Maize melatonin synthesized polygene knockout mutant and application thereof
The CRISPR/Cas9 technology knocked out the ZmSNAT, ZmASMT1 and ZmCOMT genes of corn, constructed expression vectors and cultivated transgenic corn, solving the problem of insufficient stress resistance in the existing technology, and achieving high endogenous melatonin content and multi-resistance enhancement of corn plants.
Patent Information
- Application Number
- CN202510057534.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-14
- Publication Date
- 2025-08-29
AI Technical Summary
The existing technology lacks research on the use of CRISPR/Cas9 for key gene editing of melatonin in corn, resulting in insufficient improvement of stress resistance in corn and cannot be effectively applied to genetic breeding to improve stress resistance.
The ZmSNAT, ZmASMT1 and ZmCOMT genes in corn were knocked out by CRISPR/Cas9 technology, and the pEGZMCas9 Pubi-B-SNAT-ZmASMT1-COMT expression vector was constructed to achieve multi-gene editing, and transgenic corn plants that knocked out these three genes simultaneously were cultured and screened out.
The endogenous melatonin content of corn has been improved, the drought resistance, waterlogging resistance and rapid drought resistance of plants have been enhanced, and research materials and breeding plans are provided for studying the mechanism of melatonin in crop adversity regulation.
Smart Images

Figure CN120555445A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of plant molecular biotechnology, and in particular to a corn melatonin synthesis multi-gene knockout mutant and applications thereof. Background Art
[0002] To mitigate damage to corn crops caused by abiotic stresses such as drought, flooding, and high temperatures, research on the application of various exogenous regulators has become a hot topic. Melatonin (N-acetyl-5-methoxytryptamine) is a key regulator of crop stress, regulating antioxidant enzyme activity, reducing reactive oxygen species, and enhancing crop stress tolerance. Furthermore, altered transcriptional expression of key enzymes in the melatonin biosynthesis pathway—serotonin N-acetyltransferase (SNAT), N-acetyl-5-hydroxytryptamine methyltransferase (ASMT), and caffeic acid O-methyltransferase (COMT)—increases or decreases endogenous melatonin levels, thereby affecting plant growth, development, and stress tolerance. Overexpression of a key gene involved in melatonin synthesis significantly increases endogenous melatonin levels in crops, enhancing their stress tolerance. Although great progress has been made in understanding the mechanism by which endogenous melatonin regulates crop stress resistance, there is still a lack of research on the impact of mutations in one or more key melatonin synthesis genes on crop stress resistance.
[0003] The commonly used CRISPR / Cas9 plant gene editing technology is widely used to specifically knock out target genes due to its ability to induce irreversible mutations such as insertions and deletions in the target gene's DNA; its ability to stably transmit mutations to the recipient's offspring; and its ability to consistently affect the normal function of the target gene in all organs, tissues, and cells of the recipient. Therefore, using CRISPR / Cas9 plant gene editing technology to specifically knock out one or more genes is a current research hotspot. In recent years, many basic research studies have also begun using CRISPR / Cas9 to edit target genes and study their functions. However, there are still few reports on using CRISPR / Cas9 to edit the key endogenous melatonin gene in corn.
[0004] In summary, if a mutant that specifically knocks out melatonin biosynthesis-related genes in corn using CRISPR / Cas9 plant gene editing technology can be provided, it will not only be possible to specifically study the unique function of melatonin synthesis-related genes in regulating crop stress resistance, but can also be used in genetic breeding to specifically produce new multi-resistant corn varieties, thereby improving the stress resistance of corn in the current harsh climatic environment. It will have very important scientific research value and practical application value. Summary of the Invention
[0005] In view of the deficiencies in the prior art, the present invention provides a corn melatonin synthesis multi-gene knockout mutant and its application, which are used to overcome the defects in the prior art.
[0006] The technical solution of the present invention is achieved as follows: a corn melatonin synthesis multi-gene knockout mutant, wherein the three genes knocked out in the corn melatonin synthesis multi-gene knockout mutant are ZmSNAT, ZmASMT1 and ZmCOMT, and the nucleotide sequences after the knockout are shown in SEQ ID NO 4, SEQ ID NO 5 and SEQ ID NO 6, respectively.
[0007] Furthermore, the nucleotide sequences of the genes ZmSNAT, ZmASMT1 and ZmCOMT in the B73 genome are shown as SEQ ID NO 1, SEQ ID NO 2 and SEQ ID NO 3, respectively.
[0008] An expression vector containing a corn melatonin synthesis multi-gene knockout mutant, wherein the expression vector is pEGZMCas9Pubi-B-SNAT-ZmASMT1-COMT, and the sequence thereof is shown as SEQ ID NO 7.
[0009] A method for preparing an expression vector for a corn melatonin synthesis multi-gene knockout mutant, the preparation method comprising the following steps:
[0010] S1. Design sgRNA target sequences for ZmSNAT, ZmASMT1, and ZmCOMT genes, respectively;
[0011] S2, construct sgRNA expression cassette fragment;
[0012] S3. Perform a homologous recombination reaction between the sgRNA expression cassette fragment in step S2 and the single-enzyme-cut pLHRNAipEGZMCas9Pubi-B linear vector to obtain the desired expression vector of the maize melatonin synthesis multi-gene knockout mutant.
[0013] The invention discloses an application of an expression vector for a corn melatonin synthesis multi-gene knockout mutant in preparing the corn melatonin synthesis multi-gene knockout mutant.
[0014] A use of a corn melatonin synthesis multi-gene knockout mutant in adverse stress, wherein the use comprises subjecting the corn melatonin synthesis multi-gene knockout mutant to drought stress, thereby causing the plant to exhibit drought resistance; subjecting the corn melatonin synthesis multi-gene knockout mutant to waterlogging stress, thereby causing the plant to exhibit strong waterlogging tolerance; or subjecting the corn melatonin synthesis multi-gene knockout mutant to drought-waterlogging rapid cycle stress, thereby causing the plant to exhibit strong resistance.
[0015] Application of a maize melatonin synthesis multi-gene knockout mutant in studying the specific regulatory functions of ZmSNAT, ZmASMT1 and ZmCOMT genes on maize resistance.
[0016] Application of a maize melatonin synthesis multi-gene knockout mutant in studying the regulatory mechanism of endogenous melatonin on maize resistance.
[0017] Furthermore, the target sequence for ZmSNAT gene editing in S1 is: ZmSNAT-T1: 5'-TGCATTGAAGGCATGGTCTGAGG-3', the target sequence for ZmASMT1 gene editing is: ZmASMT1-T2: 5'-GAAGAGTGGTTCAAGGACGCGGG-3', and the target sequence for ZmCOMT gene editing is: ZmCOMT-T3: 5'-GGCGTTCGAGTACCACGGCACGG-3'.
[0018] Furthermore, the single enzyme digestion in S2 is performed using HindIII restriction endonuclease.
[0019] The present invention has the following positive effects:
[0020] 1. The present invention constructed a CRISPR / Cas9 multi-gene editing vector for the ZmSNAT, ZmASMT1, and ZmCOMT genes and transformed the constructed multi-gene editing vector into a maize inbred line. Transgenic maize plants with simultaneous knockout of the three genes, ZmSNAT, ZmASMT1, and ZmCOMT, were cultured and screened.
[0021] 2. The snat asmt comt mutant provided in the present invention contains a higher endogenous melatonin content, exhibits drought resistance, waterlogging tolerance and resistance to drought-waterlogging cycles, and provides an effective research material for studying the mechanism by which melatonin improves crop stress.
