SiRNA and its modification for inhibiting xdh gene expression and application

By targeting and delivering modified siRNA conjugated to the liver via GalNAc, the problem of insufficient liver delivery and stability of existing XDH gene inhibitors is solved, achieving efficient and stable reduction of uric acid levels, and reducing drug side effects and costs.

CN120569479BActive Publication Date: 2026-06-05LIVZON PHARM GRP INC
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
LIVZON PHARM GRP INC
Filing Date
2024-09-03
Publication Date
2026-06-05

Smart Images

  • Figure CN120569479B_ABST
    Figure CN120569479B_ABST
Patent Text Reader

Abstract

Provided are siRNA and modified siRNA for inhibiting XDH gene expression and applications thereof, including a sense strand and an antisense strand; the sense strand and / or the antisense strand has a length ranging from 19 to 25 nucleotides, the antisense strand is reverse complementary to a segment on a target gene; the sense strand has a nucleotide sequence as shown in SEQ ID NO: 1-14, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 18-31. The siRNA molecules and the modified siRNA molecules have high stability and / or high inhibitory activity. The siRNA molecules conjugated with ligands have high inhibitory activity and stability, good liver targeting and the ability to promote endocytosis, can reduce the influence on other tissues or organs and reduce the amount of siRNA molecules, and can achieve the purposes of reducing toxicity and reducing cost.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to siRNA that inhibits XDH gene expression and its modifications and applications. Background Technology

[0002] Hyperuricemia refers to a blood uric acid level exceeding the normal range, generally less than 420 μmol / L for men and less than 360 μmol / L for women. Elevated uric acid levels are the biochemical basis for hyperuricemia and gout. Gout is a chronic metabolic disease caused by the deposition of urate crystals in joints and other tissues, manifesting as recurrent acute arthritis, chronic joint deformities, tophi, kidney damage, and urinary tract stones.

[0003] The occurrence of hyperuricemia and gout is related to both genetic and environmental factors. Genetic factors mainly include gene variations affecting uric acid production and excretion, such as the xanthine oxidase gene and the renal uric acid transporter gene. Environmental factors mainly include high-purine diets, alcoholism, obesity, hypertension, kidney disease, and medications. The mechanisms of hyperuricemia and gout involve the formation and deposition of urate crystals, activation of inflammatory responses, increased oxidative stress, and damage to endothelial function.

[0004] In recent years, with economic development and changes in lifestyle, the prevalence of hyperuricemia and gout has been on the rise and affecting younger people. Statistics show that there are approximately 930 million people worldwide suffering from hyperuricemia and gout, and this number is projected to reach 1.18 billion by 2025.

[0005] Hyperuricemia and gout not only affect patients' quality of life but are also closely related to the development of various chronic non-communicable diseases, such as cardiovascular disease, metabolic syndrome, and chronic kidney disease. Therefore, timely diagnosis and treatment of hyperuricemia and gout have significant clinical and public health value. Current treatment methods mainly include drug therapy and non-drug therapy. Drug therapy is mainly divided into two phases: the acute phase and the remission phase. The acute phase focuses on anti-inflammatory and analgesic treatment, while the remission phase focuses on lowering uric acid levels. Non-drug therapy mainly includes lifestyle modifications, dietary control, weight loss, and increased exercise. The combined use of drug and non-drug therapies can effectively control the development of hyperuricemia and gout and prevent complications. Currently, the main drugs used clinically to treat hyperuricemia and gout fall into the following categories:

[0006] Currently, the main drugs for the clinical treatment of hyperuricemia and gout include xanthine oxidase (XDH) inhibitors: these reduce uric acid production and lower serum uric acid levels by inhibiting xanthine oxidase, making them suitable for patients with increased uric acid production. Commonly used drugs include allopurinol and febuxostat. Allopurinol is a first-line uric acid-lowering drug, with a starting dose of 50–100 mg / day and a maximum dose of 800 mg / day, and the dosage needs to be adjusted according to renal function. Febuxostat is a specific xanthine oxidase inhibitor, with a starting dose of 20 mg / day and a maximum dose of 80 mg / day, suitable for patients with renal insufficiency, but its potential cardiovascular risks should still be monitored. Summary of the Invention

[0007] This invention designs corresponding siRNAs for XDH and delivers them effectively to the liver by coupling with GalNAc. This interferes with XDH mRNA in the liver, effectively reducing the expression of XDH protein and the synthesis of uric acid, thereby treating hyperuricemia.

