency of homologous recombination. Therefore, 0.5-3 μg of double-stranded DNA fragment CRISPR-B_D and 1-3 μg of CRISPR-B_G plasmid vector are selected to ensure that the electroporated competent cells can effectively absorb them without causing cell damage, and the volume of electroporated competent cells containing CRISPR-B_CR plasmid is limited to 50-100 μL to ensure that the reaction system is not diluted, reduce mutual interference between cells during electroporation, improve transformation efficiency, and ensure the accuracy of the final results. The present invention further mutates the RecA gene on the basis of the Stbl series strains to form strains with mutations in RecA13 and RecA56 sites, and then uses the modified strains to electroporate CRISPR library plasmids, which significantly reduces the recombination probability. Figure 2 As shown, from left to right are the gel images of P0, P1 and P2 generations of plasmids after electroporation and amplification of the modified strain. As the amplification generation increases to P2, the recombinant bands marked by the red box are still below 10%, and no obvious recombinant bands are seen after multiple passages of the plasmid, which can achieve the purpose of reducing plasmid recombination.
[0055] Preferably, in step 1 and step 3, preparing electrocompetent cells comprises the following steps:
[0056] S1. Cool the entire bacterial solution containing the desired strain on ice for 10-30 minutes and centrifuge to obtain the first precipitate;
[0057] S2, pre-cooling a treatment solution containing 1-10 M sorbitol and 1-10 mM CaCl2, resuspending the first precipitate with the treatment solution, and centrifuging to obtain a second precipitate;
[0058] S3, resuspend the second precipitate with 1-10 mM Hepes buffer and centrifuge to obtain a third precipitate;
[0059] S4. Resuspend the third precipitate with 10-20% ultrapure glycerol and centrifuge to obtain a fourth precipitate;
[0060] S5. Resuspend the fourth precipitate with ultrapure glycerol at a concentration of 10-20% to obtain the corresponding electroporation competent cells.
[0061] It is worth noting that in step 3, electroporation competent cells were prepared based on the strain with the successful RecA56 gene mutation. During the electroporation process, the permeability of the cell membrane is an important factor affecting the uptake efficiency of electroporation competent cells. The RecA protein can promote the formation of micropores in the cell membrane and the uptake of DNA through its recombination activity. Because the RecA protein plays a certain auxiliary role in the process of forming micropores on the cell membrane, mutations at the two sites of the RecA protein will weaken this process, resulting in low efficiency of electroporation competent cells after mutations at the two sites of the RecA gene. Although the problem of plasmid recombination is not easy to occur when amplifying the CRISPR library plasmid, the CRISPR library plasmid is hindered when entering the cell. The present invention can better increase the permeability of the cell membrane by treating the cells cultured to OD600 of 0.4-0.8 with CaCl2 and sorbitol through steps S1 to S4. This is because when the cell OD600 is 0.4-0.8, the cell metabolism is vigorous and in the logarithmic growth phase. The cell surface structure is relatively unstable and can better absorb and utilize exogenous DNA. The Ca2 in CaCl2 + Ions can combine with negatively charged groups on the cell membrane and change the charge distribution of the cell membrane. At the same time, sorbitol is an osmotic pressure regulator that can adjust the osmotic pressure balance inside and outside the cell. In the high osmotic pressure sorbitol solution, the water in the cell will be attracted out, causing the structure of the cell membrane to change, thereby increasing the permeability of the cell membrane.
[0062] Additionally, sorbitol can stabilize the cell membrane structure, reduce cell membrane damage during electroporation, and improve cell survival. Under low-temperature conditions, CaCl2 treatment can alter the phospholipid bilayer structure of the cell membrane, inducing the formation of micropores in the cell membrane, allowing exogenous DNA to enter the cell through these micropores. Pre-cooling a treatment solution containing 1-10M sorbitol and 1-10mM CaCl2 exposes the CaCl2 to low temperatures, inducing micropore formation in the cell membrane. Furthermore, the concentrations of sorbitol and calcium chloride should be limited to 1-10mM to avoid ineffective preparation of electrocompetent cells due to too low a concentration; and to avoid adverse effects on cell status and low electroporation efficiency due to too high a concentration.