[0022] 3. The technical solution provided by the present invention provides an important scientific basis for the regulatory effect of maize melatonin biosynthesis genes on maize stress resistance. It also provides a breeding material and an effective technical solution for studying the mechanism of melatonin regulating crop adversity. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 The structure diagram of the ZmSNAT, ZmASMT1 and ZmCOMT gene expression cassettes;
[0024] Figure 2 Figure 2 is the detection result of PCR amplification of expression cassette fragments of ZmSNAT (T1), ZmASMT1 (T2) and ZmCOMT (T3) genes;
[0025] Figure 3 This is the map of the pEGZMCas9Pubi-B-SNAT-ZmASMT1-COMT vector;
[0026] Figure 4 Electrophoresis detection diagram of positive monoclonal colonies screened by colony PCR carrying the pEGZMCas9Pubi-B-SNAT-ZmASMT1-COMT recombinant vector;
[0027] Figure 5 This is the electrophoresis detection diagram of T0 generation transgenic positive plants carrying Cas9 screened by PCR;
[0028] Figure 6 This is the detection result diagram of the alignment of the ZmSNAT gene sequencing sequence of the snat asmt comt T1 generation plant with the reference sequence;
[0029] Figure 7 This is the detection result diagram of the alignment of the ZmCOMT gene sequencing sequence of the snat asmt comt T1 generation plants with the reference sequence;
[0030] Figure 8 This is the detection result diagram of the alignment of the ZmASMT1 gene sequencing sequence of the snat asmt comt T1 generation plant with the reference sequence;
[0031] Figure 9 This is the detection chart of endogenous melatonin content in the T1 generation plants of snat asmt comt;
[0032] Figure 10 The figure shows the results of antioxidant enzyme activity determination in snat asmt comt T1 plants under drought stress;
[0033] Figure 11 The figure shows the results of measuring the active oxygen content in the T1 generation of snat asmt comt plants under drought stress;
[0034] Figure 12 The figure shows the results of MDA content determination in snat asmt comt T1 plants under drought stress;
[0035] Figure 13 The figure shows the results of proline content determination in snat asmt comt T1 plants under drought stress;
[0036] Figure 14 The figure shows the results of measuring the soluble sugar and soluble protein contents in the T1 generation of snat asmt comt plants under drought stress;
[0037] Figure 15 Figure 2 shows the results of measuring the contents of some plant hormones in T1 generation plants of snat asmt comt under drought stress;
[0038] Figure 16 The figure shows the results of the antioxidant enzyme activity assay in the T1 generation of snat asmt comt plants under waterlogging stress;
[0039] Figure 17 This is the result of measuring the active oxygen content in the T1 generation of snat asmt comt plants under waterlogging stress;
[0040] Figure 18 This is the result of measuring MDA content in T1 generation plants of snat asmt comt under waterlogging stress;
[0041] Figure 19 This is the result of measuring the proline content in the T1 generation of snat asmt comt plants under waterlogging stress;
[0042] Figure 20 The figure shows the results of measuring the soluble sugar and soluble protein contents in the T1 generation of snat asmt comt plants under waterlogging stress;
[0043] Figure 21 The figure shows the results of antioxidant enzyme activity determination in T1 generation plants of snat asmt comt under drought and flood stress;
[0044] Figure 22 The figure shows the results of measuring the active oxygen content in the T1 generation of snat asmt comt plants under drought-flood rapid transition stress;
[0045] Figure 23 This is the result of measuring the MDA content in the T1 generation of snat asmt comt plants under drought-flood rapid alternation stress;
[0046] Figure 24 This is the result of measuring the proline content in T1 plants of snat asmt comt under drought-flood rapid alternation stress;
[0047] Figure 25This figure shows the results of determining the soluble sugar and soluble protein contents in the T1 generation of snat asmt comt plants under drought-flood stress. DETAILED DESCRIPTION
[0048] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0049] In the following description of the invention, it should be noted that the terms "upper," "lower," "left," "right," "inner," and "outer," etc., indicating orientations or positional relationships, are based on the orientations or positional relationships shown in the accompanying drawings and are intended solely to facilitate and simplify the description of the invention. They are not intended to indicate or imply that the devices or components referred to must have a specific orientation, be constructed, or operate in a specific orientation. The term "connected" simply indicates a connection between devices and does not have any special meaning.
[0050] like Figure 1-25 As shown, a maize melatonin synthesis multi-gene knockout mutant is provided. The three genes knocked out in the maize melatonin synthesis multi-gene knockout mutant are ZmSNAT, ZmASMT1, and ZmCOMT, and the nucleotide sequences after the knockout are shown in SEQ ID NO 4, SEQ ID NO 5, and SEQ ID NO 6, respectively. The nucleotide sequences of the genes ZmSNAT, ZmASMT1, and ZmCOMT in the B73 genome are shown in SEQ ID NO 1, SEQ ID NO 2, and SEQ ID NO 3, respectively.
[0051] An expression vector containing a corn melatonin synthesis multi-gene knockout mutant, characterized in that: the expression vector is pEGZMCas9Pubi-B-SNAT-ZmASMT1-COMT, and its sequence is shown in SEQ ID NO 7.
[0052] A method for preparing an expression vector for a corn melatonin synthesis multi-gene knockout mutant is characterized in that the preparation method comprises the following steps: respectively designing sgRNA target sequences of the ZmSNAT, ZmASMT1 and ZmCOMT genes; constructing an sgRNA expression cassette fragment to obtain a single-enzyme-cut pLHRNAipEGZMCas9Pubi-B linear vector; and subjecting the sgRNA expression cassette fragment to a homologous recombination reaction with the single-enzyme-cut pLHRNAipEGZMCas9Pubi-B linear vector to obtain the desired expression vector for the corn melatonin synthesis multi-gene knockout mutant.
[0053] The target sequence for ZmSNAT gene editing in S1 is: ZmSNAT-T1: 5'-TGCATTGAAGGCATGGTCTGAGG-3', the target sequence for ZmASMT1 gene editing is: ZmASMT1-T2: 5'-GAAGAGTGGTTCAAGGACGCGGG-3', and the target sequence for ZmCOMT gene editing is: ZmCOMT-T3: 5'-GGCGTTCGAGTACCACGGCACGG-3'. The single enzyme digestion in S2 is performed using HindIII restriction endonuclease.
[0054] The invention discloses an application of an expression vector for a corn melatonin synthesis multi-gene knockout mutant in preparing the corn melatonin synthesis multi-gene knockout mutant.
[0055] A use of the corn melatonin synthesis multi-gene knockout mutant according to claim 1 in adverse stress, characterized in that the use comprises subjecting the corn melatonin synthesis multi-gene knockout mutant to drought stress, thereby causing the plant to exhibit drought resistance; subjecting the corn melatonin synthesis multi-gene knockout mutant to flooding stress, thereby causing the plant to exhibit strong waterlogging tolerance; or subjecting the corn melatonin synthesis multi-gene knockout mutant to drought-flood rapid cycle stress, thereby causing the plant to exhibit strong resistance.
[0056] Application of a maize melatonin synthesis multi-gene knockout mutant in studying the specific regulatory functions of ZmSNAT, ZmASMT1 and ZmCOMT genes on maize resistance.
[0057] Application of a maize melatonin synthesis multi-gene knockout mutant in studying the regulatory mechanism of endogenous melatonin on maize resistance.
