Application of isodan leaf emodin in preparation of medicine for treating rheumatoid arthritis

Abstract

The invention discloses an application of isodan leaf emodin in preparation of a medicine for treating rheumatoid arthritis. The invention finds that the isodan-leaf emodin can be used for treating rheumatoid arthritis, and researches show that the isodan-leaf emodin reduces the expression of farnesyl pyrophosphate synthase in fibroblast-like synovial cells of rheumatoid arthritis so as to down-regulate the activity of AKT and ERK1 / 2 signaling pathways and reduce the expression of IL-6, IL-8 and MMP3, so that the rheumatoid arthritis can be treated by the isodan-leaf emodin. The proliferation and migration invasion ability of rheumatoid arthritis fibroblast-like synovial cells is inhibited, so that synovitis and joint injury are relieved, and the purpose of treating rheumatoid arthritis is achieved. Meanwhile, the expression level of the farnesyl pyrophosphate synthase in the rheumatoid arthritis fibroblast-like synovial cells is obviously increased, and the treatment effect can be achieved by inhibiting the expression of the farnesyl pyrophosphate synthase. Therefore, the invention provides the application of the isodan leaf emodin and the farnesyl pyrophosphate synthase in the treatment of the rheumatoid arthritis, and more choices are provided for the clinical treatment of the rheumatoid arthritis.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and in particular relates to the application of isodanin in the preparation of a medicine for treating rheumatoid arthritis. Background Art

[0002] Rheumatoid arthritis (RA) is a chronic autoimmune disease of unknown etiology, characterized by chronic, symmetrical, peripheral polyarthritis. RA is characterized by pathological features of synovial hyperplasia, synovial inflammation, and pannus formation, accompanied by cartilage and bone destruction. Epidemiological surveys indicate that the global prevalence of RA is approximately 0.5%-1.0%. In the early stages of the disease, RA patients experience joint pain and swelling. As the disease progresses, severe cases can lead to joint deformity and loss of function, significantly reducing patients' quality of life and imposing significant social and economic burdens. RA can also affect multiple systemic diseases, including the respiratory, cardiovascular, digestive, and hematologic systems. The pathogenesis of RA is complex and remains incompletely understood. In recent years, numerous studies have revealed that fibroblast-like synoviocytes (FLS) play a key role in the development of RA, acting as key effector cells for synovial hyperplasia and bone erosion in RA. In the inflammatory environment of the rheumatoid arthritis synovium, rheumatoid arthritis fibroblast-like synoviocytes remain in a highly activated state and exhibit a unique, aggressive, tumor-like phenotype, including excessive proliferation, resistance to apoptosis, a pronounced inflammatory response, and enhanced migration and invasion. Therefore, therapeutic strategies targeting rheumatoid arthritis fibroblast-like synoviocytes may effectively alleviate joint destruction while avoiding the adverse effects of systemic immunosuppression. This strategy may provide new insights into the treatment of rheumatoid arthritis.

[0003] Currently, common medications for rheumatoid arthritis treatment include glucocorticoids, nonsteroidal anti-inflammatory drugs (NSAIDs), and disease-modifying antirheumatic drugs (DADAs). Despite significant progress in treatments for rheumatoid arthritis, the high heterogeneity among patients, with some experiencing drug intolerance or poor efficacy, hinders their clinical application. Therefore, the search for alternative safe and effective treatments holds significant theoretical and practical value. The article "Isodan-emodin Inhibits IL-1β-Induced Inflammation and Cartilage Matrix Destruction in Rat Chondrocytes" suggests that isodan-emodin could be used to treat osteoarthritis. Osteoarthritis is a slowly progressive senile disease characterized by joint pain and limb movement disorders caused by various factors. Its onset is closely linked to inflammatory responses and cartilage matrix destruction. Rheumatoid arthritis primarily affects the synovium of the joints. Long-term inflammation leads to synovial hyperplasia and thickening, gradually eroding the articular cartilage. This process is essentially a digestion of the interstitial tissue by proteases. Therefore, although the article points out that isodanin can be used to treat osteoarthritis, there is currently no report that isodanin can be used to treat rheumatoid arthritis, and there is no report on the mechanism of isodanin in treating rheumatoid arthritis. Summary of the Invention

[0004] The purpose of the present invention is to overcome the above-mentioned defects and deficiencies in the prior art and to provide an application of isodanin in the preparation of a medicine for treating rheumatoid arthritis.

[0005] The second object of the present invention is to provide a use of a farnesyl pyrophosphate synthase inhibitor in the preparation of a medicament for treating rheumatoid arthritis.

[0006] The third object of the present invention is to provide the use of farnesyl pyrophosphate synthase as a diagnostic target for rheumatoid arthritis in the preparation of products for diagnosing rheumatoid arthritis.

[0007] A fourth object of the present invention is to provide use of a reagent for detecting the expression level of farnesyl pyrophosphate synthase in the preparation of a product for diagnosing rheumatoid arthritis.