[0063] In summary, each precipitation is treated with different substances to control the number of precipitations, thereby avoiding multiple precipitations and long precipitation times, which may lead to poor bacterial state and affect electroporation efficiency. Compared with conventional glycerol treatment, the present invention increases the use of sorbitol and calcium chloride, controls the concentration of sorbitol and calcium chloride, further increases the permeability of the cell membrane, and reduces the effect of the two-point mutation of the RecA gene on the cell electroporation efficiency. Figure 5 As shown, the left side shows the electroporation results of the competent cells obtained by the present invention, and the right side shows the electroporation results of the competent cells obtained by conventional glycerol treatment. After electroporation and culture under the same conditions, the number of bacteria grown after electroporation using the electroporation competent cells of the present invention is significantly increased. In addition, under normal circumstances, only one plasmid vector will be transfected into a cell. In the case of low efficiency, the number of bacterial clones grown after plasmid electroporation is small, and many plasmid vectors carrying different sgRNA sequences cannot be transformed into cells for amplification, resulting in the loss of some sgRNA sequences during the plasmid amplification process. The electroporation competent cells obtained by the preparation method of the present invention can ensure the number of plasmid bacteria grown after electroporation, that is, more plasmids carrying different sgRNA sequences are transferred into different bacteria for amplification, thereby ensuring sgRNA coverage and ensuring the uniformity and integrity of CRISPR library plasmid amplification, thereby improving the quality of the library and the reliability of the experiment.
[0064] Preferably, when the sorbitol concentration is 5M-10M, the number of bacteria grown after electroporation of competent cells is better.
[0065] Furthermore, in step 3, the mixed components are 1-2ug of double-stranded DNA fragment CRISPR-B_D, 2ug of CRISPR-B_G plasmid, and 60-80uL of electroporated competent cells containing CRISPR-B_CR plasmid.
[0066] It can further ensure the efficiency of homologous recombination, effectively reduce the mutual interference between cells during electroporation, improve the transformation efficiency, and better ensure the accuracy of the final results.
[0067] Preferably, in step 1, the host bacteria containing the CRISPR-B_CR plasmid are cultured at a temperature of 30°C for 12-16 hours. 600 is 0.6.
[0068] Specifically, the host bacteria containing the CRISPR-B_CR plasmid is Escherichia coli, and the culture temperature is limited to 30°C. Compared with the optimal growth temperature of Escherichia coli of 37°C, it can reduce the metabolic rate of the cells and reduce the burden on cell metabolism during plasmid expression, which is beneficial to the stable growth of the host bacteria. The culture time of 12-16 hours can keep the cells in the logarithmic growth phase, and the absorbance value of the bacterial solution is limited to 0.6, ensuring that the cells are in the logarithmic growth phase and the cell density is moderate. At this time, the cells grow vigorously, the metabolism is active, and the permeability of the cell membrane is high, which is beneficial to the subsequent electroporation operation.
[0069] Furthermore, limiting the culture conditions can ensure the consistency of the cell state and improve the reproducibility of the experimental results.
[0070] Preferably, the centrifugation in steps S1-S4 is performed at a temperature of 4°C, a rotation speed of 4000 rpm, and a time of 20 min.
[0071] Specifically, a low temperature environment of 4°C can effectively reduce enzyme activity and cell metabolic rate, preventing enzymatic reactions in cells from causing plasmid DNA degradation; a rotation speed of 4000 rpm can generate sufficient centrifugal force to precipitate cells from the culture medium, and also avoid cell rupture caused by excessive centrifugation; a centrifugation time of 20 minutes can ensure that the cells are fully precipitated, while avoiding cell damage caused by excessive centrifugation time. Therefore, the centrifugation temperature is 4°C, the rotation speed is 4000 rpm, and the time is 20 minutes. This can ensure the integrity of the plasmid and the activity of the cells in the CRISPR experiment, thereby improving the success rate and reliability of the experiment.
[0072] Preferably, in step 3, the voltage of the electroporator is 1-5 kV / cm.