[0058] Example 1, corn melatonin synthesis multi-gene knockout mutant, such as Figure 1-9 As shown:
[0059] Using homologous recombination directional cloning, the maize sgRNA expression cassette was forward cloned into the plant CRISPR / Cas9 gene editing vector pEGZMCas9Pubi-B with a kanamycin selection marker to obtain the pEGZMCas9Pubi-B-SNAT-ZmASMT1-COMT multi-gene knockout vector. The structure of the sgRNA expression cassette is as follows: Figure 1 As shown, the vector map of the pEGZMCas9Pubi-B-SNAT-ZmASMT1-COMT is as shown Figure 2 As shown, the SNAT is the ZmSNAT gene, and the COMT is the ZmCOMT gene. The specific construction method is as follows:
[0060] S1. Determine the target sequences of ZmSNAT, ZmASMT1 and ZmCOMT genes: Key enzymes in the melatonin biosynthesis pathway include serotonin N-acetyltransferase (SNAT), N-acetyl-5-hydroxytryptamine methyltransferase (ASMT) and caffeic acid O-methyltransferase (COMT). The target genes selected in the present invention are the key enzymes of maize melatonin biosynthesis ZmSNAT (gene number: Zm00001d038491, GRMZM2G701207), ZmCOMT (gene number: Zm00001d049541, AC196475.3_FG004), and ZmASMT1 (gene number: Zm00001d032083, GRMZM2G059465). The corresponding reference genome sequences were obtained from the maize genome website (http: / / plants.ensembl.org / Zea_mays / Info / Index), as shown in sequence SEQ ID NO 1, sequence SEQ ID NO 2, and sequence SEQ ID NO 3, respectively. The target sequences were designed using the online website https: / / chopchop.cbu.uib.no / , and the corresponding sequences are as follows: ZmSNAT-T1: 5'-TGCATTGAAGGCATGGTCTGAGG-3'; ZmASMT1-T2: 5'-GAAGAGTGGTTCAAGGACGCGGG-3'; ZmCOMT-T3: 5'-GGCGTTCGAGTACCACGGCACGG-3'.
[0061] S2. Construction of sgRNA expression cassette: Overlap PCR and nested PCR were used to amplify the sgRNA expression cassette. The first round of PCR was performed using the OsU6a template and the sgRNA template to amplify the U6 promoter and gRNA. Then, the second round of PCR was performed using the first round pU6 product and the gRNA product to obtain the sgRNA expression cassette. Figure 1 The primer sequences for amplifying the sgRNA expression cassette are shown below:
[0062] ZM-gRT1: 5'-TGCATTGAAGGCATGGTCTGGTTTTAGAGCTAGAAAT-3'
[0063] ZM-OsU6aT1: 5'-CAGACCATGCCTTCAATGCACGGCAGCCAAGCCAGCA-3'
[0064] ZM-gRT2: 5'-GCGTTCGAGTACCACGGCAGTTTTAGAGCTAGAAATt-3'
[0065] ZM-OsU6bT2: 5'-TGCCGTGGTACTCGAACGCCAACACAAGCGGCAGC-3'
[0066] ZM-gRT3: 5'-AAGAGTGGTTCAAGGACGCGTTTTAGAGCTAGAAAT-3'
[0067] ZM-OsU6aT3: 5'-GCGTCCTTGAACCACTCTTCGGCAGCCAAGCCAGCA-3'
[0068] UF:5'-CTCCGTTTTACCTGTGGAATCG-3'
[0069] gRNA-R:5'-CGGAGGAAAATTCCATCCAC-3'
[0070] Pps-R:5'-TTCAGAGGTCTCT ACCG ACTAGTATGGAATCGGGCAGCAAAGG-3'
[0071] Pgs-L:5'-AGCGTGGGTCTCG CTCG ACGCGTATCCATCCACTCCAAGCTC-3'
[0072] In the first round of PCR, the pU6 amplification system was as follows: 5 μl of 2X Pfu MIX, 0.2 μl of 10 μM UF primer, 0.2 μl of 10 μM ZM-OsU6aT1 primer / ZM-OsU6bT2 primer / ZM-OsU6aT3 primer, and 0.1 μl of OsU6a template, all brought up to 10 μl with ddH2O. The gRNA amplification system in the first round of PCR was as follows: 5 μl of 2X Pfu MIX, 0.2 μl of 10 μM gRNA-R primer, 0.2 μl of 10 μM ZM-gRT1 primer / ZM-gRT2 primer / ZM-gRT3 primer, and 0.1 μl of sgRNA template, all brought up to 10 μl with ddH2O. The first-round PCR reaction program was as follows: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 20 s, annealing at 55°C for 20 s, extension at 72°C for 20 s, 20 cycles, and final extension at 72°C for 5 min.
[0073] The sgRNA expression cassette amplification system for the second round of PCR was as follows: 25 μl of 2X Pfu MIX, 1 μl of 10 μM Pps-R primer, 1 μl of 10 μM Pgs-L primer, 0.5 μl of the first-round pU6 product, and 0.5 μl of the first-round gRNA product, all mixed with ddH2O to a final volume of 50 μl. The second-round PCR protocol was as follows: 95°C initial denaturation for 2 min, 95°C denaturation for 20 s, 55°C annealing for 30 s, and 72°C extension for 30 s, followed by 30 cycles of 72°C extension for 5 min, followed by a final extension at 72°C. The second-round PCR amplification product was electrophoresed on a 1% agarose gel, and a 500-600 bp fragment was excised. The desired fragment was then recovered by column extraction using a gel extraction kit.
[0074] The gel image of the detection PCR amplification product is as follows Figure 2 As shown, lane 1: BM2000 DNA Marker (Pujin Biotechnology); lane 2: U6a-T1-gRNA fragment; lane 3: U6a-T2-gRNA fragment; lane 4: U6a-T3-gRNA fragment.
[0075] S3. Construction of multi-gene knockout vector: Use enzyme digestion and enzyme ligation to directly connect the pEGZMCas9Pubi-B empty plasmid and the sgRNA expression cassette target fragment. The reaction product is the CRISPR / Cas9 gene editing vector pEGZMCas9Pubi-B-SNAT-ZmASMT1-COMT. The vector is shown in the figure. Figure 3 shown.
[0076] The enzyme digestion-ligation reaction system was: 1.5 μl of 10× CutSmart Buffer, 1.5 μl of 10 mM ATP, 30 ng of empty plasmid, 30 ng of target fragment / fragment, 10 units of Bsa I-HF, 35 units of T4 DNA ligase, and ddH2O to 15 μl. The enzyme digestion-ligation reaction program was: 37°C for 5 min, 20°C for 5 min, for 15 cycles.
[0077] The reaction product was transformed into E. coli DH5α competent cells, and the primer pair SP-L / SP-R was used to perform PCR colony detection and sequencing on the transformants after resistance screening. The PCR colony detection results were as follows: Figure 4 As shown, lane 1: BM2000 DNA Marker (Pujin Biotechnology); lanes 2-9: Monoclonal colonies used as PCR templates containing pEGZMCas9Pubi-B-SNAT-ZmASMT1-COMT recombinant vector clones. As can be seen from the figure, the DNA band of approximately 1800 bp is the positive clone carrying the pEGZMCas9Pubi-B-SNAT-ZmASMT1-COMT recombinant vector.
[0078] The primer sequences used for PCR colony detection are as follows:
[0079] SP-L: 5'-GCGGTGTCATCTATGTTACTAG-3'
[0080] SP-R: 5'-TGCAATAACTTCGTATAGGC-3'
[0081] The specific steps for transforming the transformant, i.e., the recombinant plasmid, into Escherichia coli are as follows: 100 μL of DH5α was mixed with 5 μL of the enzyme-digested ligation product, ice-bathed for 30 minutes, quickly placed in a heat shock at 42°C for 90 seconds, ice-bathed for 2 minutes, mixed with 500 μL of LB liquid culture medium, and cultured at 37°C at 200 rpm for 45 minutes. The resuspended bacterial liquid was spread on a Kana-resistant LB solid culture medium plate, and after 30 minutes, it was cultured at a constant temperature of 37°C overnight.
[0082] The amplification system for colony PCR assays was: 10 μl of 2X Taq Mix, 0.5 μl of 10 μM SP-L primer, 0.5 μl of 10 μM SP-R primer, and ddH₂O on the plaque, bringing the total volume to 20 μl. The colony PCR reaction protocol was: 25 cycles of initial denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 2 min, followed by a final extension at 72°C for 5 min.