[0008] The XDH gene targeted in this invention is the gene shown in Genbank registry number NM-000379.4.

[0009] The first aspect of this invention discloses a siRNA that inhibits the expression of the xanthine oxidase gene, comprising a sense strand and an antisense strand; the sense strand and / or the antisense strand having a length in the range of 19-25 nucleotides, wherein the antisense strand is inversely complementary to a segment on the target gene;

[0010] The sense strand and / or the antisense strand may have nucleotides of any length of 19, 20, 21, 22, 23, 24 or 25; the sense strand and the antisense strand are complementary to form a double-stranded RNA.

[0011] The sense strand has the nucleotide sequences shown in SEQ ID NO: 1-14, and the antisense strand has the nucleotide sequences shown in SEQ ID NO: 18-31. The specific sequence of the siRNA that inhibits xanthine oxidase gene expression is shown below:

[0012]

[0013]

[0014]

[0015]

[0016]

[0017]

[0018]

[0019]

[0020]

[0021]

[0022]

[0023]

[0024]

[0025]

[0026]

[0027]

[0028]

[0029]

[0030]

[0031]

[0032]

[0033] Furthermore, the 3' ends of the sense and antisense strands of the nucleotide sequence are connected with up to two additional nucleotides to form overhangs, the overhangs being selected from nucleotides modified with A, C, G, U, T or A, C, G, U, T.

[0034] Furthermore, the siRNA is also modified, wherein the modified siRNA is selected from those with a glycosidic modification at the 2' position, or at least one phosphate ester group containing a modified group, or one or more nucleotide analogs; the polynucleotide molecule is chemically synthesized using naturally occurring nucleotides or various modified nucleotides, wherein the modified nucleotide is designed to increase the biological stability of the molecule or to increase the physical stability of the double strand formed between the polynucleotide molecule and the target nucleic acid.

[0035] The 2'-modified nucleotides include nucleotides modified with 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-ODMAP), TO-dimethylaminoethoxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamido (2'-O-NMA).

[0036] Specifically, the phosphate ester group containing the modifying group is a thiophosphate ester group formed by replacing at least one oxygen atom in the phosphate diester bond with a sulfur atom;

[0037] Nucleotide analogs are selected from isonucleotides, LNA, ENA, cEtBNA, UNA, or GNA.

[0038] The specific structures of the sense and antisense strands of the modified siRNA molecule are as follows:

[0039]

[0040]

[0041] Wherein, dA represents deoxyribonucleotide A; mA, mU, mC, and mG represent ribonucleotides A, U, C, and G modified with 2'-O-methyl, respectively; fA, fU, fC, and fG represent ribonucleotides A, U, C, and G modified with 2'-fluorine, respectively; -s- indicates that the two nucleotides are linked by a phosphate thiophosphate backbone; GNA-U represents ribonucleotide U modified with GNA.

[0042] As a specific embodiment of the present invention, a conjugate is obtained by coupling modified siRNA that inhibits the expression of the XDH target gene with a ligand. This conjugate can help the siRNA be delivered to the target organ or tissue and enter the cell. The ligand is conjugated to the 3' end of the positive strand. The ligand includes, but is not limited to, GalNAc, cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, N-acetylglucosamine derivatives or analogs. The ligand is preferably GalNAc.

[0043] In some schemes, the sense and antisense strand structures of the ligand-conjugated siRNA molecule are shown below:

[0044]

[0045] L-96 is GalNac-L96, a G-rich oligonucleotide with a long GalNAc linker.

[0046] The second aspect of this invention discloses biological materials related to the above-mentioned siRNA, which are any of the following:

[0047] 1) A vector containing the above-mentioned siRNA molecules;

[0048] 2) Reagents or kits containing the siRNA described above or the vector described in 1);

[0049] 3) A pharmaceutical composition comprising the above-mentioned siRNA molecule and other pharmaceutically acceptable components.