[0073] Specifically, a voltage range of -5kV / cm can minimize cell damage while ensuring transfection efficiency. Excessively high voltages may cause excessive permeability or even rupture of the cell membrane, while too low a voltage cannot effectively form micropores. Within the voltage range of 1-5kV / cm, the electric field strength is sufficient to reorient the phospholipid molecules in the cell membrane, forming hydrophilic "micropores" in localized areas, thereby significantly improving the permeability of the cell membrane and allowing exogenous DNA or other molecules to enter the cell smoothly. This voltage range is applicable to a variety of cell types, including bacteria, yeast, and mammalian cells, and can achieve efficient gene transfection.
[0074] Preferably, the voltage is set at 2-3 kV / cm for better editing efficiency after electroporation.
[0075] An electroporated competent cell for amplifying a CRISPR library plasmid is prepared by the above-mentioned preparation method.
[0076] The result is an electroporated competent cell with mutated RecA gene recA13 and RecA56 sites. It is currently known that the RecA gene is crucial for gene recombination. After the RecA gene recA13 site is mutated, the probability of plasmid recombination can be effectively reduced. The present invention avoids plasmid recombination to a greater extent by mutating the RecA56 site on the basis of the recA13 site mutation.
[0077] At the same time, after the corresponding preparation steps and four precipitations, the required electro-competent cells are obtained, reducing the impact of the two-site mutation of the RecA gene on the electro-transfection efficiency, and solving the problem that the electro-competent cells currently used to amplify CRISPR library plasmids have low electro-transfection efficiency and are prone to plasmid recombination.
[0078] The technical solution of the present invention is further illustrated below through specific implementation methods.
[0079] Example Group
[0080] Example 1
[0081] Step 1: Transform the CRISPR-B_CR plasmid carrying the Cas9 protein expression cassette into the Escherichia coli Stbl series strain with the mutation site RecA13, culture the host bacteria of the Escherichia coli Stbl series containing the CRISPR-B_CR plasmid, pick a single Escherichia coli clone and inoculate it into a test tube containing 5 ml LB liquid medium, culture it on a shaker overnight for 14 hours, take an appropriate amount of the bacterial solution and inoculate it into a conical flask containing 200 mL LB medium, and culture it on a shaker at 30°C for 2 hours to make the bacterial solution 0D 600 When the concentration reaches 0.6, a bacterial solution of Escherichia coli containing the CRISPR-B_CR plasmid is obtained;
[0082] S1. Cool the entire bacterial suspension of Escherichia coli containing the CRISPR-B_CR plasmid on ice for 30 minutes, and centrifuge at 4000 rpm for 20 minutes at 4°C to obtain the first precipitate.
[0083] S2. Pre-cool a treatment solution containing 5 M sorbitol and 8 mM CaCl2, resuspend the first precipitate with the treatment solution, and centrifuge at 4000 rpm for 20 min at 4°C to obtain a second precipitate;
[0084] S3. Resuspend the second precipitate in 5 mM Hepes buffer and centrifuge at 4000 rpm for 20 min at 4°C to obtain a third precipitate.
[0085] S4. Resuspend the third precipitate with 15% ultrapure glycerol and centrifuge to obtain the fourth precipitate;
[0086] S5. Resuspend the fourth precipitate in 20% ultrapure glycerol to prepare electrocompetent cells containing the CRISPR-B_CR plasmid.