[0008] The above-mentioned object of the present invention is achieved through the following technical solutions:

[0009] The present invention discovers that isorhapontigenin (ISO) can be used to treat rheumatoid arthritis. An investigation into its mechanism of action reveals that isorhapontigenin reduces the expression of farnesyl diphosphate synthase (FDPS, Gene ID: 2224) in rheumatoid arthritis fibroblast-like synoviocytes, thereby downregulating the activity of the AKT and ERK1 / 2 signaling pathways, ultimately inhibiting the proliferation and migration and invasion capabilities of rheumatoid arthritis fibroblast-like synoviocytes, and reducing the expression of IL-6, IL-8, and MMP3, thereby alleviating synovitis and joint damage, thereby achieving the purpose of treating rheumatoid arthritis. Further research revealed that farnesyl pyrophosphate synthase (FPS) expression is significantly elevated in RA fibroblast-like synoviocytes and synovial tissue, as well as in the synovial tissue of arthritis mice. Inhibiting FPS expression alone can also downregulate the activity of the AKT and ERK1 / 2 signaling pathways, ultimately inhibiting the proliferation, migration, and invasion of RA fibroblast-like synoviocytes and reducing the expression of IL-6, IL-8, and MMP3, thereby achieving the goal of treating RA. These results suggest that not only isodanin can be used to treat RA, but FPS can also serve as a diagnostic marker and therapeutic target for RA, providing more options for the clinical treatment of RA.

[0010] Therefore, the present invention provides the use of isodanin in preparing medicine for treating rheumatoid arthritis.

[0011] Furthermore, the isodanin is used at a concentration of 12.5 to 50 μM.

[0012] The present invention also provides use of the farnesyl pyrophosphate synthase inhibitor in preparing medicine for treating rheumatoid arthritis.

[0013] Furthermore, the treatment inhibits the proliferation, migration, and invasion of rheumatoid arthritis fibroblast-like synoviocytes, inhibits the expression of cellular inflammatory factors IL-6, IL-8 and matrix metalloproteinase MMP3, and inhibits one or more of the phosphorylation of ERK1 / 2 and AKT signaling pathways.

[0014] Furthermore, the inhibitor is isodanin. The present invention has found that isodanin can treat rheumatoid arthritis by inhibiting the expression of farnesyl pyrophosphate synthase.

[0015] Furthermore, the inhibitor is a small interfering RNA, including siRNA-2 and siRNA-3, and the nucleotide sequences thereof are shown in SEQ ID No. 1 to 2, respectively.

[0016] The present invention also provides the use of farnesyl pyrophosphate synthase as a diagnostic target for rheumatoid arthritis in the preparation of a product for diagnosing rheumatoid arthritis.

[0017] The present invention also provides use of a reagent for detecting the expression level of farnesyl pyrophosphate synthase in preparing a product for diagnosing rheumatoid arthritis.

[0018] Furthermore, the reagent for detecting the expression level of farnesyl pyrophosphate synthase is an antibody, a primer, a probe or a combination thereof. The expression levels of farnesyl pyrophosphate synthase mRNA and protein in rheumatoid arthritis fibroblast-like synoviocytes are higher than those in normal human fibroblast-like synoviocytes.

[0019] Preferably, the primers are real-time fluorescence quantitative PCR primers, and their nucleotide sequences are shown in SEQ ID No. 3-4.

[0020] Preferably, the antibody is a farnesyl pyrophosphate synthase-specific antibody.

[0021] Furthermore, the product is a test kit, a chip or a test paper.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The present invention provides the use of isodanin and farnesyl pyrophosphate synthase in the preparation of a medicament for treating rheumatoid arthritis. The present invention finds that isodanin can be used to treat rheumatoid arthritis. Further studies have shown that isodanin reduces the expression of farnesyl pyrophosphate synthase in rheumatoid arthritis fibroblast-like synoviocytes, thereby downregulating the activity of the AKT and ERK1 / 2 signaling pathways, reducing the expression of IL-6, IL-8, and MMP3, and inhibiting the proliferation, migration, and invasion of rheumatoid arthritis fibroblast-like synoviocytes, thereby alleviating synovitis and joint damage, thereby achieving the purpose of treating rheumatoid arthritis. At the same time, it was also found that the expression level of farnesyl pyrophosphate synthase in rheumatoid arthritis fibroblast-like synoviocytes was significantly increased, and inhibiting its expression can also achieve a therapeutic effect. Therefore, the present invention provides the use of isodanin and farnesyl pyrophosphate synthase in the treatment of rheumatoid arthritis, providing more options for the clinical treatment of rheumatoid arthritis. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The effects of different concentrations of isobutyric acid (ISO) on the activity and apoptosis of rheumatoid arthritis fibroblast-like synoviocytes (RA FLS). Figure 1 A is the CCK8 assay for RA FLS activity; B is the representative graph and statistical graph for flow cytometry detection of cell apoptosis.