[0050] The pharmaceutically acceptable other components include, but are not limited to, water, saline, pH buffer, protectant, osmotic pressure regulator, excipient, diluent, disintegrant, binder, lubricant, sweetener, preservative, or combinations thereof. The protectant may be at least one selected from inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose, and glucose.

[0051] The aforementioned carriers include, but are not limited to, one or more of the following: magnetic nanoparticles (such as Fe2O3), carbon nanotubes, mesoporous silica, calcium phosphate nanoparticles, polyethyleneimine, polyamide amine dendritic polymers, polylysine, chitosan, poly-D or L-type lactic acid / glycolic acid copolymers, poly(aminoethyl ethylene phosphate), and poly(N,N-dimethylaminoethyl methacrylate) and their derivatives.

[0052] Furthermore, the dosage form of the pharmaceutical composition may be a liquid formulation (e.g., an injection) or a lyophilized powder for injection. When administered, the lyophilized powder for injection is mixed with liquid excipients to form a liquid formulation. The liquid formulation may be used, but is not limited to, for subcutaneous, intramuscular, or intravenous injection, and may also be administered via a spray to the lungs, or via a spray to other organs or tissues (e.g., the liver).

[0053] The third aspect of this invention discloses the application of the above-mentioned biomaterials in the treatment of hyperuricemia.

[0054] In some embodiments, the present invention provides an in vivo method comprising alleviating or treating a disease or symptom mediated by the XDH gene in a subject, said disease or symptom including hyperuricemia or gout. The method may include administering to the subject an effective amount, such as a preventative or therapeutic amount, of the aforementioned siRNA molecule or pharmaceutical composition.

[0055] The present invention achieves the following beneficial technical effects:

[0056] 1. siRNA molecules and modified siRNA molecules have high stability and / or high inhibitory activity.

[0057] 2. Ligand-conjugated siRNA molecules maintain high inhibitory activity and stability while also exhibiting good liver targeting and the ability to promote endocytosis. This can reduce the impact on other tissues or organs and decrease the amount of siRNA molecules used, thereby reducing toxicity and lowering costs. Attached Figure Description

[0058] Figure 1 The diagram shows how the naked siRNA sequence in Example 1 can reduce the expression of XDH mRNA in Hep-G2 cells.

[0059] Figure 2 The diagram shows that the siRNA modification sequence in Example 2 can reduce the expression of XDH mRNA in Hep-G2 cells.

[0060] Figure 3 The diagram shows that the siRNA modification sequence coupled with GalNAc in Example 3 can reduce the expression of XDH mRNA in Hep-G2 cells.

[0061] Figure 4A -D represents the IC50 of the siRNA modification sequence coupled with GalNAc in Example 4, which reduces the expression of XDH mRNA in Hep-G2 cells.

[0062] Figure 5 The diagram shows that the siRNA modification sequence coupled with GalNAc in Example 5 can reduce the expression of XDH mRNA in the liver of SD rats.

[0063] Figure 6 This is a diagram showing the efficacy results of the GalNAc-coupled sequence in a mouse model of hyperuricemia in Example 6.

[0064] Figure 7 This is a diagram showing the persistence of efficacy of the GalNAc conjugate sequence in a mouse model of hyperuricemia in Example 7.

[0065] Figure 8 This is a diagram showing the persistence of efficacy of the GalNAc-coupled sequence in the cynomolgus monkey hyperuricemia model in Example 8. Detailed Implementation

[0066] It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments, and those skilled in the art will readily be able to modify or appropriately alter and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to implement and apply the technology of this invention.

[0067] Example 1: Screening for the effect of naked sequence knockdown

[0068] 1) Human liver cancer cells Hep-G2 in the logarithmic growth phase were digested with trypsin (purchased from the cell bank of Kunming Institute of Physics, Chinese Academy of Sciences), and digestion was terminated with complete medium supplemented with 10% FBS. Cells were collected by centrifugation, resuspended in medium supplemented with 10% FBS, and counted with a hemocytometer. Then, 50,000 cells were added to each well of a 24-well plate for culture.