[0083] The single clone confirmed by sequencing is used to extract the plasmid. The specific steps are as follows:
[0084] Take 4 mL of overnight cultured bacterial solution, centrifuge at 10,000 rpm for 2 minutes, discard the supernatant to collect the bacteria, add 250 μL of Solution I reagent containing ribonuclease A to thoroughly resuspend the bacterial block, add 250 μL of Solution II reagent to lyse the bacterial block, gently invert it up and down several times until the bacteria are transparent, then add 350 μL of Solution III reagent, invert it several times until white compact flocs are formed, centrifuge at 12,000 rpm for 10 minutes, take the supernatant and place it on the nucleic acid purification column, centrifuge at 12,000 rpm for 1 minute, discard the filtrate, add 500 μL of Buffer W1 to the nucleic acid purification column, centrifuge at 12,000 rpm for 30 seconds, discard the filtrate, add 700 μL of Buffer W2 to the nucleic acid purification column, centrifuge at 12,000 rpm at room temperature for 30 seconds, discard the filtrate, and repeat the above steps; place the nucleic acid purification column on the collection tube, empty it at 12,000 rpm at room temperature for 2 minutes to remove as much residual liquid as possible; discard the collection tube, take the nucleic acid purification column and place it on 1.5 mL Place the tube in an EP tube and add 50 μL of elution buffer to elute the DNA attached to the nucleic acid purification column membrane (the elution buffer can be preheated in a 65°C constant temperature water bath to facilitate elution of the DNA). Let it stand at room temperature for 2 minutes, centrifuge at 12000 rpm for 2 minutes to elute the DNA attached to the nucleic acid purification column membrane, and store it in a -40°C low-temperature refrigerator for later use.
[0085] The recombinant plasmid extracted above was transferred into the Agrobacterium DHA105 strain by electroporation. After PCR identification, a single clone was selected for expansion culture and then used to infect the maize inbred line B104 for genetic transformation. The transformed seedlings were then selected for Cas9 expression strain identification and sequencing analysis. Finally, the strain with simultaneous knockout of the three genes ZmSNAT, ZmASMT1 and ZmCOMT was determined, and strict self-pollination was used to obtain T1 generation seeds.
[0086] The specific steps of the genetic transformation are:
[0087] S1. Dip the Agrobacterium liquid into a resistance plate and culture it overnight to complete activation. Pick a colony from the activated plate and place it in 50 ml of LB culture medium containing Kana and rifampicin. Culture it at 28°C and 200 rpm for 1 day.
[0088] S2. Centrifuge at 4000 rpm for 10 min at room temperature, discard the supernatant, add 50 ml of MS liquid culture medium to suspend the colonies, and add 50 μl of 100 mM acetosyringone to adjust the bacterial solution to an OD value of 0.6-0.8 for infection;
[0089] S3. Select corn inbred line B104 ears with appropriate embryo age, peel them and disinfect them. Then, remove the embryos from the disinfected ears with an embryo-cutting knife and place them in a sterile tube containing infection solution. After tightly capping the centrifuge tube, gently shake it to suspend the young embryos and let it stand for several minutes.
[0090] S4, discard the Agrobacterium suspension, transfer the immature embryos to the co-culture plate, wait for the Agrobacterium suspension on the embryo surface to dry, and complete the low-temperature co-culture;
[0091] S5. After the co-culture is completed, the embryos are transferred to the recovery medium for appropriate recovery culture;
[0092] S6. Transfer the immature embryos from the recovery medium to the screening medium to obtain resistant calli;
[0093] S7, using forceps, transfer the resistant calli to the regeneration medium to induce seedling emergence;
[0094] The formula of the induction medium (1 L) is as follows: add 50 μl of 20000× trace element stock solution, 200× EDTA-Fe 2+ 5ml of mother liquor, 5ml of 200×B5 organic salt mother liquor, 1ml of 2mg / ml 2,4-D mother liquor, 0.22g of CaCl2, 0.5g of proline, 0.3g of hydrolyzed protein, 30g of sucrose, 3g of plant gelatin, and the pH value was adjusted to 5.8.
[0095] The formula of the 20000× trace element mother solution (100 ml) is: H3BO3 0.62 g, KI 0.083 g, MnSO4·4H2O 2.23 g, ZnSO4·7H2O 0.86 g, Na2MoO4·2H2O 0.025 g, CuSO4·5H2O 0.0025 g, CoCl2·6H2O 0.0025 g. 2+ The formula of mother solution (500ml) is: 10 H 14 3.73 g of N2Na2O8 (sodium ethylenediaminetetraacetate), 2.78 g of FeSO4·7H20. The formula of the 200×B5 organic salt mother solution (100 ml) is: 0.2 g of vitamin B1, 0.02 g of vitamin B6, 0.02 g of niacin, and 2 g of inositol.
[0096] The co-culture medium (1 L) is formulated as follows: add the above-mentioned 200×EDTA-Fe to 1 L of MS basic medium (Murashige & Skoog Basal Medium, purchased from Phytotechnology Laboratories, USA) 2+ 5ml of mother liquor, 1ml of 2mg / ml 2,4-D mother liquor, 0.5g of proline, 0.3g of hydrolyzed protein, 30g of sucrose, 10g of glucose, 3g of plant gelatin, adjust the pH value to 5.8, and add 1ml of the above-mentioned acetosyringone mother liquor before pouring the gel after sterilization.
[0097] The screening medium formula (1L) is as follows: add 5ml of 200×NBO B3 trace salt stock solution, 5ml of 200×L3 iron salt stock solution, 5ml of 200×L3 organic salt stock solution, 1.25ml of 2mg / ml 2,4-D stock solution, 0.5g of proline, 0.5g of glutamine, 0.3g of hydrolyzed protein, 30g of maltose, and 3g of plant gel to 1L of MS basic medium, adjust the pH value to 5.8, and after sterilization, add 1ml of the above-mentioned G418 screening antibiotic stock solution with a concentration of 50mg / ml, 0.8ml of hygromycin stock solution with a concentration of 50mg / ml, and 2ml of penicillin stock solution with a concentration of 200mg / ml before pouring the gel.
[0098] The formula of the 200×L3 iron salt mother solution (1L) is: 10 H 14 14.90 g of sodium ethylenediaminetetraacetic acid (N2Na2O8) and 11.18 g of FeSO4.7H20. The differentiation medium (1 L) is formulated as follows: 5 ml of 200×NBO B3 trace salt stock solution, 5 ml of 200×L3 iron salt stock solution, 5 ml of 200×L3 organic salt stock solution, 4 ml of 0.5 mg / ml KT stock solution, 4 ml of 0.5 mg / ml KT stock solution, 2 ml of 0.1 mg / ml IAA stock solution, 0.5 g of proline, 0.5 g of glutamine, 0.8 g of hydrolyzed protein, 30 g of maltose, and 3 g of plant gelatin are added to 1 L of N6 minimal medium. The pH is adjusted to 5.8. After sterilization, 0.6 ml of 50 mg / ml hygromycin stock solution and 2 ml of 200 mg / ml penicillin stock solution are added just before pouring.
[0099] The rooting medium (1L) is formulated as follows: 2.5ml of 200×MS trace element mother solution is added to 1L MS basic medium, and the above 200×EDTA-Fe 2+2.5 ml of stock solution, 2.5 ml of 200×MS organic element stock solution, 1 ml of 0.4 mg / ml IBA stock solution, 20 g of sucrose, 3 g of plant gelatin, adjusted to pH 5.8, and 2 ml of 200 mg / ml penicillin stock solution added near the time of pouring after sterilization. The formula of the 200×MS organic element stock solution (1 L) is: MnSO4·4H2O 4.46 g, ZnSO4·7H2O 1.72 g, H3BO3 1.24 g, KI 0.166 g, Na2MoO4·2H2O 0.05 g, CuSO4·5H2O 0.005 g, and CoCl2·6H2O 0.005 g. The formula of the 200× organic salt mother solution (250 ml) is: glycine 0.1 g, vitamin B1 0.005 g, vitamin B6 0.025 g, inositol 5 g, and niacin 0.025 g.