[0025] Figure 2The effects of different concentrations of ISO on the proliferation of RA FLS, inflammatory factors and MMPs expression levels. Figure 2 Figure A shows representative images and statistical graphs of the EdU proliferation assay; Figure B shows mRNA expression levels of inflammatory factors and MMPs in RA FLS. *: Compared with the DMSO group, *P < 0.05, **P < 0.01, ***P < 0.001. #: Compared with the DMSO + TNF-α group, #P < 0.05, ##P < 0.01, ###P < 0.001.

[0026] Figure 3 The effects of different concentrations of ISO on the migration and invasion of RA FLS. Figure 3 A shows representative images and statistical graphs of the Transwell migration assay; B shows representative images and statistical graphs of the Transwell invasion assay. *: Compared with the DMSO group, *P < 0.05, **P < 0.01, ***P < 0.001.

[0027] Figure 4 RNA-seq was used to screen the potential downstream targets of ISO in RA FLS (using RNA-seq to detect the differentially expressed genes in RA FLS after treatment with ISO (50 μM) or DMSO). Figure 4 Figure A shows a volcano plot of differentially expressed genes, with a screening threshold of P < 0.05 and |Fold Change| ≥ 2. Figure B shows the results of Reactome enrichment analysis of differentially expressed genes. Figure C shows the mRNA level of farnesyl pyrophosphate synthase (FDPS) in RA FLS. Figure D shows the protein level of FDPS in RA FLS. *: Compared with the DMSO group. ***: P < 0.001.

[0028] Figure 5 is the expression level of FDPS in synovium. Figure 5 Figure A shows the statistical expression of FDPS mRNA in FLS of RA patients and healthy controls; Figure B shows the representative and statistical graphs of farnesyl pyrophosphate synthase (FDPS) protein expression in FLS of RA patients and healthy controls; Figure C shows the expression of FDPS in synovial tissue of RA patients and healthy controls. *: indicates comparison with the healthy control group, *P < 0.05, **P < 0.01.

[0029] Figure 6 The effect of ISO on collagen-induced arthritis mouse model. Figure 6Figure (A) shows the appearance of ankle joints in the normal control, DMSO, and ISO groups; (B) shows the clinical symptom scores of arthritis in the DMSO and ISO groups; (C) shows representative images of joint tissue sections stained with hematoxylin-eosin and safranin O-fast green in the DMSO and ISO groups; (D) shows the scores for inflammatory infiltration, synovial hyperplasia, cartilage erosion, and bone destruction in the joints of the DMSO and ISO groups. *: Compared with the DMSO group, *P < 0.05, **P < 0.01.

[0030] Figure 7 The expression of FDPS in the synovial tissue of the mouse model was detected by immunohistochemistry. The expression levels of FDPS in the synovial tissue of the normal control group, DMSO group, and ISO group mice were detected.

[0031] Figure 8 The safety of ISO in a collagen-induced arthritis mouse model. Figure 8 A shows the weight changes of mice in the DMSO group and the ISO group; B shows the biochemical indicators of mice in the DMSO group and the ISO group; C shows the hematoxylin-eosin staining of liver and kidney tissue sections of mice in the DMSO group and the ISO group, comparing the changes in liver and kidney tissue structure of the two groups of mice.

[0032] Figure 9 is the knockdown efficiency of FDPS siRNA. Figure 9 A represents knockdown efficiency at the mRNA level; B and C represent representative and statistical graphs of knockdown efficiency at the protein level. *: Comparison with the siC group, **P < 0.01.

[0033] Figure 10 To investigate the effect of knocking down FDPS on the proliferation, inflammatory factors and MMPs secretion of RA FLS. Figure 10 Figure A shows representative images and statistical graphs of the EdU proliferation assay; Figure B shows mRNA expression levels of inflammatory factors and MMPs in RA FLS. *: Compared with the siC group, ***P < 0.001. #: Compared with the siC + TNF-α group, #P < 0.05, ##P < 0.01, ###P < 0.001.

[0034] Figure 11 To investigate the effect of knocking down FDPS on the migration and invasion of RA FLS. Figure 11 A shows representative images and statistical graphs of the Transwell migration assay; B shows representative images and statistical graphs of the Transwell invasion assay. *: Comparison with the siC group, ***P < 0.001.

[0035] Figure 12 The effect of ISO on RA FLS AKT and ERK1 / 2 signaling pathways. Figure 12Figure A shows the effect of ISO on the AKT signaling pathway; Figure B shows the effect of ISO on the ERK1 / 2 signaling pathway; Figure C shows the statistical effect of ISO on the AKT signaling pathway; Figure D shows the statistical effect of ISO on the ERK1 / 2 signaling pathway. *: Compared with the DMSO group, ***P < 0.001. #: Compared with the DMSO + TNF-α group, #P < 0.05, ###P < 0.001.