[0069] 2) Preparation of LipoRNAiMAX (Lipofectamine RNAiMAX) (purchased from Invitrogen) and siRNA mixture, specifically using the following sequences: where overhangs are generated in some sequences, the overhangs are indicated in parentheses in the table below.

[0070]

[0071]

[0072] Dilute 10 nM siRNA / well and 1.5 μL of LipoRNAiMAX (invitrogen) separately in 25 μL of serum-free culture medium (Opti-MEM, purchased from Gibco). Then mix the siRNA solution with the LipoRNAiMAX (invitrogen) solution and incubate at room temperature for 5 minutes.

[0073] 3) Add 50 μL of the corresponding group's siRNA and LipoRNAiMAX (invitrogen) mixed solution to each well.

[0074] 4) After culturing for 48 hours, discard the culture medium, wash twice with enzyme-free PBS, add lysis buffer (BioFlux) to lyse the cells, add chloroform (MREDA) for extraction, vortex to mix, let stand at room temperature for 2-3 minutes, centrifuge, transfer the supernatant after separation to a well plate and bind with binding buffer, use a nucleic acid extractor, and arrange the well plates in the order according to the kit instructions (MagaBio plus Total RNA Purification Kit II, manufacturer: Borui, batch number BSC69L1E) and use the BSC69 program to extract RNA.

[0075] 5) Prepare the qPCR system and perform it on ice. Add 1 μL One Step SYBR Green Mix (Novizan), 10 μL 2*One Step SYBR Green Mix (Novizan), 0.4 μL hYJH-012 3PF, and 0.4 μL hYJH-012 3PR to each well. Dilute 100 ng RNA in 8.2 μL RNase ddH2O (Novizan) and add it to the well. Mix well and place in the qPCR instrument for reaction.

[0076] PCR reaction conditions: 50℃ for 15 minutes pre-denaturation, 95℃ for 1 minute, 95℃ for 15 seconds annealing, 60℃ for 1 minute extension, for 39 cycles.

[0077] PCR primers: hYJH-012 3PF (SEQ ID NO:65): NF05_300300, hYJH-012 3PR (SEQ ID NO:66): NF05_300301,

[0078] Target name Sequence (5'-3') XDH hYJH-012 3P F TTTCTGAATCAGGCAGGAGC XDH hYJH-012 3P R GGCACAGTGTTAGTGCTTGTC

[0079] Novizan reagent kit: batch number 7E750A3

[0080] The results showed that after LipoRNAiMAX transfection, the YJH-012-1609 sequence had a 43% inhibition rate, the YJH-012-3043 sequence had a 21% inhibition rate, the YJH-012-3047 sequence had a 53% inhibition rate, and the YJH-012-ARH sequence (positive control sequence) had a 50% inhibition rate, with all differences being statistically significant. Figure 1 As shown.

[0081] Example 2: Screening for the effect of modified sequence knockdown

[0082] 1) Human liver cancer cells Hep-G2 in the logarithmic growth phase were digested with trypsin (purchased from the cell bank of Kunming Institute of Physics, Chinese Academy of Sciences), and digestion was terminated with complete medium supplemented with 10% FBS. Cells were collected by centrifugation, resuspended in medium supplemented with 10% FBS, and counted with a hemocytometer. Then, 50,000 cells were added to each well of a 24-well plate for culture.

[0083] 2) Preparation of LipoRNAiMAX (invitrogen) and siRNA mixture, specifically using the following sequences: Some sequences generate protrusions, and the protrusions are indicated in parentheses in the table below.

[0084]

[0085]

[0086]

[0087] Dilute 10 nM / well of siRNA and 1.5 μL of LipoRNAiMAX (purchased from Invitrogen) separately in 25 μL of serum-free culture medium (Opti-MEM, purchased from Gibco). Then mix the siRNA solution with the LipoRNAiMAX (Invitrogen) solution and incubate at room temperature for 5 minutes.

[0088] 3) Add 50 μL of the corresponding group's siRNA and LipoRNAiMAX (invitrogen) mixed solution to each well.