[0100] After successful induction of S8 and T0 seedlings, transfer them to a rooting pot for rooting induction. Once the seedlings have 3–4 young leaves, samples can be taken for PCR testing to screen for Cas9-, ZmSNAT-, ZmCOMT-, and ZmASMT1-edited lines, as well as lines with simultaneous editing of the ZmSNAT, ZmCOMT, and ZmASMT1 genes.
[0101] The PCR detection primers for screening Cas9 gene editing strains are as follows:
[0102] CAS9(+):5'-ACAACTACCACCACGCTCAC-3'
[0103] CAS9(-):5'-ACTTCTTAGGGTCCCCAATCC-3'
[0104] The PCR detection primers for screening ZmSNAT gene-edited strains are as follows:
[0105] ZM207(814+):5'-AGACAGTAGAGCCACCACCAGC-3'
[0106] ZM207(814-):5'-GATGTCTCGCTGGAGCAAAGTA-3'
[0107] The PCR detection primers for screening ZmCOMT gene-edited strains are as follows:
[0108] ZM475(699+):5'-AAACTCATTCAGCCATTCG-3'
[0109] ZM475(699-):5'-CGATGACCTTGCCATTTTCC-3'
[0110] The PCR detection primers for screening ZmASMT1 gene-edited strains are as follows:
[0111] ZM9465(772+):5'-CAGCAACAATCTCGGACATCAT-3'
[0112] ZM9465(772-):5'-GGATCTTGACGCTGCTTTCG-3'
[0113] The designed Cas9 target band is 533 bp. The results of the Cas9 gene editing strain are as follows: Figure 5 As shown, lane 1: BM2000 DNA Marker (Pujin Biotechnology); lanes 2-11: template DNA from leaves of T1-generation transgenic plants harboring the pEGZMCas9Pubi-B-SNAT-ZmASMT1-COMT vector. As can be seen from the figure, DNA bands around 600 bp (lanes 2-11) indicate positive lines harboring the Cas9 recombinant vector.
[0114] The PCR amplification products of the ZmSNAT, ZmCOMT and ZmASMT1 genes were sent to Zhengzhou Qingke Zixi Biotechnology Co., Ltd. for sequencing. The starting sequencing primers were ZM207 (814+), ZM475 (699+) and ZM9465 (772+), respectively. The sequencing results are shown in SEQ ID NO 4, SEQ ID NO 5 and SEQ ID NO 6, respectively. The results of the comparison of the sequencing results with the reference sequences are as follows: Figure 6 , Figure 7 and Figure 8 , in each figure, the upper part is the reference sequence and the lower part is the sequencing sequence.
[0115] The sequencing results showed that the target sites of the ZmSNAT, ZmCOMT and ZmASMT1 genes in the transgenic lines 3565-5, 3565-13 and 3565-15 had mutations to varying degrees, and these three lines were all homozygous mutants, namely the obtained corn multi-gene knockout mutant snat asmt comt lines.
[0116] Example 2, as Figure 9 As shown, the endogenous melatonin content in the leaves of maize multi-gene knockout mutant snat asmt comt plants was determined:
[0117] 0.2 g of leaves from snat asmt comt T1 transgenic positive plants 3565-5, 3565-13, and 3565-15 were taken, added with 1 mL of 50% methanol, ground, and extracted overnight. The supernatant was centrifuged and the endogenous melatonin content was determined by HPLC. Figure 9 As shown, the endogenous melatonin content of the three snat asmt comt mutant lines, 3565-5, 3565-13 and 3565-15, was significantly higher than that of the negative control plants, especially 3565-13, which was as high as 746 ng / g, an increase of 146% compared with the negative control.
[0118] The HPLC liquid chromatography method uses a Rigol L3000 high performance liquid chromatograph, an Ultimate XB C18 reverse phase column (250 mm*4.6 mm, 5 μm), and a mobile phase with a ratio of A (methanol): B (0.1% formic acid solution) = 4:6.
[0119] The HPLC liquid chromatography method is as follows: First, turn on the computer, detector, and pump. Then, install the chromatographic column. Open the software and set the method set to 10 μL injection volume, 0.8 mL / min flow rate, 30°C column temperature, 45 min run time, 280 nm excitation wavelength, and 348 nm emission wavelength. Save the method set after completing the settings.
[0120] Example 3, as Figure 10-15 As shown, phenotypic identification of maize multi-gene knockout mutant snat asmt comt plants under drought stress:
[0121] The comt, snat, asmt triple knockout mutant and the negative control (NC) were used as materials for cultivation under a rainproof canopy in an outdoor barrel cultivation area equipped with a large weighing device. One to two plants were grown in 40x60 cm PVP barrels with drain valves located 5 cm from the bottom of the barrels. When the maize reached the jointing to full-mouth stage, robust and consistent-growing NC and triple knockout mutant plants were selected and subjected to drought stress. The soil relative moisture content was controlled at a lower limit of 50%. During the treatment, the soil relative moisture content was controlled by weighing, and the drain valves were kept open. The potting soil was sandy loam soil from the 0-20 cm tillage layer of the field. It was air-dried, crushed, and sieved, and the soil had a field water holding capacity of approximately 22%. After the treatment, samples were taken to determine the antioxidant enzyme activity, reactive oxygen content, malondialdehyde, proline, soluble protein content, soluble sugar content, endogenous melatonin content, abscisic acid content, gibberellin content, auxin content, and cytokinin content. The results showed that the snat asmt comt triple knockout mutant showed strong drought resistance under drought stress.
[0122] The antioxidant enzyme activities measured include peroxidase (POD), ascorbic acid (AsA), and oxidized glutathione (GSSG), wherein the POD measurement result is as follows: Figure 10 AsA determination results are shown in A. Figure 10 As shown in B, the GSSG determination results are as follows Figure 10 As shown in C, the results showed that after drought stress (Drought), the snat asmt comt triple knockout mutant had higher POD and AsA activities and lower GSSG activity compared with the negative control (NC).
[0123] The active oxygen species measured include hydrogen peroxide (H2O2) and superoxide anion (O2 - ), where the determination results of H2O2 are as follows Figure 11 As shown in A, O2 - The measurement results of Figure 11 As shown in B, the results showed that after drought stress (Drought), the snat asmtcomt triple knockout mutant contained lower concentrations of H2O2 and O2 compared with the negative control (NC). - .
[0124] The determination results of malondialdehyde (MDA) are as follows Figure 12 As shown, the results showed that after drought stress (Drought), the snat asmt comt triple knockout mutant contained a lower concentration of MDA content compared with the negative control (NC), indicating that the cell membrane system of the snat asmt comt triple knockout mutant was less damaged under drought stress.
[0125] The determination results of proline are as follows Figure 13 As shown, the results showed that after drought stress (Drought), the snat asmt comt triple knockout mutant contained a lower concentration of proline compared with the negative control (NC), indicating that the cell membrane structure of the snat asmt comt triple knockout mutant was relatively intact under drought stress, and the osmotic balance between its protoplast and the environment was less damaged.
[0126] The determination results of the soluble sugars and soluble protein contents are as follows: Figure 14 As shown in the figure, the results showed that the snat asmt comt triple knockout mutant contained a higher concentration of soluble protein content compared with the negative control (NC) under normal conditions (CK) and drought stress (Drought), while there was no significant difference in the soluble sugar content between the two under treated and untreated conditions.
[0127] The results of the determination of the content of endogenous melatonin (MT), abscisic acid (ABA), cytokinin (CTK), gibberellin (GA) and auxin (IAA) are as follows: Figure 15 As shown, the results showed that the snatasmt comt triple knockout mutant contained high concentrations of MT, ABA, CTK, GA and IAA compared with the negative control (NC), both under normal conditions (CK) and drought stress (Drought).
