SNP (Single Nucleotide Polymorphism) primer group for identifying east-west slope sub-populations of pinus pumila as well as identification method and application of SNP primer group

Abstract

The invention provides an SNP (Single Nucleotide Polymorphism) primer group for identifying a pinus speciosus east-west slope sub-population as well as an identification method and application of the SNP primer group, and belongs to the technical field of molecular markers. According to the invention, five SNP primer groups are designed aiming at five SNP loci of pinus parviflora. The SNP primer group comprises a first upstream primer, a second upstream primer and a downstream primer. The SNP primer group disclosed by the invention can be used for rapidly identifying the Xiaozhi pinus parviflora, has the advantages of accuracy, rapidness, low cost, short identification period, simplicity and convenience in operation and the like, and has important application value in the aspects of protection and management of germplasm resources of the Xiaozhi pinus parviflora.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, in particular to a SNP primer set for identifying the east and west slope subpopulations of Qiaojia five-needle pine, and an identification method and application thereof. Background Art

[0002] The Qiaojia five-needle pine (Pinus squamata XiangW.Li), scientifically known as the five-needle white pine, is an evergreen tree and a very small population plant of the Pinus group, white pine subgroup of the Pinus genus of the Pinaceae family (Pinacea). Currently, there are only 35 wild Qiaojia five-needle pine trees. There is only one wild population of Qiaojia five-needle pine, which can be divided into two subpopulations based on geographical distribution and genetic differentiation, called the east slope subpopulation and the west slope subpopulation. Over the past 30 years, certain achievements have been made in the protection of Qiaojia five-needle pine through artificial sowing and propagation, ex situ conservation, and return to the original habitat. However, in the conservation research of Qiaojia five-needle pine, a major challenge currently faced is how to efficiently distinguish the provenance of artificially propagated individuals (original populations on the east or west slope) when the seed source is unclear, so as to achieve precise protection of different genotypes and maintain genetic diversity in artificial protected areas. At present, this task relies on relatively expensive gene sequencing technology and lacks simple, economical and rapid alternative methods. Preventing inbreeding depression is a key issue in protecting extremely small populations of plants. However, no effective method has been found to efficiently distinguish different genotypes of Qiaojia five-needle pine.

[0003] Artificial propagation is considered an essential strategy for the conservation of Qiaojia five-needle pine. Currently, seedling production relies primarily on second-generation trees as provenance. However, the origins of these second-generation trees are often unclear, making provenance tracking and management difficult. Therefore, rapid and efficient genotyping techniques are crucial for determining provenance. Summary of the Invention

[0004] In view of this, the present invention provides a SNP primer set for identifying the east and west slope subpopulations of P. quinquefolia in Qiaojia, and an identification method and application thereof.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a SNP primer set for identifying the east and west slope subpopulation of Pinus truncatula L., wherein the SNP primer set comprises at least one of the following primer sets:

[0007] A first SNP primer set, used to amplify the first SNP site;

[0008] A second SNP primer set, used to amplify the second SNP site;

[0009] A third SNP primer set, used to amplify the third SNP site;

[0010] A fourth SNP primer set, used for amplifying the fourth SNP site;

[0011] The fifth SNP primer set is used to amplify the fifth SNP site;

[0012] The first upstream primer of the first SNP primer set is shown as SEQ ID NO. 1, the second upstream primer is shown as SEQ ID NO. 2, and the downstream primer is shown as SEQ ID NO. 3;

[0013] The first upstream primer of the second SNP primer set is shown as SEQ ID NO. 4, the second upstream primer is shown as SEQ ID NO. 5, and the downstream primer is shown as SEQ ID NO. 6;

[0014] The first upstream primer of the third SNP primer set is shown as SEQ ID NO. 7, the second upstream primer is shown as SEQ ID NO. 8, and the downstream primer is shown as SEQ ID NO. 9;

[0015] The first upstream primer of the fourth SNP primer set is shown as SEQ ID NO. 10, the second upstream primer is shown as SEQ ID NO. 11, and the downstream primer is shown as SEQ ID NO. 12;

[0016] The first upstream primer of the fifth SNP primer set is shown as SEQ ID NO.13, the second upstream primer is shown as SEQ ID NO.14, and the downstream primer is shown as SEQ ID NO.15.