[0089] 4) After culturing for 48 hours, discard the culture medium, wash twice with enzyme-free PBS, add lysis buffer (BioFlux) to lyse the cells, add chloroform (MREDA) for extraction, vortex to mix, let stand at room temperature for 2-3 minutes, centrifuge, transfer the supernatant after separation to a well plate and bind with binding buffer, use a nucleic acid extractor, and arrange the well plates in the order according to the kit instructions (MagaBio plus Total RNA Purification Kit II, manufacturer: Borui, batch number BSC69M1E) and use the BSC69 program to extract RNA.

[0090] 5) Prepare the qPCR system and perform it on ice. Add 1 μL One Step SYBR Green Mix (Novizan), 10 μL 2*One Step SYBR Green Mix (Novizan), 0.4 μL hYJH-012 4PF, and 0.4 μL hYJH-012 4PR to each well. Dilute 100 ng RNA in 8.2 μL RNase ddH2O (Novizan) and add it to the well. Mix well and place in the qPCR instrument for reaction.

[0091] PCR reaction conditions: 50℃ for 15 minutes pre-denaturation, 95℃ for 1 minute, 95℃ for 15 seconds annealing, 60℃ for 1 minute extension, for 39 cycles.

[0092] PCR primers: hYJH-012 4PF (SEQ ID NO:67): NF07_182005, hYJH-012 4PR (SEQ ID NO:68): NF07_182006,

[0093]

[0094]

[0095] Novizan reagent kit: batch number 7E750A3

[0096] The results showed that after transfection with LipoRNAiMAX, both YJH-012-1609 and its modified sequences had inhibitory effects, with the YJH-012-1609mE1 sequence showing the best inhibition rate, reaching 70%. Similarly, both YJH-012-3047 and its modified sequences showed inhibitory effects, with the YJH-012-3047mE+2 sequence showing the best inhibition rate, reaching 61%, and exhibiting a significant difference. The positive control modified sequences YJH-012-ALN m1 and YJH-012-ARH m1 showed inhibition rates of 58% and 36%, respectively. Figure 2 As shown.

[0097] Example 3: Knockdown effect of GalNAc-coupled sequence in Hep-G2 cells

[0098] 1. GalNAc couplings are as follows:

[0099]

[0100] 2. Knockdown experiment:

[0101] 1) Human liver cancer cells Hep-G2 in the logarithmic growth phase were digested with trypsin (purchased from the cell bank of Kunming Institute of Physics, Chinese Academy of Sciences), and digestion was terminated with complete medium supplemented with 10% FBS. Cells were collected by centrifugation, resuspended in medium supplemented with 10% FBS, and counted with a hemocytometer. Then, 50,000 cells were added to each well of a 24-well plate for culture.

[0102] 2) Preparation of LipoRNAiMAX (invitrogen) and siRNA mixture, specifically using the following sequences: Some sequences generate protrusions, and the protrusions are indicated in parentheses in the table below.

[0103]

[0104] Dilute 10 nM siRNA / well and 1.5 μL of LipoRNAiMAX (invitrogen) separately in 25 μL of serum-free culture medium (Opti-MEM, purchased from Gibco). Then mix the siRNA solution with the LipoRNAiMAX (invitrogen) solution and incubate at room temperature for 5 minutes.

[0105] 3) Add 50 μL of the corresponding group's siRNA mixture to each well.

[0106] 4) After culturing for 48 hours, discard the culture medium, wash twice with enzyme-free PBS, add lysis buffer (BioFlux) to lyse the cells, add chloroform (MREDA) for extraction, vortex to mix, let stand at room temperature for 2-3 minutes, centrifuge, transfer the supernatant after separation to a well plate and bind with binding buffer, use a nucleic acid extractor, and arrange the well plates in the order according to the kit instructions (MagaBio plus Total RNA Purification Kit II, manufacturer: Borui, batch number BSC69M1E) and use the BSC69 program to extract RNA.

[0107] 5) Prepare the qPCR system and perform it on ice. Add 1 μL One Step SYBR Green Mix (Novizan), 10 μL 2*One Step SYBR Green Mix (Novizan), 0.4 μL hYJH-012 4PF, and 0.4 μL hYJH-012 4PR to each well. Dilute 100 ng RNA in 8.2 μL RNase ddH2O (Novizan) and add it to the well. Mix well and place in the qPCR instrument for reaction.