[0128] Example 4, as Figure 16-20 As shown, phenotypic identification of maize multi-gene knockout mutant snat asmt comt plants under waterlogging stress:
[0129] Inbred lines and triple-knockout mutants were cultivated outdoors under a rain shelter in a barrel-growing area equipped with a large weighing device. One to two plants were planted per barrel in 40x60 cm PVP barrels with drain valves located 5 cm from the bottom. Uniformly growing, robust maize inbred lines and triple-knockout mutants were selected during the jointing to full-mouth stage. Treatments included normal watering (CK), light flooding (CF1, 8 cm water depth, 3 days), and heavy flooding (CF2, 8 cm water depth, 6 days). Water loss was replenished daily at 6:00 PM. Potting soil consisted of 0-20 cm of field soil from the tillage layer, air-dried, crushed, and sieved. The soil was sandy loam with a field water holding capacity of approximately 22%. After the treatment, samples were taken to determine the antioxidant enzyme activity, reactive oxygen content, malondialdehyde, proline, soluble protein content, soluble sugar content, etc. The results showed that the snat asmt comt triple knockout mutant showed strong waterlogging tolerance under different waterlogging stresses.
[0130] The antioxidant enzyme activities measured include catalase (CAT), superoxide dismutase (SOD), peroxidase (POD), ascorbic acid (AsA), and oxidized glutathione (GSSG). The CAT assay results are as follows: Figure 16 As shown in A, the SOD determination results are as follows Figure 16 As shown in B, the POD determination results are as follows Figure 16 As shown in C, the AsA determination results are as follows Figure 16 As shown in D, the GSSG determination results are as follows Figure 16 As shown in Figure E, the results showed that after waterlogging stress, compared with the negative control (NC), the snat asmt comt triple knockout mutant had higher CAT activity and lower SOD and POD activities in light waterlogging (CF1) and heavy waterlogging (CF2), while AsA activity was lower in light waterlogging (CF1) and higher in heavy waterlogging (CF2), and GSSG activity was higher in light waterlogging but had no significant difference in heavy waterlogging.
[0131] The active oxygen species measured include hydrogen peroxide (H2O2) and superoxide anion (O2 - ), where the determination results of H2O2 are as follows Figure 17 As shown, O2 - The measurement results of Figure X As shown in Figure 1, the results showed that after waterlogging stress, the snat asmt comt triple knockout mutant contained lower concentrations of H2O2 and O2 in both light waterlogging (CF1) and heavy waterlogging (CF2) compared with the negative control (NC). - .
[0132] The determination results of malondialdehyde (MDA) are as follows Figure 18 The results showed that after waterlogging stress, the snat asmtcomt triple knockout mutant contained lower concentrations of MDA content in both light waterlogging (CF1) and heavy waterlogging (CF2) compared with the negative control (NC), indicating that the cell membrane system of the snat asmt comt triple knockout mutant was less damaged under waterlogging stress.
[0133] The determination results of proline are as follows Figure 19The results showed that after waterlogging stress, the snatasmtcomt triple knockout mutant contained lower concentrations of proline content in both light waterlogging (CF1) and heavy waterlogging (CF2) compared with the negative control (NC), indicating that the cell membrane structure of the snatasmtcomt triple knockout mutant was relatively intact under different waterlogging stresses, and the osmotic balance between its protoplasts and the environment was less damaged.
[0134] The determination results of the soluble sugars and soluble protein contents are as follows: Figure 20 The results showed that after waterlogging stress, compared with the negative control (NC), in light waterlogging (CF1), the snat asmt comt triple knockout mutant contained lower concentrations of soluble sugar and soluble protein content, while in severe waterlogging (CF2), the snat asmt comt triple knockout mutant contained higher soluble sugar content while its soluble protein content had no significant difference.
[0135] Example 4, as Figure 21-25 As shown, phenotypic identification of maize multi-gene knockout mutant snat asmt comt plants under drought and flood stress:
[0136] Using inbred lines and triple knockout mutants as materials, they were planted in a 40*60 (cm) PVP barrel with a drain valve 5 cm below the barrel in an outdoor barrel planting area with a large weighing device under a rainproof awning. 1-2 plants were planted in each barrel. When the corn was in the jointing-opening stage, the inbred lines and triple knockout mutants with consistent growth and robustness were selected. The continuous normal water supply (CK), mild drought to mild waterlogging stress (DFAA1), mild drought to severe waterlogging stress (DFAA2), severe drought to mild waterlogging stress (DFAA3), and severe drought to mild waterlogging stress (DFAA4) were set. Waterlogging stress (DFAA3) and severe drought-to-severe waterlogging stress (DFAA4) were tested. The lower limit of soil relative moisture content (RMC) in the normal water supply treatment was 70%. Drought treatments were divided into moderate drought (RMC 60% for 10 days) and severe drought (RMC 50% for 10 days). Waterlogging treatments were divided into mild waterlogging (8 cm water depth for 3 days) and severe waterlogging (8 cm water depth for 6 days). Water loss was replenished at 6:00 PM daily. The drought-to-waterlogging rapid transition treatment included a 10-day drought and either a 3-day or 6-day waterlogging. The drain valve remained open during the drought treatment and closed during the waterlogging treatment. After the waterlogging ended, the valve was reopened to rapidly remove excess water, allowing the soil relative moisture content to return to normal water supply conditions within a short period of time. To more precisely control the water consumption and drought severity of each corn plant and minimize the impact of spatial variation in soil moisture and nutrients on research results, this project used a gravimetric method to control soil relative moisture content. Potting soil consisted of field soil from the 0-20 cm tillage layer, air-dried, crushed, and sieved. The soil was sandy loam with a field water holding capacity of approximately 22%. After treatment, samples were collected to measure antioxidant enzyme activity, reactive oxygen species (ROS), malondialdehyde (MDA), proline, soluble protein, soluble sugar, endogenous melatonin, abscisic acid (ABA), gibberellins, auxins, and cytokinins. The results showed that the snat asmt comt triple knockout mutant exhibited strong resistance to rapid drought-flood cycles.
[0137] The antioxidant enzyme activities measured include catalase (CAT), superoxide dismutase (SOD), peroxidase (POD), ascorbic acid (AsA), and oxidized glutathione (GSSG). The CAT assay results are as follows: Figure 21 As shown in A, the SOD determination results are as follows Figure 21 As shown in B, the POD determination results are as follows Figure 21 As shown in C, the AsA determination results are as follows Figure 21 As shown in D, the GSSG determination results are as follows Figure 21As shown in Figure E, the results showed that compared with the negative control (NC), the snat asmt comt triple knockout mutant had higher SOD activity in CK, DAFF1, DAFF2 and DAFF4, higher CAT activity in DAFF1, DAFF2 and DAFF3, higher POD activity in CK, DAFF1, DAFF2 and DAFF3, higher AsA activity in DAFF2, DAFF3 and DAFF4, and higher GSSG activity in DAFF1 and DAFF4.
[0138] The active oxygen species measured include hydrogen peroxide (H2O2) and superoxide anion (O2 - ), where the determination results of H2O2 are as follows Figure 22 As shown, O2 - The measurement results of Figure X As shown in Figure 1, the results showed that compared with the negative control (NC), the snatasmt comt triple knockout mutant contained lower concentrations of H2O2 and O2 in DAFF1, DAFF2, DAFF3, and DAFF4. - .
[0139] The determination results of malondialdehyde (MDA) are as follows Figure 23 As shown, the results showed that compared with the negative control (NC), the snatasmtcomt triple knockout mutant contained lower concentrations of MDA in DAFF1, DAFF2, DAFF3 and DAFF4, indicating that the cell membrane system of the snat asmt comt triple knockout mutant was less damaged under drought and flood stress.
[0140] The determination results of proline are as follows Figure 24 As shown, the results showed that compared with the negative control (Negative Control, NC), the snat asmt comt triple knockout mutant contained a lower concentration of proline content, indicating that the snat asmt comt triple knockout mutant had a lower content of proline in DAFF2, DAFF3 and DAFF4, indicating that the cell membrane structure of the triple knockout mutant was relatively intact and the osmotic balance between its protoplast and the environment was less damaged.