[0036] Figure 13 To knock down the effect of FDPS on RA FLS AKT and ERK1 / 2 signaling pathways. Figure 13 Figure A shows the effects of FDPS knockdown on the AKT and ERK1 / 2 signaling pathways; Figure B shows the effects of FDPS knockdown on the ERK1 / 2 signaling pathway; Figure C shows the statistical effect of FDPS knockdown on the AKT signaling pathway; and Figure D shows the statistical effect of FDPS knockdown on the ERK1 / 2 signaling pathway. *: Compared with the siC group, *P < 0.05, ***P < 0.001. #: Compared with the siC + TNF-α group, #P < 0.05, ##P < 0.01, ###P < 0.001. DETAILED DESCRIPTION

[0037] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0038] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.

[0039] Isosorbide-5-Nitrae-rhubarb (ISO, CAS No.: 32507-66-7) was purchased from MCE and dissolved in DMSO to prepare ISO solution, which was then diluted with culture medium according to experimental requirements.

[0040] Example 1 Regulatory Effects of Isodanin (ISO) on the Biological Behavior of RA FLS

[0041] 1. Experimental Methods

[0042] Methods Synovial membranes were collected from patients with rheumatoid arthritis (RA) to obtain primary fibroblast-like synoviocytes (FLS), which were cultured, passaged, and cryopreserved. RA FLS were treated with different concentrations of ISO (12.5 μM, 25 μM, 50 μM, and 100 μM).

[0043] 1. CCK8 experiment

[0044] CCK8 reagent was used to determine the effect of ISO on cell viability.

[0045] (1) When the cell confluence in a 96-well plate reached 80%, the cells were treated with DMSO or drugs;

[0046] (2) CCK8 working solution was diluted with complete culture medium at a ratio of 1:10, 100 μL per well, and incubated in a 37°C incubator. The absorbance at a wavelength of 450 nm was detected.

[0047] 2. Flow cytometry detection experiment

[0048] After cells were labeled with Annexin V-PI, flow cytometry was used to detect the effect of ISO on cell apoptosis.

[0049] (1) After treatment with DMSO or drugs, cells were collected into flow cytometry tubes to prepare cell suspensions; Annexin V-APC and PI were added sequentially to label the cells;

[0050] (2) Add binding buffer to the flow cytometer and complete the flow cytometer test within 1 hour.

[0051] 3. EdU proliferation assay

[0052] The EdU method was used to assess the proliferation of RA FLS.

[0053] (1) When the cell confluence in a 96-well plate reaches 80%, treat with DMSO or drugs;

[0054] (2) Prepare EdU culture medium (EdU A solution: cell culture medium = 1:1000), 100 μL per well, and incubate in a cell culture incubator;

[0055] (3) After incubation, fix the cells with 4% paraformaldehyde, prepare the Click reaction solution, add 50 μL per well, and incubate in the dark.

[0056] (4) Dilute the Hoechst 33342 reaction solution with PBS at a ratio of 1:1000, add 50 μL of 1× Hoechst 33342 reaction solution to each well, and incubate in the dark;

[0057] (5) Observe and photograph under a microscope as soon as possible.

[0058] 4. Real-time quantitative PCR (RT-qPCR)

[0059] RT-qPCR was used to detect the mRNA expression levels of cytokines and matrix metalloproteinases (MMPs) in RA FLS. The primer sequences are shown in Table 1.

[0060] (1) Extract cellular RNA using the Trizol method;

[0061] (2) Reverse transcription to generate cDNA;

[0062] (3) configuring the PCR reaction system and performing the PCR amplification procedure;

[0063] (4) Using 2 -△△ct The relative expression level of the target gene was calculated using the formula.

[0064] Table 1 Detection primers for various cytokines and matrix metalloproteinases

[0065]

[0066] 5. Transwell assay was used to detect the migration and invasion ability of RA FLS.

[0067] (1) Transwell migration assay: After treatment with DMSO or drugs, 0.25% trypsin containing EDTA was added to digest the cells and the cells were resuspended in serum-free medium; complete medium containing 10% FBS was added to the lower chamber; 300 μL of cell suspension was added to the upper chamber and the cells were cultured in a cell incubator; the chamber was removed, the suspension was poured out and washed with PBS, and the cells were fixed with 4% paraformaldehyde; they were stained with filtered 1% crystal violet solution; the cells on the inner membrane of the upper chamber that had not migrated were wiped clean; the membrane was cut along the outer edge, sealed with neutral gum, and observed under a microscope and photographed.