[0087] Step 2: Based on the sequence of the RecA gene, a sgRNA sequence targeting the host bacteria and a homologous recombination template sequence were designed for point mutation of the RecA 56 gene. The sgRNA sequence was constructed into a CRISPR-B_G plasmid vector to obtain a CRISPR-B_G plasmid vector containing the desired sgRNA sequence; and a double-stranded DNA fragment CRISPR-B_D containing the homologous recombination template sequence was synthesized; the sgRNA sequence was GGGGCAGGTGGTCTGCCGAT, and the homologous recombination template sequence was shown in SEQ ID No. 1;
[0088] Step 3: Mix 2 μg of double-stranded DNA fragment CRISPR-B_D, 2 μg of CRISPR-B_G plasmid vector and 70 μL of electroporated competent cells containing CRISPR-B_CR plasmid, transfer the mixed cell suspension to an electroporator for electroporation, set the voltage of the electroporator at 2.5 kV / cm, and plate the electroporated bacterial solution for overnight culture. Use colony PCR to identify strains that have successfully obtained RecA56 gene mutations. Based on these strains that have successfully obtained RecA56 gene mutations, culture until OD 600 is 0.6;
[0089] S1. Cool the entire bacterial suspension of the strain with the successfully obtained RecA56 gene mutation on ice for 30 minutes, and centrifuge at 4000 rpm for 20 minutes at 4°C to obtain the first precipitate;
[0090] S2. Pre-cool a solution containing 5 M sorbitol and 8 mM CaCl2, use the solution to resuspend the first precipitate, and centrifuge at 4000 rpm for 20 min at 4°C to obtain a second precipitate;
[0091] S3. Resuspend the second precipitate in 5 mM Hepes buffer and centrifuge at 4000 rpm for 20 min at 4°C to obtain a third precipitate.
[0092] S4. Resuspend the third precipitate with 15% ultrapure glycerol and centrifuge to obtain the fourth precipitate;
[0093] S5. Resuspend the fourth precipitate in 20% ultrapure glycerol to prepare electrocompetent cells for amplifying the CRISPR library plasmid.
[0094] Example 2
[0095] Step 1: Transform the CRISPR-B_CR plasmid carrying the Cas9 protein expression cassette into the Escherichia coli Stbl series strain with the mutation site RecA13, culture the host bacteria of the Escherichia coli Stbl series containing the CRISPR-B_CR plasmid, pick a single Escherichia coli clone and inoculate it into a test tube containing 5 ml LB liquid medium, culture it on a shaker overnight for 14 hours, take an appropriate amount of the bacterial solution and inoculate it into a conical flask containing 200 mL LB medium, and culture it on a shaker at 30°C for 2 hours to make the bacterial solution 0D 600 When the concentration reaches 0.6, a bacterial solution of Escherichia coli containing the CRISPR-B_CR plasmid is obtained;
[0096] S1. Cool the entire bacterial suspension of Escherichia coli containing the CRISPR-B_CR plasmid on ice for 30 minutes, and centrifuge at 4000 rpm for 20 minutes at 4°C to obtain the first precipitate.
[0097] S2. Pre-cool a treatment solution containing 5 M sorbitol and 8 mM CaCl2, resuspend the first precipitate with the treatment solution, and centrifuge at 4000 rpm for 20 min at 4°C to obtain a second precipitate;
[0098] S3. Resuspend the second precipitate in 5 mM Hepes buffer and centrifuge at 4000 rpm for 20 min at 4°C to obtain a third precipitate.
[0099] S4. Resuspend the third precipitate with 15% ultrapure glycerol and centrifuge to obtain the fourth precipitate;
[0100] S5. Resuspend the fourth precipitate in 20% ultrapure glycerol to prepare electrocompetent cells containing the CRISPR-B_CR plasmid.
[0101] Step 2: Based on the sequence of the RecA gene, a sgRNA sequence targeting the host bacteria and a homologous recombination template sequence were designed for point mutation of the RecA 56 gene. The sgRNA sequence was constructed into a CRISPR-B_G plasmid vector to obtain a CRISPR-B_G plasmid vector containing the desired sgRNA sequence; and a double-stranded DNA fragment CRISPR-B_D containing the homologous recombination template sequence was synthesized; the sgRNA sequence was GGGGCAGGTGGTCTGCCGAT, and the homologous recombination template sequence was shown in SEQ ID No. 1;
[0102] Step 3: Mix 2 μg of double-stranded DNA fragment CRISPR-B_D, 2 μg of CRISPR-B_G plasmid vector and 70 μL of electroporated competent cells containing CRISPR-B_CR plasmid, transfer the mixed cell suspension to an electroporator for electroporation, set the voltage of the electroporator at 2.5 kV / cm, and plate the electroporated bacterial solution for overnight culture. Use colony PCR to identify strains that have successfully obtained RecA56 gene mutations. Based on these strains that have successfully obtained RecA56 gene mutations, culture until OD 600 is 0.6;
[0103] S1. Cool the entire bacterial suspension of the strain with the successfully obtained RecA56 gene mutation on ice for 30 minutes, and centrifuge at 4000 rpm for 20 minutes at 4°C to obtain the first precipitate;
[0104] S2. Pre-cool a solution containing 10 M sorbitol and 8 mM CaCl2, use the solution to resuspend the first precipitate, and centrifuge at 4000 rpm for 20 min at 4°C to obtain a second precipitate;
[0105] S3. Resuspend the second precipitate in 5 mM Hepes buffer and centrifuge at 4000 rpm for 20 min at 4°C to obtain a third precipitate.