[0017] Preferably, the 5' end of the first upstream primer is connected to a FAM fluorescent group tag sequence, and the 5' end of the second upstream primer is connected to a HEX fluorescent group tag sequence.

[0018] The present invention also provides a kit for identifying the SNPs of the east-west slope subpopulation of Pinus truncatula L. in Qiaojia, comprising the SNP primer set.

[0019] The present invention also provides a method for identifying the east-west slope subpopulation of Pinus truncatula, which is characterized by comprising the following steps:

[0020] S1. Extract genomic DNA from the tested Qiaojia five-needle pine samples;

[0021] S2. Using the genomic DNA of the tested Qiaojia five-needle pine sample as a template, competitive allele-specific PCR amplification was performed using the SNP primer set to obtain a PCR product;

[0022] S3. Genotyping and identification of the east and west slope subpopulations were performed based on fluorescence reading: if the fluorescence signal of the FAM group was read, it was determined to be the west slope subpopulation genotype (WW type); if the fluorescence signal of the HEX group was read, it was determined to be the east slope subpopulation genotype (EE type); if both HEX and FAM fluorescence signals were read, it was determined to be a heterozygous genotype (EW type).

[0023] Preferably, the reaction system for the competitive allele-specific PCR amplification is 10 μL: 1.2×v4 Flu-Arms Mix: 5 μL, 4.5 μL of genomic DNA of the Qiaojia five-needle pine sample to be tested, and 0.5 μL of mixed primers; the mixed primers consist of a first upstream primer, a second upstream primer and a downstream primer.

[0024] Preferably, the initial concentration of the primer mixture is 10 μM; the molar ratio of the first upstream primer, the second upstream primer and the downstream primer is 1:1:3.

[0025] Preferably, the reaction procedure of the competitive allele-specific PCR amplification is:

[0026] (1) Initial denaturation: 95°C for 10 min;

[0027] (2)2. Touchdown PCR cycle:

[0028] (2.1) 195°C, 15s;

[0029] (2.2) 61°C, 45 seconds;

[0030] (2.3) Repeat steps (2.1) and (2.2) for 10 cycles, decreasing the temperature by 0.6°C per cycle at 61°C.

[0031] (3) Conventional PCR cycle:

[0032] (3.1) 95°C, 15 seconds;

[0033] (3.2) 55°C, 45 seconds;

[0034] (3.3) Repeat steps 3.1 and 3.2 for a total of 36 cycles.

[0035] The present invention also provides the use of the SNP primer set in at least one of the following:

[0036] (1) Application in identifying or assisting in identifying the east and west slope subpopulations of Pinus quinquefolia;

[0037] (2) Application in the preparation of a kit for identifying the east-west slope subpopulation of Pinus quinquefolia;

[0038] (3) Application of molecular markers in the breeding of Qiaojia five-needle pine;

[0039] (4) Application in the protection of Qiaojia five-needle pine germplasm resources.

[0040] The present invention also provides the use of the kit in at least one of the following:

[0041] (1) Application in identifying or assisting in identifying the east and west slope subpopulations of Pinus quinquefolia;

[0042] (2) Application of molecular markers in the breeding of Qiaojia five-needle pine;

[0043] (3) Application in the protection of Qiaojia five-needle pine germplasm resources.

[0044] By adopting the above technical solution, the present invention has the following beneficial effects: the SNP primer set of the present invention can quickly identify the east and west slope subpopulations of Qiaojia five-needle pine, and has the advantages of accuracy, speed, low cost, short identification cycle, and simple operation. It has important application value in the protection and management of Qiaojia five-needle pine germplasm resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 This is a fluorescence scatter plot of SNP molecular marker genotyping of 12 samples in Example 3.

[0046] Figure 2 This is a fluorescence scatter plot of SNP molecular marker genotyping of the 54 tested Qiaojia five-needle pine ex situ populations in Example 4. DETAILED DESCRIPTION

[0047] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0048] Example 1. KASP primer development

[0049] The molecular marker development work used laboratory-stored samples of 33 native Qiaojia five-needle pine trees (numbered YS01 to YS33). These samples were collected in February 2023 from the Yaoshan National Nature Reserve in Qiaojia County, Zhaotong City, Yunnan Province. These 33 native Qiaojia five-needle pine trees were resequenced, the resulting raw sequences were quality-controlled, and the quality-controlled sequences were analyzed for variation to identify single-nucleotide polymorphisms (SNPs). Primers were designed for these identified SNPs.