[0068] (2) Transwell invasion assay: After treatment with DMSO or drugs, 0.25% EDTA-containing trypsin was added to digest the cells and the cells were resuspended in serum-free medium; Matrigel was diluted with serum-free medium at a ratio of 1:9, 50 μl of Matrigel was added to the inner side of the chamber, and the cells were incubated in a cell culture incubator; complete culture medium containing 10% FBS was added to the lower chamber; 300 μL of cell suspension was added to the upper chamber, and the cells were cultured in a cell culture incubator; the chamber was removed, the suspension was poured out, and the cells were washed with PBS, and the cells were fixed with 4% paraformaldehyde; they were stained with filtered 1% crystal violet solution; the cells that had not migrated on the inner membrane of the upper chamber were wiped clean; the membrane was cut along the outer edge, sealed with neutral gum, and observed under a microscope and photographed.

[0069] 6. GraphPad Prism 9.5.0 statistical software was used for data analysis and analysis. Student's t-test and one-way analysis of variance were used to analyze differences between groups. P < 0.05 was considered statistically significant.

[0070] 2. Experimental Results

[0071] 1. After treating RA FLS with different concentrations of ISO (12.5μM, 25μM, 50μM and 100μM), the CCK8 assay results are as follows: Figure 1 As shown in A: 0-100 μM ISO had no effect on the activity of RA FLS. To exclude the effect of drug toxicity on RA FLS activity, three drug concentrations (12.5 μM, 25 μM and 50 μM) were selected for subsequent experiments in this study.

[0072] 2. After treating RA FLS with different concentrations (12.5μM, 25μM and 50μM) of ISO, the cells were labeled with Annexin V-PI and the results were detected by flow cytometry. Figure 1 As shown in B, different concentrations of ISO had no significant effect on the apoptosis of RA FLS.

[0073] 3. After treating RA FLS with different concentrations (12.5μM, 25μM and 50μM) of ISO, the results of EdU proliferation assay are as follows: Figure 2 As shown in A, ISO treatment leads to a decrease in the proliferation ability of RA FLS.

[0074] 4. After treating RA FLS with different concentrations (12.5μM, 25μM and 50μM) of ISO, the RT-qPCR results were as follows: Figure 2 As shown in Figure 2, the mRNA expression levels of IL-6 and IL-8 gradually decreased with the increase of ISO concentration, while the expression level of IL-1β did not change significantly. Meanwhile, the mRNA expression level of MMP3 gradually decreased with the increase of ISO concentration, while the expression levels of MMP1, MMP9 and MMP13 did not change significantly.

[0075] 5. After treating RA FLS with different concentrations (12.5μM, 25μM and 50μM) of ISO, the results of Transwell migration assay are as follows: Figure 3 As shown in A, the migration ability of RA FLS was reduced; the results of Transwell invasion assay were shown in Figure 3 As shown in B, the invasive ability of RA FLS was inhibited.

[0076] The above in vitro experiments confirmed that ISO can regulate the abnormal biological behaviors of RA FLS, including proliferation, migration, invasion, and inflammatory responses. These results suggest that ISO may play a therapeutic role in RA by targeting RA FLS. To explore how ISO regulates the abnormal biological behaviors of RA FLS, the present inventors conducted the following experimental investigations.

[0077] Example 2: Exploring the Mechanism of ISO in Regulating the Biological Behavior of RA FLS

[0078] 1. Experimental Methods

[0079] 1. RNA-seq detection

[0080] The synovium of normal subjects and RA patients was collected to obtain primary FLS, which were then cultured, passaged and cryopreserved.

[0081] RNA-seq combined with bioinformatics was used to screen potential downstream target genes of ISO. Three RA FLS cells were treated with either ISO (50 μM) or DMSO, respectively. RNA was then extracted and analyzed by RNA-seq. Reactome enrichment analysis was performed on the differentially expressed genes to identify potential downstream target genes of ISO.

[0082] 2. RT-qPCR

[0083] RT-qPCR was used to detect the regulatory effect of ISO on downstream potential target genes at the mRNA level and to detect the expression levels of downstream potential target genes in FLS of RA patients and normal subjects, using the same method as step 4 in Example 1.

[0084] FDPS-F: CTTTCTTCCTGGTGGCAGATGAC (SEQ ID No. 3)

[0085] FDPS-R: AGAGCTTCAGCAGGCGGTAGAT (SEQ ID No. 4)

[0086] 3. Western blotting experiments

[0087] Western blotting experiments were used to detect the regulatory effect of ISO on downstream potential target genes at the protein level and to detect the expression levels of downstream potential target genes in FLS of RA patients and normal subjects.

[0088] (1) Prepare PAGE gel using the PAGE gel rapid preparation kit, add an equal volume of sample or prestained protein marker to each well, and then perform electrophoresis and transfer to the membrane;

[0089] (2) After the transfer is completed, the residual transfer solution is washed away with ddH2O, and Ponceau red is added for staining. The desired target band is cut according to the protein band and the pre-stained protein marker; the band is washed and blocked with TBST buffer containing 5% skim milk or TBST buffer containing 5% BSA;

[0090] (3) Prepare the primary antibody, soak the target band in the prepared primary antibody, and incubate it in a shaker at 4°C overnight;

[0091] (4) Wash the strips, soak the target strips in the secondary antibody, and incubate on a shaker at room temperature;

[0092] (5) Prepare ECL chemiluminescent solution and evenly drop it on the target strip, and develop the color using the Bio-Rad chemiluminescent imaging system;

[0093] (6) Use ImageJ and Photoshop software to analyze the grayscale value of the target band.