[0141] The determination results of the soluble sugars and soluble protein contents are as follows: Figure 25As shown, the results showed that compared with the negative control (NC), the snat asmt comt triple knockout mutant contained higher concentrations of soluble sugar and soluble protein in DAFF1, DAFF2 and DAFF3, while both contents were lower in DAFF4.
[0142] These results suggest that the maize multi-gene knockout mutant snat asmt comt exhibits strong resistance to drought, waterlogging, and the alternating cycle of drought and waterlogging. Therefore, using the maize multi-gene knockout mutant snat asmt comt not only effectively and specifically investigates the specific mechanisms by which endogenous melatonin elevation regulates crop stress resistance, but also demonstrates that the ZmSNAT, ZmASMT1, and ZmCOMT genes play a crucial role in regulating maize stress resistance. Furthermore, the maize multi-gene knockout mutant snat asmt comt has significant application potential and value in genetic engineering breeding for maize resistance.
[0143] Sequence Listing
[0144] <110> Farmland Irrigation Research Institute, Chinese Academy of Agricultural Sciences
[0145] <120> A corn melatonin synthesis multi-gene knockout mutant and its application
[0146] <160> 7
[0147] <170> SIPOSequenceListing 1.0
[0148] <210> 1
[0149] <211> 6803
[0150] <212> DNA
[0151] <213> ZmSNAT genome sequence
[0152] <400> 1
[0153]
[0154] <210>2
[0155] <211>2197
[0156] <212>DNA
[0157] <213>ZmCOMT genomic sequence
[0158] <400>2
[0159] CTAATCGTAATAGCCATGGGCTCCACCGCCGGCGACGTGGCCGCGGTGGTGGACGAGGAGGCGTGCATGT
[0160] ACGCGATGCAGCTGGCGTCGTCGTCCATCCTGCCCATGACGCTGAAGAACGCCATCGAGCTGGGCCTGCT
[0161] GGAGGTGCTGCAGAAGGAGGCCGGCGGCGGCAAGGCGGCGCTGGCGCCCGAGGAGGTGGTGGCGCGGATG
[0162] CCCGCGGCGCCCGGCGACCCCGCCGCCGCGGCGGCCATGGTGGACCGCATGCTCCGCCTGCTCGCCTCCT
[0163] ACGACGTCGTCCGGTGCCAGATGGAGGACCGGGACGGCCGGTACGAGCGCCGCTACTCCGCCGCGCCCGT
[0164] CTGCAAGTGGCTCACCCCCAACGAGGACGGCGTGTCCATGGCCGCCCTCGCGCTCATGAACCAGGACAAG
[0165] GTCCTCATGGAGAGCTGGTGAGTAGTAGCCGCATCGCATCAACCACCTTCTACCTATCTATATCCATCAC
[0166] TTGTTGCTGCTGGCGTGCGCGGCATGCATGATGACGAGCTCGCTCATCATTGGTGCTACTAGTGATTTAT
[0167] TTCGTCCAGTAAAATTAATTAAGGTGCGCTGCTACTCTACTGGCTGCGGCTAGCACAAGGCTGGAAATAG
[0168] TTGTTACTTGTTATACACGATATAATATTTCTCTAGAACAAAAAAGATTTTTTTTTTATAAAAAGCAAGC
[0169] AAGAAAGAAAGTGAGTGACTTCATGTTTTTCCTAAAAAAAAGTTAGGAGTGGGATGGAAAAGTCAGCAAG
[0170] GACCACTTGTTTGTTGTCCACTATCCATCCAGTGGGTGAGACTTTTTTGCGAGACGGAGCACTATATTAT
[0171] TGGCCGAGTCCTTTTTCTGTATCCGCAAAACGGCAGCCGTCGATCGCCGGACGGATCGACGGCTCACATG
[0172] AGTGTCGAGTCCAATTCCAACCACGAGGGCGGCAAGGAAAACCATCCGTGCTGGTCTGGACTTTTTGCCA
[0173] AACTCCATTCAGCCATTCGCCGACTGAAGGTGAATCTTCAGACAGCCAGATTGTTTGGTGTCTAGTGTGT
[0174] GCGAAGATGGCGTAGAAAAGACTGAGAGACAGTTGGCTCACACAGACAAGTGACAACTGACTATAGTATC
[0175] TGCCTGCCTGGCTGATGCTGATAGAGATGGGGACTCTTGTCCTGTCTGTTTCTTGTATGCGCTGATCTGA
[0176] TTCTGATCACTGCCACTCTGCCAGGTACTATCTCAAGGACGCGGTGCTGGACGGCGGCATCCCGTTCAAC
[0177] AAGGCGTACGGGATGACGGCGTTCGAGTACCACGGCACGGACTCGCGCTTCAACCGCGTGTTCAACGAGG
[0178] GCATGAAGAACCACTCGGTGATCATCACCAAGAAGCTGCTGGACTTCTACACGGGCTTCGAGGGCGTGTC
[0179] GACGCTGGTGGACGTGGGCGGCGGCGTGGGCGCCACGCTGCACGCCATCACGTCCCGCCACCCGCACATC
[0180] TCCGGGGTCAACTTCGACCTGCCGCACGTCATCTCCGAGGCGCCGCCGTTCCCCGGCGTGCGCCACGTGG
[0181] GCGGGGACATGTTCGCGTCCGTGCCCGCCGGCGACGCCATCCTCATGAAGTGGATCCTCCACGACTGGAG
[0182] CGACGCGCACTGCGCCACGCTGCTCAAGAACTGCTACGACGCGCTGCCGGAAAATGGCAAGGTCATCGTC
[0183] GTCGAGTGCGTGCTGCCGGTCAACACGGAGGCCACCCCCAAGGCGCAGGGCGTCTTCCACGTCGACATGA
[0184] TCATGCTCGCGCACAACCCCGGCGGCAAGGAGCGGTACGAGCGCGAGTTCCGCGAGCTCGCAAAGGGCGC
[0185] CGGCTTCTCCGGGTTCAAGGCCACCTACATCTACGCCAACGCCTGGGCCATCGAGTTCATCAAGTGAACC
[0186] ACCGTCGCCGCGATGAGATGGCATGGCTGCCACATGCTTTGCTTGCTTGGTCCTCGTATCGTACGTCGCC
[0187] GTCGTCGTCTTCTTCTGGTTATTGCGCTGCTACCTCGCTGCTCTCGCGTATGCATGTACTTTTGCTTAAT
[0188] TTTCTTTCTTCATATCATGCACTCTGGCTGGCCTAGACTGCCCCCGATCCATGGTGGCCGGTACGTCTTG
[0189] TCGAGCTCTTGCATGTCGTGGATTCTAAATTCTTCTTCTGCGTCGAATTGTCTCTGCCATGTGCGAGTAA
[0190] TAACAATCAAGGTTATACTTACGATAC
[0191] <210>3
[0192] <211>1513
[0193] <212>DNA
[0194] <213>ZmASMT1 genomic sequence
[0195] <400>3
[0196]
[0197] <210>4
[0198] <211>332
[0199] <212>DNA
[0200] <213>ZmSNAT Mutation Detection Sequence in Triple Knockout Mutant
[0201] <400>4
[0202] AATTCATTTTTCTAGATGATGAACATCTTAGTGTACTTGTAGAAGTTATTTGACAGAGGGAGATGAGAAGAAACAGCTCATTGGGATGGCACGAGCAACCTCAGACCAATGCCTTCAATGCAACGATTTGGGATGTCCTTGTTGATCCTTCATACCAGGTGAGCTAGTGAACTTGGCTGTTTCGCCTTTTCAGAATCCTACCCCACCATTTCTGCTGTCTATATTAAAGAAGAATTATCATGAATGGCTGAGACTTCAATTATTTCAGGGTCAGGGTCTTGGTAAAGCACTCATGGAGAAAGTAATTCGTACTTTGCTCCAGCGAGACATCA
[0203] <210>5
[0204] <211>753
[0205] <212>DNA
[0206] <213>ZmCOMT Mutation Detection Sequence in Triple Knockout Mutant
[0207] <400>5
[0208] GGTGTCTAGTGTGTGCGAAGATGGCGTAGAAAAGACTGAGAGACAGTTGGCTCACACAGACAAGTGACAA
[0209] CTGACTATAGTATCTGCCTGCCTGGCTGATGCTGATAGAGATGGGGACTCTTGTCCTGCTGTCTGTTCTT
[0210] GTATAAATCTCCGTTGTCAAATATTTATCGTCCGATTATTTATTTTTAAACTAAACAACGACAAATAAAA
[0211] AAGAACGAGGTTGCAAAAGATAGATACAAACCAAAGGATGTCGTCGCTGTGCGCTGATCTGATCACTGCC