[0050] Primer design principles:

[0051] 1. First, identify the target detection site and design an upstream typing primer on the left side of the site. The upstream typing primer should be about 24bp long.

[0052] 2. Add FAM and HEX adapter sequences to the 5' end of the designed upstream typing primer;

[0053] 3. Design the 3' end of the downstream common primer to avoid the SNP site base. The primer length is 29 bp. When synthesizing the downstream common primer, use the reverse complementary sequence.

[0054] 4. The length of the entire amplified product is 60 to 120 bp.

[0055] According to the above principles, the five sets of SNP primers designed are as follows:

[0056] The first SNP site is located on the chromosome >chr03:1894841732

[0057] SNP1-F1:

[0058] 5'- GAAGGTGACCAAGTTCATGCT AGAGTTTTTCTGGATCAACCTGAAG-3'(SEQID NO.1);

[0059] SNP1-F2:

[0060] 5'- GAAGGTCGGAGTCAACGGATT AGAGTTTTTCTGGATCAACCTGAAT-3'(SEQID NO.2);

[0061] SNP1-R: 5'-GTGAATCTGTGGAATCAAATAGTCTCCTC-3' (SEQ ID NO. 3).

[0062] The target fragment to be amplified is:

[0063] AGAGTTTTTCTGGATCAACCTGAAGTGGAACGAGGAGACTATTTGATTCCACAGATTCAC(SEQ IDNO.16);

[0064] AGAGTTTTTCTGGATCAACCTGAATTGGAACGAGGAGACTATTTGATTCCACAGATTCAC (SEQ ID NO. 17).

[0065] If the genotype is T:T, it is determined to be the genotype of the Dongpo subpopulation (EE type); if the genotype is T:G, it is determined to be a heterozygous genotype (EW type); if the genotype is G:G, it is determined to be the genotype of the Xipo subpopulation (WW type). Or HEX fluorescence is determined to be the genotype of the Dongpo subpopulation (EE type); the mixed fluorescence result of HEX and FAM is determined to be a heterozygous genotype (EW type); FAM fluorescence is determined to be the genotype of the Xipo subpopulation (WW type).

[0066] The second SNP site is located at >chr03:2067283962

[0067] SNP2-F1:5'- GAAGGTGACCAAGTTCATGCT CGACGATGTAGAGATGTTGAAGTTT-3'(SEQIDNO.4);

[0068] SNP2-F2:5'- GAAGGTCGGAGTCAACGGATT CGACGATGTAGAGATGTTGAAGTTA-3' (SEQ IDNO.5);

[0069] SNP2-R: 5'-GCATTGAGGCAAATAAGTGGGTTTTGTGG-3' (SEQ ID NO. 6);

[0070] The target fragment to be amplified is:

[0071] CGACGATGTAGAGATGTTGAAGTTTTCCCAACCCACAAAACCCACTTATTTGCCTCAATGC (SEQ ID NO. 18);

[0072] CGACGATGTAGAGATGTTGAAGTTATCCCAACCCACAAAACCCACTTATTTGCCTCAATGC (SEQ ID NO. 19).

[0073] Genotype A:A was determined to be the genotype of the eastern slope subpopulation (EE type); genotype A:T was determined to be the heterozygous genotype (EW type); genotype T:T was determined to be the genotype of the western slope subpopulation (WW type). Alternatively, HEX fluorescence was determined to be the genotype of the eastern slope subpopulation (EE type); the mixed HEX and FAM fluorescence results were determined to be the heterozygous genotype (EW type); and FAM fluorescence was determined to be the genotype of the western slope subpopulation (WW type).

[0074] The third SNP site is located on chromosome chr04:2281349986

[0075] SNP3-F1:5'- GAAGGTGACCAAGTTCATGCT CAAATGTCTGTAAGAGACACAGTTG-3'(SEQ IDNO.7);

[0076] SNP3-F2:5'- GAAGGTCGGAGTCAACGGATT CAAATGTCTGTAAGAGACACAGTTT-3'(SEQ IDNO.8);

[0077] SNP3-R: 5'-TCTTGGTTAATCCAACAATCATTGCATTC-3' (SEQ ID NO. 9).