[0108] PCR reaction conditions: 50℃ for 15 minutes pre-denaturation, 95℃ for 1 minute, 95℃ for 15 seconds annealing, 60℃ for 1 minute extension, for 39 cycles.

[0109] PCR primers: hYJH-012 4PF (SEQ ID NO:67): NF07_182005, hYJH-012 4PR (SEQ ID NO:68): NF07_182006,

[0110] Target name Sequence (5'-3') XDH hYJH-012 4P F GGACAGTTGTGGCTCTTGAGGT XDH hYJH-012 4P R GGAAGGTTGGTTTTGCACAGCC

[0111] Novizan reagent kit: batch number 7E750A3

[0112] The results are as follows Figure 3 As shown, the sequences YJH-012-1609mS2-L96, YJH-012-1609mE1-L96, and YJH-012-3047mE+2-L96 inhibited XDH mRNA by 20.33%, 60.33%, and 47.67%, respectively.

[0113] Example 4: IC50 of GalNAc-coupled sequences in Hep-G2 cells

[0114] 1) Human liver cancer cells Hep-G2 in the logarithmic growth phase were digested with trypsin (purchased from the cell bank of Kunming Institute of Physics, Chinese Academy of Sciences), and digestion was terminated with complete medium supplemented with 10% FBS. Cells were collected by centrifugation, resuspended in medium supplemented with 10% FBS, and counted with a hemocytometer. Then, 50,000 cells were added to each well of a 24-well plate for culture.

[0115] 2) The same sequence as in Example 3 was used to prepare the mixture of LipoRNAiMAX (invitrogen) and siRNA.

[0116] 50 nM / well of NC siRNA and 1.5 μL of LipoRNAiMAX (Invitrogen) were diluted separately in 25 μL of serum-free culture medium (Opti-MEM, purchased from Gibco). The siRNA solution was then mixed with the LipoRNAiMAX (Invitrogen) solution to prepare a stock solution, which was incubated at room temperature for 5 minutes. Simultaneously, three siRNAs—YJH-012-1609mS2-L96, YJH-012-1609mE1-L96, and YJH-012-3047mE+2-L96—were used. 50 nM / well of each siRNA was directly diluted in 50 μL of serum-free culture medium (Opti-MEM, purchased from Gibco) to prepare a stock solution, which was incubated at room temperature for 5 minutes. The stock solutions of the four siRNAs were then serially diluted to siRNA concentrations of 10 nM, 2 nM, and 0.4 nM.

[0117] 3) Add 50 μL of the corresponding group's siRNA mixture to each well.

[0118] 4) After culturing for 48 hours, discard the culture medium, wash twice with enzyme-free PBS, add lysis buffer (BioFlux) to lyse the cells, add chloroform (MREDA) for extraction, vortex to mix, let stand at room temperature for 2-3 minutes, centrifuge, transfer the supernatant after separation to a well plate and bind with binding buffer, use a nucleic acid extractor, and arrange the well plates in the order according to the kit instructions (MagaBio plus Total RNA Purification Kit II, manufacturer: Borui, batch number BSC69M1E) and use the BSC69 program to extract RNA.

[0119] 5) Prepare the qPCR system and perform it on ice. Add 1 μL One Step SYBR Green Mix (Novizan), 10 μL 2*One Step SYBR Green Mix (Novizan), 0.4 μL hYJH-012 4PF, and 0.4 μL hYJH-012 4PR to each well. Dilute 100 ng RNA in 8.2 μL RNase ddH2O (Novizan) and add it to the well. Mix well and place in the qPCR instrument for reaction.

[0120] PCR reaction conditions: 50℃ for 15 minutes pre-denaturation, 95℃ for 1 minute, 95℃ for 15 seconds annealing, 60℃ for 1 minute extension, for 39 cycles.