[0106] S4. Resuspend the third precipitate with 15% ultrapure glycerol and centrifuge to obtain the fourth precipitate;
[0107] S5. Resuspend the fourth precipitate in 20% ultrapure glycerol to prepare electrocompetent cells for amplifying the CRISPR library plasmid.
[0108] Example 3
[0109] Step 1: Transform the CRISPR-B_CR plasmid carrying the Cas9 protein expression cassette into the Escherichia coli Stbl series strain with the mutation site RecA13, culture the host bacteria of the Escherichia coli Stbl series containing the CRISPR-B_CR plasmid, pick a single Escherichia coli clone and inoculate it into a test tube containing 5 ml LB liquid medium, culture it on a shaker overnight for 14 hours, take an appropriate amount of the bacterial solution and inoculate it into a conical flask containing 200 mL LB medium, and culture it on a shaker at 30°C for 2 hours to make the bacterial solution 0D 600 When the concentration reaches 0.6, a bacterial solution of Escherichia coli containing the CRISPR-B_CR plasmid is obtained;
[0110] S1. Cool the entire bacterial suspension of Escherichia coli containing the CRISPR-B_CR plasmid on ice for 30 minutes, and centrifuge at 4000 rpm for 20 minutes at 4°C to obtain the first precipitate.
[0111] S2. Pre-cool a treatment solution containing 5 M sorbitol and 8 mM CaCl2, resuspend the first precipitate with the treatment solution, and centrifuge at 4000 rpm for 20 min at 4°C to obtain a second precipitate;
[0112] S3. Resuspend the second precipitate in 5 mM Hepes buffer and centrifuge at 4000 rpm for 20 min at 4°C to obtain a third precipitate.
[0113] S4. Resuspend the third precipitate with 15% ultrapure glycerol and centrifuge to obtain the fourth precipitate;
[0114] S5. Resuspend the fourth precipitate in 20% ultrapure glycerol to prepare electrocompetent cells containing the CRISPR-B_CR plasmid.
[0115] Step 2: Based on the sequence of the RecA gene, a sgRNA sequence targeting the host bacteria and a homologous recombination template sequence were designed for point mutation of the RecA 56 gene. The sgRNA sequence was constructed into a CRISPR-B_G plasmid vector to obtain a CRISPR-B_G plasmid vector containing the desired sgRNA sequence; and a double-stranded DNA fragment CRISPR-B_D containing the homologous recombination template sequence was synthesized; the sgRNA sequence was GGGGCAGGTGGTCTGCCGAT, and the homologous recombination template sequence was shown in SEQ ID No. 1;
[0116] Step 3: Mix 2 μg of double-stranded DNA fragment CRISPR-B_D, 2 μg of CRISPR-B_G plasmid vector and 70 μL of electroporated competent cells containing CRISPR-B_CR plasmid, transfer the mixed cell suspension to an electroporator for electroporation, set the voltage of the electroporator at 2.5 kV / cm, and plate the electroporated bacterial solution for overnight culture. Use colony PCR to identify strains that have successfully obtained RecA56 gene mutations. Based on these strains that have successfully obtained RecA56 gene mutations, culture until OD 600 is 0.6;
[0117] S1. Cool the entire bacterial suspension of the strain with the successfully obtained RecA56 gene mutation on ice for 30 minutes, and centrifuge at 4000 rpm for 20 minutes at 4°C to obtain the first precipitate;
[0118] S2. Pre-cool a solution containing 2 M sorbitol and 8 mM CaCl2, use the solution to resuspend the first precipitate, and centrifuge at 4000 rpm for 20 min at 4°C to obtain a second precipitate;
[0119] S3. Resuspend the second precipitate in 5 mM Hepes buffer and centrifuge at 4000 rpm for 20 min at 4°C to obtain a third precipitate.