[0078] The target fragment to be amplified is:

[0079] CAAATGTCTGTAAGAGACACAGTTGCGTGGAATGCAATGATTGTTGGATTAACCAAGA (SEQ ID NO. 20);

[0080] CAAATGTCTGTAAGAGACACAGTTTCGTGGAATGCAATGATTGTTGGATTAACCAAGA (SEQ ID NO. 21).

[0081] Genotype T:T was determined to be the genotype of the eastern slope subpopulation (EE type); genotype T:G was determined to be the heterozygous genotype (EW type); genotype G:G was determined to be the genotype of the western slope subpopulation (WW type). Alternatively, HEX fluorescence was determined to be the genotype of the eastern slope subpopulation (EE type); the mixed HEX and FAM fluorescence results were determined to be the heterozygous genotype (EW type); and FAM fluorescence was determined to be the genotype of the western slope subpopulation (WW type).

[0082] The fourth SNP site is located on chromosome chr06:2125520768

[0083] SNP4-F1:5'- GAAGGTGACCAAGTTCATGCT AAGGTGGAATCACGAGATAAGAAAT-3'(SEQ IDNO.10);

[0084] SNP4-F1:5'- GAAGGTCGGAGTCAACGGATT AAGGTGGAATCACGAGATAAGAAAG-3' (SEQ ID NO. 11);

[0085] SNP4-R: 5'-AATATTAGGTTGGTCATCGACCTGACAAG-3' (SEQ ID NO. 12).

[0086] The target fragment to be amplified is:

[0087] AAGGTGGAATCACGAGATAAGAAATTGGATACTTGTCAGGTCGATGACCAACCTAATATT (SEQ ID NO. 22);

[0088] AAGGTGGAATCACGAGATAAGAAAGTGGATACTTGTCAGGTCGATGACCAACCTAATATT (SEQ ID NO. 23).

[0089] Genotype G:G was determined to be the genotype of the eastern slope subpopulation (EE type); genotype G:T was determined to be the heterozygous genotype (EW type); genotype T:T was determined to be the genotype of the western slope subpopulation (WW type). Alternatively, HEX fluorescence was determined to be the genotype of the eastern slope subpopulation (EE type); the mixed HEX and FAM fluorescence results were determined to be the heterozygous genotype (EW type); and FAM fluorescence was determined to be the genotype of the western slope subpopulation (WW type).

[0090] The location of the fifth SNP site on chromosome is >chr07:365412684

[0091] SNP5-F1:5'- GAAGGTGACCAAGTTCATGCT AAACACACTAAAATGGAGTTACCAC-3'(SEQ ID NO.13);

[0092] SNP5-F2:5'- GAAGGTCGGAGTCAACGGATT AAACACACTAAAATGGAGTTACCAG-3' (SEQ ID NO. 14);

[0093] SNP5-R: 5'-TCGAGAAGCATCTCCTTCTCTTCGATCTC-3' (SEQ ID NO. 15).

[0094] The target fragment to be amplified is:

[0095] AAACACACTAAAATGGAGTTACCACGCTATGGAGATCGAAGAGAAGGAGATGCTTCTCGA (SEQ ID NO. 24);

[0096] AAACACACTAAAATGGAGTTACCAGGCTATGGAGATCGAAGAGAAGGAGATGCTTCTCGA (SEQ ID NO. 25).

[0097] Genotype G:G was determined to be the genotype of the eastern slope subpopulation (EE type); genotype G:C was determined to be the heterozygous genotype (EW type); genotype C:C was determined to be the genotype of the western slope subpopulation (WW type). Alternatively, HEX fluorescence was determined to be the genotype of the eastern slope subpopulation (EE type); the mixed HEX and FAM fluorescence results were determined to be the heterozygous genotype (EW type); and FAM fluorescence was determined to be the genotype of the western slope subpopulation (WW type).

[0098] In the above primer set, the underlined portion of the first upstream primer is a FAM fluorescent group tag sequence, and the underlined portion of the second upstream primer is a HEX fluorescent group tag sequence.

[0099] Example 2. Genotyping of Pinus truncatulae using KASP primers

[0100] Experimental materials: Fresh needle tissue samples of the second and third generations of Qiaojia five-needle pine were selected. The second-generation samples were collected from the botanical garden of the Kunming Institute of Botany, and the third-generation samples were collected from the nursery. A total of 17 samples were stored in 2mL centrifuge tubes.