[0121] PCR primers: hYJH-012 4PF (SEQ ID NO:67): NF07_182005, hYJH-012 4PR (SEQ ID NO:68): NF07_182006,

[0122] Target name Sequence (5'-3') XDH hYJH-012 4P F GGACAGTTGTGGCTCTTGAGGT XDH hYJH-012 4P R GGAAGGTTGGTTTTGCACAGCC

[0123] Novizan reagent kit: batch number 7E750A3

[0124] The results showed that the IC50 calculated based on the inhibition rate of the GalNAc-coupled sequence in Hep-G2 cells was as follows: Figure 4A As shown in Figure -D, the IC50 values ​​of YJH-012-1609mS2-L96, YJH-012-1609mE1-L96, and YJH-012-3047mE+2-L96 are 4.517 nM, 4.017 nM, and 11.89 nM, respectively.

[0125] Example 5: Knockdown effect of GalNAc-coupled sequence in rat liver

[0126] In vivo evaluation was performed on siRNAs of interest identified from in vitro studies. The pharmacodynamic activity of the following GalNAc-conjugated siRNAs targeting XDH was analyzed in rats after subcutaneous injection of the siRNAs: [The table below shows sequences with overhangs in parentheses for each overhang.]

[0127]

[0128]

[0129] Two dosage concentrations (1 mg / kg and 4 mg / kg) were set for each GalNAc-conjugated siRNA, administered subcutaneously once a week for multiple weeks. Liver samples were collected from rats on day 21 after the start of administration, and XDH mRNA levels in all samples were analyzed by RT-qPCR. Rat liver tissue was lysed using lysis buffer (BioFlux), and chloroform (MREDA) was added for extraction. After vortexing and incubation at room temperature for 2-3 minutes, the mixture was centrifuged. The supernatant was transferred to wells and bound with binding buffer. Using a nucleic acid extractor, following the kit instructions (MagaBio Plus Total RNA Purification Kit II, manufacturer: Borui, batch number C692307003), the wells were arranged in the correct order, and total RNA was extracted using the BSC69 program.

[0130] 2) Prepare the qPCR system and perform it on ice. Add 1 μL One SteP SYBR Green Mix (Novizan), 10 μL 2*One SteP SYBR Green Mix (Novizan), 0.4 μL rYJH-012-2PF (rXDH-2PF), and 0.4 μL rYJH-012-2PR (rXDH-2PR) to each well. Dilute the total RNA from liver tissue in 8.2 μL of RNase deionized water (Novizan) and add it to the well. Mix well and place in the qPCR instrument for reaction.

[0131] qPCR reaction conditions: 50℃, 15 min pre-denaturation; 95℃, 1 min, 95℃ annealing for 15 sec, 60℃ extension for 1 min, for 39 cycles.

[0132] PCR primers: rYJH-012-2P F (SEQ ID NO: 69): NF09-130069, rYJH-012-2P R (SEQ ID NO: 70): NF09-130070.

[0133] Target name Sequence (5'-3') XDH rYJH-012-2P F CAGAGGTGTTCAGAGGCGTGATG XDH rYJH-012-2P R GGGCTGGCAGTGATGATGTTCC

[0134] Novizan reagent kit: batch number 7E711D3

[0135] like Figure 5 As shown, injections of the above sequences (YJH-012-1609mS2-L96, YJH-012-1609mE1-L96, and YJH-012-3047mE+2-L96) at 4 mg / kg resulted in 42.08%, 49.00%, and 54.90% inhibition of XDH mRNA expression in rat liver, respectively. These results indicate that injection of GalNAc-conjugated siRNA can downregulate XDH mRNA expression.

[0136] Example 6: Efficacy of GalNAc-coupled sequences in a mouse model of hyperuricemia

[0137] The pharmacodynamics of siRNA was evaluated in a mouse model of hyperuricemia. Following subcutaneous injection of siRNA, the pharmacodynamic activity of the following GalNAc-conjugated siRNAs targeting XDH was analyzed in mice: [The table below shows sequences with protrusions in parentheses for each sequence.]

[0138]

[0139] 1) Each GalNAc-conjugated siRNA was given at one dose concentration (8 mg / kg). A single subcutaneous administration was performed on the first day of the experiment. Modeling was performed 30 minutes after administration. Model mice were injected intraperitoneally with 600 mg / kg potassium oxonate daily.