[0120] S4. Resuspend the third precipitate with 15% ultrapure glycerol and centrifuge to obtain the fourth precipitate;
[0121] S5. Resuspend the fourth precipitate in 20% ultrapure glycerol to prepare electrocompetent cells for amplifying the CRISPR library plasmid.
[0122] Comparative group
[0123] Comparative Example 1
[0124] Compared with Example 1, in Comparative Example 1, instead of mutating the RecA56 site of the gene, the E. coli Stbl series strain with the mutation site RecA13 was directly used. A single E. coli clone was picked and inoculated into a test tube containing 5 ml of LB liquid medium, and cultured on a shaker overnight for 14 h. An appropriate amount of the bacterial solution was inoculated into a conical flask containing 200 mL of LB medium and cultured on a shaker at 30°C for 2 h. The bacterial solution was 0D 600 Reach 0.6;
[0125] S1. Cool the entire bacterial solution on ice for 30 minutes, and centrifuge at 4000 rpm for 20 minutes at 4°C to obtain the first precipitate.
[0126] S2. Pre-cool a treatment solution containing 5 M sorbitol and 8 mM CaCl2, resuspend the first precipitate with the treatment solution, and centrifuge at 4000 rpm for 20 min at 4°C to obtain a second precipitate;
[0127] S3. Resuspend the second precipitate in 5 mM Hepes buffer and centrifuge at 4000 rpm for 20 min at 4°C to obtain a third precipitate.
[0128] S4. Resuspend the third precipitate with 15% ultrapure glycerol and centrifuge to obtain the fourth precipitate;
[0129] S5. Resuspend the fourth precipitate in 20% ultrapure glycerol to obtain electroporation competent cells.
[0130] Comparative Example 2
[0131] Compared with Example 1, Comparative Example 2 performed conventional glycerol treatment. In Steps 1 and 3, the preparation of electroporated competent cells included the following steps:
[0132] S1. Cool the entire bacterial solution on ice for 30 minutes, and centrifuge at 4000 rpm for 20 minutes at 4°C to obtain the first precipitate.
[0133] S2. Resuspend the first precipitate in pre-chilled 10% glycerol and centrifuge the bacterial solution at 4000 rpm for 20 min at 4°C to obtain the second precipitate.
[0134] S3, repeat step S2 to obtain a third precipitate;
[0135] S4. Resuspend the third precipitate in 20% ultrapure glycerol to obtain electroporation competent cells.
[0136] Comparative Example 3
[0137] Compared with Example 1, in Comparative Example 3, instead of mutating the RecA56 site of the gene, the Escherichia coli Stbl series strain with the mutation site RecA13 was directly used. A single Escherichia coli clone was picked and inoculated into a test tube containing 5 ml of LB liquid medium, and cultured on a shaking table for 14 hours overnight. An appropriate amount of the bacterial solution was inoculated into a conical flask containing 200 mL of LB medium and cultured on a shaking table at 30°C for 2 hours. The bacterial solution was 0D 600 At the same time, the preparation steps of electroporation competent cells were the same as those in Comparative Example 2.
[0138] Equal amounts of CRISPR library plasmids containing an Amp-resistance gene, i.e., ampicillin resistance, were introduced into the competent cells obtained from the above Example and Comparative Example groups. Equal volumes of competent cells at the same cell density were then plated and cultured under the same culture conditions. The culture medium used contained ampicillin resistance, corresponding to the Amp-resistance gene in the plasmids. The CRISPR library plasmids were amplified using the electroporated competent cells obtained from Example 1 and Comparative Example 1 under the same conditions, and the amplified products were subjected to agarose gel electrophoresis.