[0101] The first step is to extract RNA:

[0102] 1. Grind the leaves of Pinus truncatulae in liquid nitrogen and collect ≤100 mg of plant sample into a centrifuge tube. Add 500 μL RBBuffer / 10 μL β-mercaptoethanol and immediately vortex to mix.

[0103] 2. Place the gDNAFilter column into a 2 mL collection tube, transfer the mixture to the gDNAFilter column, and centrifuge at 14,000 g for 5 minutes at room temperature.

[0104] 3. Transfer the filtrate to a new 1.5 mL centrifuge tube, add 0.5 times the volume of anhydrous ethanol, and vortex at high speed for 20 seconds to mix. If there is precipitation, aspirate 10-15 times with a pipette;

[0105] 4. Place the HiBind R RNA Mini Binding Column into a 2 mL collection tube, transfer 700 μL of the mixture from step 3 to the HiBind R RNA Mini Binding Column, centrifuge at 12,000 x g for 1 min at room temperature, and discard the filtrate.

[0106] 5. Repeat step 4 until all the mixed solution has been transferred through the column;

[0107] 6. Place the HiBind B RNAMini binding column into the same 2 mL collection tube, add 400 μL RWF Wash Buffer, centrifuge at 10,000 x g for 30 seconds at room temperature, and discard the filtrate.

[0108] 7. Place the HiBind RRNA Mini Binding Column into the same 2 mL collection tube, add 500 μL RNA Wash Buffer III (previously diluted with anhydrous ethanol), centrifuge at 10,000 x g for 30 seconds at room temperature, and discard the filtrate.

[0109] 8. Repeat step 7;

[0110] 9. Place the HiBind RRNAMini Binding Column into the same 2 mL collection tube and centrifuge at maximum speed for 2 minutes at room temperature to dry the HiBind R RNAMini Binding Column matrix.

[0111] 10. Place the HiBind R RNA Mini Binding Column in a new 1.5 mL centrifuge tube, take 50-100 μL of DEPC Water, and accurately add it to the center of the HiBind R RNA Mini Binding Column membrane. Incubate at room temperature for 2 minutes, and centrifuge at 10,000 × g for 1 minute at room temperature to elute the RNA.

[0112] 11. Nanodrop, Qbuit and electrophoresis quality inspection.

[0113] Step 2: RNA quality testing:

[0114] The purity of the samples was detected using a NanoPhotometer spectrophotometer (IMPLEN, CA, USA);

[0115] The integrity of RNA samples was detected using the Agilent 2100 RNA Nano 6000 Assay Kit (Agilent Technologies, CA, USA).

[0116] In this invention, the quality and purity of the RNA samples of the Qiaojia five-needle pine germplasm resources tested must meet the requirements for subsequent reverse transcription and PCR (RT-qPCR) typing. The specific standards are as follows:

[0117] The extracted total RNA samples were subjected to strict quality control before being used in subsequent genotyping experiments. The RNA concentration was determined using a Qubit 3.0 fluorescent quantitative instrument (Life Technologies, Carlsbad, CA, USA), and the qualified standard was set at ≥50 ng / μL to ensure sufficient starting amount for the subsequent reverse transcription reaction. The purity of the RNA samples was assessed using a NanoDrop One Spectrophotometer (NanoDrop Technologies, Wilmington, DE) by measuring their A260 / A280 and A260 / A230 ratios. The qualified A260 / A280 ratio should be between 1.8 and 2.2, and the A260 / A230 ratio should be between 1.8 and 2.5 to exclude the potential inhibitory effects of proteins, salt ions or organic solvent residues on downstream enzymatic reactions. RNA integrity is crucial for successful genotyping experiments. Therefore, all RNA samples used for genotyping were evaluated using an Agilent 2100 Bioanalyzer, with a RIN (RNA Integrity Number) value of ≥7.0 required to ensure RNA sample integrity and facilitate accurate reverse transcription and subsequent typing reactions. Furthermore, to completely eliminate the interference of genomic DNA contamination on typing results, a no-reverse transcriptase (No-RT) control was included with each RNA sample for qPCR testing. The acceptance criteria for the No-RT control were the absence of amplification signals within 40 cycles, ensuring that the detected typing signals were specifically derived from cDNA reverse-transcribed from the RNA.