[0212] ACTCTGCCAGGTACTACCTCAAGGACGCGGTGCTGGACGGCGGCATCCCGTTCAACAAGGCGTACGGGAT
[0213] GACGGCGTTCGAGTACCACGCACGGACGCGCGCTTCAACCGCGTGTTCAACGAGGGCATGAAGAACCACT
[0214] CGGTGATCATCACCAAGAAGCTGCTGGACTTCTACACGGGCTTCGAGGGCGTGTCGACGCTGGTGGACGT
[0215] GGGCGGCGGCGTGGGCGCCACGCTGCACGCCATCACGTCCCGCCACCCGCACATCTCCGGGGTCAACTTC
[0216] GACCTGCCGCACGTCATCTCCGAGGCGCCGCCGTTCCCCGGCGTGCGCCACGTGGGCGGGGACATGTTCG
[0217] CGTCCGTGCCCGCCGGCGACGCCATCCTCATGAAGTGGATCCTCCACGACTGGAGCGACGCGCACTGCGC
[0218] CACGCTGCTCAAGAACTGCTACGACGCGCTGCCGGAAAATGGCAAGGTCATCG
[0219] <210>6
[0220] <211>773
[0221] <212>DNA
[0222] <213>Mutation detection sequence of ZmASMT1 in triple knockout mutants
[0223] <400>6
[0224] CAGCAACAATCTCGGACATCATCACCGAGACCGGCGTCGACCCGTCGAAGCTCCCGTATCTCCGACGGCTCATGCGCGTGCTTACCGTCTCCAGCATCTTGGCCACCACAGGCACAGACGAGACTGAGACTGAGAGCGACGACAGTACTGTTTACAAGCTCACTCCGGCGTCCCGCCTCCTCGTAAGCGGCGCGGGGGCACCGACCTCGTGCGACATATCGCCGATGCTGGACCTTCTGATGCGCCCCACTACGTCGGTCGCCACCTACTTCAGCCTGGAAGAGTGGTTCAAGGAACGCGGGCGCCACCGCCACGCTCTTCGAGGTGGCGCACGGCATGTCCCCGTGGAGCTTGACGAAGAACGACGCGCTGTACAACAAGACCTTGAACGACGGGTGCGCGGCGGACAGCAACTTCGCCATGGACACGCTCCTGAGAGAGCCCCGGGCCGCGGGTATATTCCGCGGGCTCGGCTCGCTCGTGGACGTCGGCGGCGGCCACGGCGCCGCTGCGATGGCCATCGCTAGGGCCTTCCCGCACATCCGGTGCAGCGTGTTGGACCTCGAGCAGGTGGTCAGCGGGGCACCTGATGATGGCACGGTGAAGTTCATCGCCGGCGACATGTTCGAGTCTATCCCGGCTGCAGATTGTGTCTTGCTTAAGGTACTCCCATCTGTTCTGCATTACTACGTATATATATATGCATTACCTGTCTATGCATGTATTTCAGTATGTTCTGCATTGCTGGGACGACGAAAGCAGCGTCAAGATCC
[0225] <210>7
[0226] <211>10540
[0227] <212>DNA
[0228] <213> pEGZMCas9Pubi-B vector simultaneously inserts SNAT, ZmASMT and COMT fragments into the pEGZMCas9Pubi-B-SNAT-ZmASMT1-COMT vector sequence
[0229] <400> 7
[0230]
Claims
1. A corn melatonin synthesis multi-gene knockout mutant, characterized by: The three genes knocked out in the maize melatonin synthesis multi-gene knockout mutant are ZmSNAT, ZmASMT1 and ZmCOMT, and their nucleotide sequences after knockout are shown in SEQ ID NO 4, SEQ ID NO 5 and SEQ ID NO 6, respectively.
2. The corn melatonin synthesis multi-gene knockout mutant according to claim 1, characterized in that: The nucleotide sequences of the genes ZmSNAT, ZmASMT1 and ZmCOMT in the B73 genome are shown as SEQ ID NO 1, SEQ ID NO 2 and SEQ ID NO 3, respectively.
3. An expression vector containing the corn melatonin synthesis multi-gene knockout mutant according to claim 1, characterized in that: The expression vector is pEGZMCas9Pubi-B-SNAT-ZmASMT1-COMT, and its sequence is shown in SEQ ID NO 7.
4. A method for preparing an expression vector for a corn melatonin synthesis multi-gene knockout mutant according to claim 3, characterized in that: The preparation method comprises the following steps: S1. Design sgRNA target sequences for ZmSNAT, ZmASMT1, and ZmCOMT genes, respectively; S2. Construct the sgRNA expression cassette fragment to obtain the single-enzyme-digested pLHRNAipEGZMCas9Pubi-B linear vector; S3. Perform a homologous recombination reaction between the sgRNA expression cassette fragment in step S2 and the single-enzyme-cut pLHRNAipEGZMCas9Pubi-B linear vector to obtain the desired expression vector of the maize melatonin synthesis multi-gene knockout mutant.
5. Use of the expression vector of the corn melatonin synthesis multi-gene knockout mutant according to claim 3 in preparing the corn melatonin synthesis multi-gene knockout mutant.
6. Use of the corn melatonin synthesis multi-gene knockout mutant according to claim 1 in adverse stress, characterized in that: The application includes subjecting a corn melatonin synthesis multi-gene knockout mutant to drought stress treatment, whereby the plant exhibits drought resistance; subjecting a corn melatonin synthesis multi-gene knockout mutant to waterlogging stress treatment, whereby the plant exhibits relatively strong waterlogging tolerance; or subjecting a corn melatonin synthesis multi-gene knockout mutant to drought-waterlogging rapid transition stress treatment, whereby the plant exhibits relatively strong resistance.
7. Use of the maize melatonin synthesis multi-gene knockout mutant according to claim 1 in studying the specific regulatory functions of ZmSNAT, ZmASMT1 and ZmCOMT genes on maize resistance.
8. Use of the corn melatonin synthesis multi-gene knockout mutant according to claim 1 in studying the regulatory mechanism of endogenous melatonin on corn resistance.
9. The method for preparing the expression vector of the corn melatonin synthesis multi-gene knockout mutant according to claim 4, characterized in that: The target sequence for ZmSNAT gene editing in S1 is: ZmSNAT-T1: 5'-TGCATTGAAGGCATGGTCTGAGG-3', the target sequence for ZmASMT1 gene editing is: ZmASMT1-T2: 5'-GAAGAGTGGTTCAAGGACGCGGG-3', and the target sequence for ZmCOMT gene editing is: ZmCOMT-T3: 5'-GGCGTTCGAGTACCACGGCACGG-3'.
10. The method for preparing the expression vector of the corn melatonin synthesis multi-gene knockout mutant according to claim 4, characterized in that: The single enzyme digestion in S2 is performed using HindIII restriction endonuclease.