[0139] The plates obtained in Examples 1-3 were as follows Figure 6-8 As shown, the difference between Examples 1-3 is that Example 1 uses 5M sorbitol, Example 2 uses 10M sorbitol, and Example 3 uses 2M sorbitol. Figure 6-8 In contrast, when the sorbitol concentration was 5M and 10M, the number of bacteria grown after electroporation of competent cells was better. The higher the electroporation efficiency, the more bacteria grew. When the sorbitol concentration was 5M and 10M, the electroporation efficiency was better than that of 2M sorbitol.
[0140] Comparative Example 1: Figure 9 As shown, the electrophoresis results of Comparative Example 1 are as follows Figure 1 As shown, the electrophoresis results of Example 1 are as follows Figure 2 As shown, Figure 1 and Figure 2 From left to right, the plasmids of generation P0, P1 and P2 after electroporation of the strain are shown. Compared with the number of bacteria grown in Example 1, the number of bacteria grown in Comparative Example 1 is similar. Accordingly, the electroporation efficiency of Example 1 and Comparative Example 1 is not much different, but Figure 1As the amplification generation increases to P2, the proportion of the recombinant bands marked by the red box is as high as more than 70%, and Figure 2 In the figure, as the amplification generation increased to P2, the recombination band marked by the red box was still below 10%, and no obvious recombination band was observed after multiple passages of the plasmid. This shows that under the premise of mutating the RecA13 site of the RecA gene and then mutating the RecA56 site, the cells obtained by the same electroporation competent cell preparation method can achieve the purpose of reducing plasmid recombination when amplifying the CRISPR library plasmid without affecting the electroporation efficiency.
[0141] The cultivation situation of comparative example 2 is as follows Figure 10 As shown, compared with Example 1, the method for preparing electrocompetent cells is different. Comparative Example 2 is a conventional glycerol treatment. Figure 6 In comparison, the number of grown bacteria is significantly lower than that in Example 1. It is known that the culture medium used has ampicillin resistance, which corresponds to the Amp resistance gene in the plasmid. The higher the electroporation efficiency, the greater the number of colonies. This shows that the electroporation efficiency of Comparative Example 2 is poor, and it is impossible to achieve good electroporation efficiency while reducing plasmid recombination.
[0142] The cultivation situation of comparative example 3 is as follows Figure 11 As shown, compared with Comparative Example 1, the method for preparing electrocompetent cells is different. Figure 11 The number of bacteria is not as good as Figure 9 , indicating that compared with conventional glycerol treatment, the preparation method of electroporated competent cells of the present invention can further improve the electroporation efficiency.
[0143] Depend on Figure 6-8 and Figure 2 It can be seen that the electroporation competent cells for amplifying CRISPR library plasmids prepared by this technical solution can reduce plasmid recombination and have good electroporation efficiency.
[0144] The technical principles of the present invention have been described above with reference to specific embodiments. These descriptions are intended solely to illustrate the principles of the present invention and are not to be construed in any way as limiting the scope of protection of the present invention. Based on the explanations herein, those skilled in the art will readily conceive of other specific embodiments of the present invention without inventive effort, and such embodiments will fall within the scope of protection of the present invention.