[0118] Step 3: Construction and preparation of the library

[0119] After the samples passed the test, 1-2 μg of total RNA was used as the starting material to construct the transcriptome sequencing library. Different index tags were selected for library construction according to the instructions of the VAHTS Universal V6 RNA-seq Library Prep Kit for Ilumina⑧ (NR604-01 / 02).

[0120] For qualified Total RNA samples, eukaryotic mRNA is enriched using magnetic beads with Oligo(dT). Fiagmentation buffer is then added to break the mRNA into short fragments. Using the mRNA as a template, random hexamers are used to synthesize single-strand cDNA. Buffer, dNTPs, RNase H, and DNA polymerase I are then added to synthesize second-strand cDNA. The double-stranded cDNA is then purified using AMPure Pbeads or the QiaQuick PCR kit. The purified double-stranded cDNA is then end-repaired, A-tailed, and ligated with sequencing adapters. Fragment size selection is then performed, and finally, PCR enrichment is performed to obtain the final cDNA library.

[0121] Step 4: Inventory Inspection

[0122] After the library construction is completed, Qubit3.0 is used for preliminary quantification, and the library is diluted to 1 ng / ul. Then, the insert size of the library is detected using Agilent 2100. If the insert size meets the expectation, Q-PCR is performed using Bio-RAD CFX96 fluorescence quantitative PCR instrument and Bio-RAD KITiQSYBR GRN to accurately quantify the effective concentration of the library (library effective concentration >10nM) to ensure the quality of the library.

[0123] Step 5: Clustering and sequencing

[0124] Clustering and sequencing were performed on the DNBSEQ-T7 platform using the DNBSEQ-T7RS high-throughput sequencing kit (FCL PE100) V3.0. The paired-end sequencing program (PE) was run to obtain 150 bp paired-end sequencing reads.

[0125] Step 6: Process sequencing data:

[0126] Raw data control: filter low-quality read data;

[0127] Data preprocessing: READ comparison, followed by sorting and deduplication, followed by local reprocessing and base quality correction;

[0128] Variant detection: detect variants, then perform quality control and filtering;

[0129] In the seventh step, gene sequencing was performed to analyze the variation and obtain the genotyping results, as shown in Table 1.

[0130] Table 1 Genotyping results

[0131] Sample number Typing results Sample number Typing results GL01 EE FHB070a EW GL02 WW FHB070b EW GL03 WW SXK040a EW GL04 EE SXK040b EW GL05 EE SXK066a EW GL06 EE SXK066b EW GL07 WW SXK073a EW FHB020a EW SXK073b EW FHB020b EW

[0132] Note: WW is the west slope subpopulation, EE is the east slope subpopulation, and EW is a heterozygote

[0133] Example 3. Validation of SNP primers in samples with known genotypes

[0134] The primers of the present invention were used to amplify the second-generation homozygous sample (sample number: GL01-07) and the third-generation heterozygous samples (FHB020a, FHB070a, SXK040a, SXK066a, SXK073a) of the Qiaojia five-needle pine with known genotypes in Example 2 in a PCR reaction. The steps are as follows:

[0135] 1. The CTAB method was used to extract DNA from seven samples of Pinus truncatula GL01-07 to obtain genomic DNA of the seven samples;

[0136] 2. Competitive allele-specific PCR amplification was performed using genomic DNA from seven P. qiaojiaensis strains as templates and five primer sets, respectively, to obtain PCR amplification products. A non-template control (NTC) group was also established, without the addition of reaction template, as a control. The reaction system is shown in Table 2.

[0137] Table 2 Reaction system

[0138]

[0139]

[0140] In each PCR reaction system, the concentration ratio of the first upstream primer, the second upstream primer, and the downstream primer was 1:1:3.

[0141] PCR reaction procedure:

[0142] 1. Initial denaturation: 95°C for 10 min.

[0143] 2. Touchdown PCR cycle:

[0144] 1) 95°C, 15s;

[0145] 2) 61°C, 45 seconds;

[0146] 3) Repeat the above steps for 10 cycles, with the temperature at 61°C decreasing by 0.6°C per cycle.

[0147] 3. Conventional PCR cycle:

[0148] 1) 95°C, 15s;

[0149] 2) 55°C, 45 seconds;

[0150] 3) Repeat the above steps for 36 cycles.