[0094] 4. Immunohistochemistry

[0095] Immunohistochemistry was used to detect the expression levels of downstream potential target genes in the synovium of RA patients and normal subjects.

[0096] (1) After baking, dewaxing, and rehydrating the sections, add endogenous peroxidase inhibitors to the sections and incubate at room temperature;

[0097] (2) Add sufficient EDTA antigen retrieval solution for antigen retrieval, and then add PBS containing 5% BSA for blocking;

[0098] (3) Dilute the primary antibody according to the ratio specified in the antibody instructions, carefully add it to the tissue surface, then place it in a humidified chamber and transfer it to a 4°C refrigerator overnight;

[0099] (4) The next day, the primary antibody was recovered and the secondary antibody was added dropwise to the tissue and incubated at room temperature;

[0100] (5) Prepare DAB color developing solution according to the instructions and add an appropriate amount of DAB color developing solution to the tissue for color development; then add an appropriate amount of hematoxylin to the tissue for nuclear staining;

[0101] (6) Finally, dehydrate and seal the slides, air-dry them, and then observe and photograph them under a microscope.

[0102] 5. The differences between the groups were analyzed using t-test and one-way analysis of variance. P < 0.05 was considered statistically significant.

[0103] 2. Experimental Results

[0104] 1. RNA-seq data analysis results are as follows Figure 4As shown in A: Compared with the DMSO group, after ISO treatment of RA FLS, there were 281 differentially expressed genes, of which 172 genes were down-regulated and 109 genes were up-regulated (P<0.05, |FoldChange|≥2). Figure 4 As shown in Figure B, Reactome enrichment analysis of the differentially expressed genes revealed that downstream pathways were primarily enriched in lipid metabolism pathways. The top three pathways were: SREBF (SREBP) activation of gene expression pathway, SREBP (SREBP) regulation of cholesterol biosynthesis pathway, and cholesterol biosynthesis pathway. Intersection of these three pathways revealed seven genes involved in all three pathways: farnesyl diphosphate synthase (FDPS), 3-hydroxy-3-methylglutaryl-CoA synthetase 1, squalene epoxidase, mevalonate diphosphate decarboxylase, 7-dehydrocholesterol reductase, HMG-CoA reductase, and peptide IDA-LIKE1. FPS was the downstream gene with the highest fold change. Therefore, it is speculated that ISO may regulate the function of RA FLS by affecting FDPS expression.

[0105] 2. If Figure 4 C and Figure 4 As shown in the results (D), RT-qPCR and Western blotting experiments confirmed that ISO could inhibit the expression of farnesyl pyrophosphate synthase at both mRNA and protein levels in RA FLS.

[0106] 3. If Figure 5 A and Figure 5 B The results showed that the expression of farnesyl pyrophosphate synthase at both mRNA and protein levels in RA FLS were higher than those in normal FLS.

[0107] 4. If Figure 5 C The results showed that immunohistochemistry experiments found that the expression of farnesyl pyrophosphate synthase in RA synovial tissue was higher than that in normal synovial tissue.

[0108] These in vitro experiments demonstrate that FPS is highly expressed in RA FLS and RA synovial tissue compared to normal FLS and synovial tissue, and that ISO can inhibit FPS expression in RA FLS. Therefore, FPS may be a diagnostic marker for rheumatoid arthritis.

[0109] Example 3 Construction of a collagen-induced arthritis mouse model to study the in vivo mechanism of action of ISO

[0110] 1. Experimental Methods

[0111] 1. Construction of an arthritis mouse model and investigation of the in vivo mechanism of action of ISO

[0112] This study further explored the in vivo efficacy of ISO by constructing a collagen-induced arthritis mouse model. Fifteen 8-week-old SPF-grade DBA / 1 male mice were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd. and divided into a normal control group and a model group. The normal control group consisted of normal mice. The model group construction included a primary and secondary immunization. For the primary immunization, equal volumes of bovine type II collagen and complete Freund's adjuvant were mixed and emulsified, then injected into the mouse's tail at multiple points, with approximately 100 μL of emulsified collagen injected per mouse. For the secondary immunization, on day 21 after the primary immunization, bovine type II collagen and incomplete Freund's adjuvant were mixed in a 1:1 ratio by volume and emulsified, followed by multiple injections into the mouse's tail, with approximately 100 μL of emulsified collagen injected per mouse. The arthritic mice were randomly divided into a DMSO group and an ISO group, with 5 mice in each group. Starting 22 days after the initial immunization, the ISO group received daily intraperitoneal injections of ISO at a dose of 30 mg / kg / day. Simultaneously, the DMSO group received an equal volume of 10% DMSO solution. Treatment continued for 21 days. After the completion of treatment, mice were bled intraorbitally and sacrificed. Tissue specimens, including ankle joints, liver, and kidneys, were fixed in 4% paraformaldehyde. The ankle joints were then decalcified, embedded, and sectioned.