Claims
1. A method for preparing electrocompetent cells for amplifying CRISPR library plasmids, characterized in that: The following steps are involved: Step 1: Transform the CRISPR-B_CR plasmid into the host bacteria of the Escherichia coli Stbl series. The CRISPR-B_CR plasmid carries the Cas9 protein expression cassette. Cultivate the host bacteria containing the CRISPR-B_CR plasmid. Cultivate the host bacteria containing the CRISPR-B_CR plasmid to OD 600 The pH value is 0.4-0.8, and electrocompetent cells are prepared to obtain electrocompetent cells containing CRISPR-B_CR plasmid; Step 2: Based on the sequence of the RecA gene, a sgRNA sequence targeting the host bacteria and a homologous recombination template sequence were designed for point mutation of the RecA 56 gene. The sgRNA sequence was constructed into the CRISPR-B_G plasmid vector to obtain a CRISPR-B_G plasmid vector containing the desired sgRNA sequence; and a double-stranded DNA fragment CRISPR-B_D of the homologous recombination template sequence was synthesized; Step 3: Mix the double-stranded DNA fragments CRISPR-B_D and CRISPR-B_G plasmid vectors obtained in step 2 and the electroporated competent cells containing the CRISPR-B_CR plasmid obtained in step 1, transfer the mixed cell suspension to an electroporator for electroporation, and plate the electroporated bacterial solution for overnight culture. Use colony PCR to identify the strain that successfully obtained the RecA56 gene mutation. Based on the strain that obtained the RecA 56 gene mutation, culture it to OD 600 The pH value was 0.4-0.8, and electrocompetent cells were prepared to obtain electrocompetent cells for amplifying CRISPR library plasmids.
2. The method for preparing electrocompetent cells for amplifying CRISPR library plasmids according to claim 1, characterized in that: The mutation site of the host bacteria of the Escherichia coli Stbl series is RecA13, the sgRNA sequence targeting the host bacteria of the Escherichia coli Stbl series is GGGGCAGGTGGTCTGCCGAT, and the homologous recombination template sequence is shown in SEQ ID No. 1; In step 3, the mixed components are 0.5-3 μg of double-stranded DNA fragment CRISPR-B_D, 1-3 μg of CRISPR-B_G plasmid vector and 50-100 μL of electroporated competent cells containing CRISPR-B_CR plasmid.
3. The method for preparing electrocompetent cells for amplifying CRISPR library plasmids according to claim 1 or 2, characterized in that: In step 1 and step 3, preparing electrocompetent cells includes the following steps: S1. Cool the entire bacterial solution containing the desired strain on ice for 10-30 minutes and centrifuge to obtain the first precipitate; S2, pre-cooling a treatment solution containing 1-10 M sorbitol and 1-10 mM CaCl2, resuspending the first precipitate with the treatment solution, and centrifuging to obtain a second precipitate; S3, resuspend the second precipitate with 1-10 mM Hepes buffer and centrifuge to obtain a third precipitate; S4. Resuspend the third precipitate with 10-20% ultrapure glycerol and centrifuge to obtain a fourth precipitate; S5. Resuspend the fourth precipitate with ultrapure glycerol at a concentration of 10-20% to obtain the corresponding electroporation competent cells.
4. The method for preparing electrocompetent cells for amplifying CRISPR library plasmids according to claim 2, characterized in that: In step 3, the mixed components are 1-2ug of double-stranded DNA fragment CRISPR-B_D, 2ug of CRISPR-B_G plasmid, and 60-80uL of electroporated competent cells containing CRISPR-B_CR plasmid.
5. The method for preparing electrocompetent cells for amplifying CRISPR library plasmids according to claim 2, characterized in that: In step 1, the host bacteria containing CRISPR-B_CR plasmid were cultured at 30°C for 12-16 hours. 600 is 0.
6.
6. The method for preparing electrocompetent cells for amplifying CRISPR library plasmids according to claim 3, characterized in that: The centrifugation temperature in steps S1-S4 is 4°C, the rotation speed is 4000 rpm, and the time is 20 min.
7. The method for preparing electrocompetent cells for amplifying CRISPR library plasmids according to claim 1, characterized in that: In step 3, the voltage of the electroporator is 1-5 kV / cm.
8. An electroporated competent cell for amplifying a CRISPR library plasmid, characterized in that Prepared by the preparation method according to any one of claims 1 to 7.
Citation Information
Patent Citations
Re-engineering mediated site-directed mutagenesis method
CN102876623A
Method and system for detecting CRISPR / Cas PAM sequence in mammalian cells
CN110066852A
Bacterial CRISPR-Cas9 gene editing method and application
CN115976086A
Escherichia coli efficient transformation culture method
CN116536343A
Preparation and transformation method of competent cells for large-fragment vector construction
CN118028332A