[0151] 4. Fluorescence reading: When the temperature of the PCR amplification product drops below 40°C, the fluorescence value is read by scanning the FAM and HEX beams of the microplate reader (the FAM fluorescent tag sequence is observed and read at an excitation light of 485 nm and an emission light of 520 nm, and the HEX fluorescent tag sequence is observed and read at an excitation light of 528 nm and an emission light of 560 nm). The genotype of the 12 tested Qiaojia pine germplasm resources based on each SNP site is determined according to the color of the fluorescent signal.

[0152] The specific judgment principles are as follows:

[0153] The 5' end of the first upstream primer carries a FAM fluorescent tag sequence, and the amplified fragment thereof can read the fluorescent signal of the FAM group using a microplate reader or a fluorescent quantitative PCR instrument, and the fluorescent signal of the FAM fluorescent tag sequence is green; the 5' end of the second upstream primer carries a HEX fluorescent tag sequence, and the amplified fragment thereof can read the fluorescent signal of the HEX group using a microplate reader or a fluorescent quantitative PCR instrument, and the fluorescent signal of the HEX fluorescent tag sequence is yellow or orange.

[0154] If the fluorescent quantitative PCR instrument detects the green fluorescent signal of the FAM fluorescent group, the tested Qiaojia five-needle pine germplasm resource is homozygous and belongs to the Xipo subpopulation (WW type);

[0155] If the fluorescent quantitative PCR instrument detects yellow or orange fluorescence signals of the HEX fluorescent group, the tested Qiaojia five-needle pine germplasm resource is homozygous and belongs to the Dongpo subpopulation (EE type);

[0156] If the fluorescence quantitative PCR instrument detects two colors of fluorescence signals, FAM and HEX, the genotype of the tested Qiaojia five-needle pine germplasm resource based on the SNP site is a heterozygous type (EW type).

[0157] Step 3: Analyze the PCR results: Use the HEX (East Slope EE) and FAM (West Slope WW) fluorescence values ​​to establish a coordinate system and create a picture. The genotype close to the X axis is the West Slope genotype, the genotype close to the Y axis is the East Slope genotype, and the genotype on the diagonal is the heterozygous genotype. According to the picture, the fluorescence category of each sample is statistically analyzed. The results are shown in Table 3. The identified genotypes are shown in Table 4. The fluorescence scatter plot of SNP molecular marker genotyping is shown in Figure 1 shown.

[0158] Table 3 Fluorescence types of each sample

[0159]

[0160] Note: FAM / HEX means both FAM and HEX fluorescence signals were detected

[0161] Table 4 Genotype identification results of each sample

[0162]

[0163]

[0164] Note: WW is the west slope subpopulation, EE is the east slope subpopulation, and EW is a heterozygote

[0165] If HEX fluorescence is read in the amplified product, it is determined to be the Dongpo subpopulation (EE type); if FAM fluorescence is read in the amplified product, it is determined to be the Xipo subpopulation (WW type). Figure 1 Judging from the SNP molecular marker genotyping fluorescence scatter plot, the amplification and identification results of the 12 Qiaojia pine samples can match those of the known genotype samples.

[0166] Example 4. Identification of existing Qiaojia five-needle pine germplasm resources using SNP primers

[0167] In this example, 54 high-quality germplasm resources of the ex situ population of Pinus truncatula were used to test the effectiveness of the SNP primer combination developed in Example 1. The sample sources and genotype identification results are shown in Table 5.

[0168] Table 5 Identification results of 54 subpopulations of Pinus truncatulae on the east and west slopes tested

[0169]

[0170]

[0171]

[0172] Note: WW is the west slope subpopulation, EE is the east slope subpopulation, and EW is a heterozygote.

[0173] As can be seen from the above examples, the present invention provides a SNP primer set for identifying the east and west slope subpopulations of P. truncatum L. in Qiaojia County, as well as its identification method and application. The SNP primer set of the present invention can realize the identification of the east and west slope subpopulations of P. truncatum L. in Qiaojia County.