[0113] (1) Starting from the 5th to 6th day after the second immunization, arthritis mice began to develop the disease. The general condition of the mice and the involvement of the limb joints were observed every day, and the weight of the mice was measured and recorded every other day.

[0114] (2) Ankle joint sections were stained with hematoxylin-eosin and safranin O-fast green, and the pathological scores of the ankle joints of mice were evaluated based on inflammatory cell infiltration, synovial hyperplasia, bone destruction, and cartilage erosion;

[0115] Hematoxylin-eosin staining and Safranin O-Fast Green staining experiments:

[0116] A. Hematoxylin-eosin staining: Dewax and rehydrate the sections, add hematoxylin to stain the nuclei, then place the sections in 1% hydrochloric acid-ethanol differentiation solution for differentiation. Rinse in tap water to restore the blue color, and then place the sections in eosin staining solution for staining. After dehydration and mounting, observe and photograph.

[0117] B. Safranin O-Fast Green Staining: Dewax and rehydrate the sections, stain with Fast Green solution, and soak in tap water until the cartilage appears colorless under a microscope. Place the sections in 1% hydrochloric acid-ethanol differentiation solution for differentiation and wash with tap water. Stain the sections in Safranin O-Fast Green solution. Dehydrate, mount, and photograph.

[0118] (3) Immunohistochemistry was used to detect the expression of downstream potential target genes in mouse joints;

[0119] (4) Serum creatinine (SCr), aspartate transaminase (AST), and alanine aminotransferase (ALT) assay kits were used to measure serum biochemical parameters in mice. Liver and kidney tissues of mice were stained with hematoxylin-eosin to assess the hepatotoxicity and renal toxicity of ISO.

[0120] (5) The differences between the groups were analyzed using t-test and one-way analysis of variance. P < 0.05 was considered statistically significant.

[0121] 2. Experimental Results

[0122] 1. The results of mouse limb joint involvement are as follows Figure 6 As shown in A, the joint swelling in the DMSO group was more obvious than that in the normal control group; compared with the ISO-treated group, the joint redness and swelling in the DMSO group was significantly more severe. Figure 6 B shows that the joint inflammation score in the DMSO group was higher than that in the ISO-treated group.

[0123] 2. The results of hematoxylin-eosin staining and safranin O-fast green staining of ankle joints of arthritic mice are as follows Figure 6 C and Figure 6 As shown in D, the results showed that the pathological scores of inflammatory cell infiltration, synovial hyperplasia, bone destruction and cartilage erosion in the DMSO group were significantly higher than those in the ISO group.

[0124] 3. Immunohistochemistry results Figure 7 As shown in the figure, compared with the normal control group, the expression of farnesyl pyrophosphate synthase in the synovial tissue of arthritic mice in the DMSO group was significantly increased. However, the expression level of farnesyl pyrophosphate synthase in the synovial tissue of mice treated with ISO was lower than that in the DMSO group.

[0125] 4. Changes in mouse weight Figure 8 As shown in A, throughout the animal experiment, no mice in the ISO group and the DMSO group died, and there was no significant difference in body weight.

[0126] 5. Test results of mouse serum biochemical indicators Figure 8As shown in B, there was no significant difference in liver function (ALT and AST) and renal function (SCr) between the DMSO group and the ISO group. Figure 8 As shown in Figure C, the liver tissue structure of the two groups of mice was intact, the hepatic lobules were clearly demarcated, and there was no cell degeneration and necrosis; the kidney tissue structure of the two groups of mice was normal, the renal tubules and glomeruli were normal in morphology, and no pathological conditions such as atrophy were observed.

[0127] These results demonstrate that FPS expression is significantly elevated in the synovial tissue of mice with collagen-induced arthritis. ISO significantly alleviates arthritis symptoms in this model by reducing FPS expression in the synovium of these mice, without exhibiting significant hepatotoxicity or renal toxicity. Therefore, these in vivo studies demonstrate ISO's potential for treating RA and that FPS may serve as a therapeutic target for RA.

[0128] Example 4 Functional Investigation of Farnesyl Pyrophosphate Synthase (FDPS)

[0129] 1. Experimental Methods

[0130] 1. RA FLS system for knockdown of downstream potential target genes was constructed using siRNA

[0131] (1) The present invention designed three siRNAs (siFDPS-1, siFDPS-2, and siFDPS-3) to construct a RA FLS system for knocking down farnesyl pyrophosphate synthase.