[0174] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A SNP primer set for identifying the east-west slope subpopulation of Pinus quinquefolia in Qiaojia, characterized in that: The SNP primer set includes at least one of the following primer sets: A first SNP primer set, used to amplify the first SNP site; A second SNP primer set, used to amplify the second SNP site; A third SNP primer set, used to amplify the third SNP site; A fourth SNP primer set, used for amplifying the fourth SNP site; The fifth SNP primer set is used to amplify the fifth SNP site; The first upstream primer of the first SNP primer set is shown as SEQ ID NO. 1, the second upstream primer is shown as SEQ ID NO. 2, and the downstream primer is shown as SEQ ID NO. 3; The first upstream primer of the second SNP primer set is shown as SEQ ID NO. 4, the second upstream primer is shown as SEQ ID NO. 5, and the downstream primer is shown as SEQ ID NO. 6; The first upstream primer of the third SNP primer set is shown in SEQ ID NO. 7, the second upstream primer is shown in SEQ ID NO. 8, and the downstream primer is shown in SEQ ID NO. 9; The first upstream primer of the fourth SNP primer set is shown as SEQ ID NO. 10, the second upstream primer is shown as SEQ ID NO. 11, and the downstream primer is shown as SEQ ID NO. 12; The first upstream primer of the fifth SNP primer set is shown as SEQ ID NO.13, the second upstream primer is shown as SEQ ID NO.14, and the downstream primer is shown as SEQ ID NO.

15.

2. The SNP primer set according to claim 1, wherein The 5' end of the first upstream primer is connected to a FAM fluorescent group tag sequence, and the 5' end of the second upstream primer is connected to a HEX fluorescent group tag sequence.

3. A kit for identifying SNPs in the East and West slope subpopulations of Pinus quinquefolia, characterized in that: Comprising the SNP primer set according to claim 1 or 2.

4. A method for identifying the east-west slope subpopulation of Pinus truncatula, characterized in that: The following steps are involved: S1. Extract genomic DNA from the tested Qiaojia five-needle pine samples; S2. Using the genomic DNA of the Qiaojia five-needle pine sample to be tested as a template, competitive allele-specific PCR amplification was performed using the SNP primer set according to claim 1 or 2 to obtain a PCR product; S3. Genotyping and identification of the east and west slope subpopulations were performed based on the fluorescence signals from the PCR products: if the fluorescence signal from the FAM group was read, the genotype was determined to be that of the west slope subpopulation; if the fluorescence signal from the HEX group was read, the genotype was determined to be that of the east slope subpopulation; if both HEX and FAM fluorescence signals were read, the genotype was determined to be heterozygous.

5. The identification method according to claim 4, characterized in that The reaction system for the competitive allele-specific PCR amplification is 10 μL: 1.2×v4 Flu-Arms Mix: 5 μL, 4.5 μL of genomic DNA of the Qiaojia five-needle pine sample to be tested, and 0.5 μL of mixed primers; the mixed primers consist of a first upstream primer, a second upstream primer, and a downstream primer.

6. The identification method according to claim 5, characterized in that The initial concentration of the mixed primer is 10 μM; the molar ratio of the first upstream primer, the second upstream primer and the downstream primer is 1:1:

3.

7. The identification method according to claim 6, characterized in that The reaction procedure of the competitive allele-specific PCR amplification is: (1) Initial denaturation: 95°C for 10 min; (2)2. Touchdown PCR cycle: (2.1)195℃，15s； (2.2)61℃，45s； (2.3) Repeat steps (2.1) and (2.2) for 10 cycles, decreasing the temperature by 0.6°C per cycle at 61°C. (3) Conventional PCR cycle: (3.1)95℃，15s； (3.2)55℃，45s； (3.3) Repeat steps 3.1 and 3.2 for a total of 36 cycles. (4) Fluorescence reading: 30°C, 30 seconds.

8. Use of the SNP primer set according to claim 1 or 2 in at least one of the following: (1) Application in identifying or assisting in identifying the east and west slope subpopulations of Pinus quinquefolia; (2) Application in the preparation of a kit for identifying the east-west slope subpopulation of Pinus quinquefolia; (3) Application of molecular markers in the breeding of Qiaojia five-needle pine; (4) Application in the protection of Qiaojia five-needle pine germplasm resources.

9. Use of the kit according to claim 3 in at least one of the following: (1) Application in identifying or assisting in identifying the east and west slope subpopulations of Pinus quinquefolia; (2) Application of molecular markers in the breeding of Qiaojia five-needle pine; (3) Application in the protection of Qiaojia five-needle pine germplasm resources.

Images