[0132] siFDPS-1:GGATCTTGTCAGATTCACT(SEQ ID No.21)

[0133] siFDPS-2:GGGTGAAGGCCGCTATATGA (SEQ ID No. 1)

[0134] siFDPS-3:GTACATGGCAGGAATTGAT (SEQ ID No. 2)

[0135] (2) Wait until the cells grow to 70-80% confluency in the culture plate; use sterile DEPCE water to prepare siRNA to a storage concentration of 20 μM, divide it into packages and store it in a -20°C refrigerator; dilute Lipofectamine 3000 transfection reagent with Opti-MEM medium at a ratio of 50:3; dilute siRNA storage concentration to 100 nM with Opti-MEM medium; mix the diluted transfection reagent and siRNA working solution at a ratio of 1:1 and incubate at room temperature; then add it to the culture plate and culture it in a cell culture incubator; discard the culture medium containing the transfection reagent, add an appropriate amount of complete culture medium, and verify the transfection efficiency after 48-72 hours and perform subsequent functional experiments

[0136] 2. EdU detection and Transwell assays were used to assess changes in the proliferation, migration, and invasion abilities of RA FLS. RT-qPCR was used to examine the expression levels of IL-6, IL-8, and MMP3 in RA FLS after knockdown of potential downstream target genes. Western blotting was used to examine the effects of ISO treatment and knockdown of potential downstream target genes on the AKT and ERK1 / 2 pathways in RA FLS. The experimental methods were the same as in Example 1.

[0137] 2. Experimental Results

[0138] 1. RT-qPCR and Western blotting results Figure 9 As shown, subsequent experiments will select siFDPS-2 and siFDPS-3 with higher knockdown efficiency to verify the function of farnesyl pyrophosphate synthase.

[0139] 2. The results of the EdU proliferation experiment are as follows Figure 10 As shown in A, knockdown of farnesyl pyrophosphate synthase reduced the proliferation ability of RA FLS.

[0140] 3. RT-qPCR results Figure 10 As shown in Figure 2, knockdown of farnesyl pyrophosphate synthase reduced the mRNA expression levels of IL-6 and IL-8 in RA FLS and also reduced the expression of MMP3 in RA FLS.

[0141] 4. Transwell migration and invasion assay results Figure 11 A and Figure 11 As shown in B, knockdown of farnesyl pyrophosphate synthase reduced the migration and invasion abilities of RA FLS.

[0142] 5. Western blot test results are as follows Figure 12 As shown in the figure, after ISO treatment, the phosphorylation of ERK1 / 2 and AKT signaling pathways in RA FLS cells was inhibited.

[0143] 6. Western blot test results are as follows Figure 13 As shown in the figure, after knocking down farnesyl pyrophosphate synthase, the phosphorylation of ERK1 / 2 and AKT signaling pathways in RA FLS cells was inhibited.

[0144] These results suggest that ISO can inhibit the activation of the AKT and ERK1 / 2 signaling pathways by reducing FDPS expression in RA FLS, thereby exerting anti-inflammatory, anti-proliferation, and anti-migratory and invasive effects in RA FLS. Furthermore, inhibiting FDPS expression alone also exerts anti-inflammatory, anti-proliferative, and anti-migratory and invasive effects in RA FLS. Therefore, in vitro experiments demonstrate that farnesyl pyrophosphate synthase may be a therapeutic target for rheumatoid arthritis.

Claims

1. Application of isodanin in the preparation of medicines for treating rheumatoid arthritis.

2. The application according to claim 1, characterized in that The use concentration of the isodanin is 12.5-50 μM.

3. Use of farnesyl pyrophosphate synthase inhibitors in the preparation of drugs for treating rheumatoid arthritis.

4. The application according to any one of claims 1 or 3, characterized in that: The treatment is to inhibit the proliferation, migration and invasion ability of rheumatoid arthritis fibroblast-like synoviocytes, inhibit the expression of cellular inflammatory factors IL-6, IL-8 and matrix metalloproteinase MMP3, and inhibit one or more of the phosphorylation of ERK1 / 2 and AKT signaling pathways.

5. The application according to claim 3, characterized in that: The inhibitor is a small interfering RNA, including siRNA-2 and siRNA-3, and the nucleotide sequences thereof are shown in SEQ ID No. 1 to 2, respectively.

6. Application of farnesyl pyrophosphate synthase as a diagnostic target for rheumatoid arthritis in the preparation of products for diagnosing rheumatoid arthritis.

7. Use of a reagent for detecting farnesyl pyrophosphate synthase expression levels in the preparation of a product for diagnosing rheumatoid arthritis.

8. The application according to claim 7, characterized in that: The reagent for detecting the expression level of farnesyl pyrophosphate synthase is an antibody, a primer, a probe, a sequencing library or a combination thereof.

9. The application according to claim 8, characterized in that: The primers are real-time fluorescence quantitative PCR primers, and the nucleotide sequences thereof are shown in SEQ ID No. 3-4.

10. The use according to any one of claims 6 or 7, characterized in that: The product is a test kit, a chip or a test paper.

Images