[0140] 2) On the 14th day after the start of the experiment, blood was collected 2 hours after the model was established to separate serum and measure the uric acid value.

[0141] like Figure 6 As shown, injections of the above sequences (YJH-012-1609mS2-L96, YJH-012-1609mE1-L96, and YJH-012-3047mE+2-L96) at 8 mg / kg resulted in uric acid-lowering effects of 20.15%, 40.82%, and 40.36% in hyperuricemic mouse models, respectively, on day 14 post-administration. These results indicate that injection of GalNAc-conjugated siRNA can downregulate serum uric acid levels in hyperuricemic mouse models.

[0142] Example 7: Duration of efficacy of GalNAc-coupled sequences in a mouse model of hyperuricemia

[0143] The pharmacodynamic persistence of siRNA was evaluated in a mouse model of hyperuricemia. Following subcutaneous injection of siRNA, the pharmacodynamic activity of the following GalNAc-conjugated siRNAs targeting XDH was analyzed in mice: [The table below shows sequences with overhangs in parentheses for each overhang.]

[0144]

[0145] 1) GalNAc-conjugated siRNA was administered at three concentrations (1 mg / kg, 4 mg / kg and 8 mg / kg). A single subcutaneous dose was administered on the first day of the experiment. Modeling was performed 30 minutes after administration. Model mice were injected intraperitoneally with 600 mg / kg potassium oxonate daily.

[0146] 2) On days -1, 4, 7, 10, 14, 21, and 28 after the start of the experiment, blood was collected 2 hours after modeling to separate serum and measure uric acid levels.

[0147] like Figure 7 As shown, a single dose of YJH-012-1609mE1-L96 at 4 mg / kg or 8 mg / kg resulted in a sustained reduction of serum uric acid levels in hyperuricemia model mice for 28 days. However, the 1 mg / kg dose group only showed significant uric acid-lowering efficacy on day 4 after administration.

[0148] Example 8: Duration of efficacy of GalNAc-coupled sequence in cynomolgus monkey model of hyperuricemia

[0149] The pharmacodynamic durability of siRNA was evaluated in a cynomolgus monkey model of hyperuricemia. Following subcutaneous injection of siRNA, the pharmacodynamic activity of the following GalNAc-conjugated siRNAs targeting XDH was analyzed in cynomolgus monkeys: [The table below shows sequences with protrusions in parentheses for each sequence.]

[0150]

[0151] 1) GalNAc-conjugated siRNA was administered at a single subcutaneous dose (10 mg / kg) on ​​the first day of the experiment. Modeling was performed 30 minutes after administration. The cynomolgus monkeys were injected intraperitoneally with 600 mg / kg potassium oxonate daily.

[0152] 2) On days -1, 1, 4, 7, 14, 21, 30, 45, 60 and 90 after the start of the experiment, blood was collected 2 hours after modeling to separate serum and measure uric acid levels.

[0153] like Figure 8 As shown, a single dose of YJH-012-1609mE1-L96 at 10 mg / kg can effectively reduce serum uric acid levels in a hyperuricemia model of cynomolgus monkeys for up to 90 days.

[0154] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A siRNA that inhibits the expression of the xanthine oxidase gene, characterized in that, It includes a sense strand and an antisense strand; the antisense strand is inversely complementary to a segment on the target gene; The nucleotide sequence of the modified siRNA is shown below. Justice Chain Sequence: fC-s-mC-s-fC-mU-fC-mA-fG-fC-fU-mU-fC-mU-fU-mC-fU-mU-fC-mA-fA-mG-mU; Antisense chain sequence: mU-s-fU-s-mG-fA-mA-fG-mA-fA-mG-fA-mA-mG-mC-fU-mG-fA-mG-fG-mG-s-mU-s-mG.

2. The siRNA as described in claim 1, characterized in that, The 3' end of the positive chain is conjugated with a ligand; the ligand includes GalNAc, cholesterol, biotin, and vitamins.

3. The siRNA as described in claim 2, characterized in that, The sequence of the sense strand of the siRNA molecule conjugated with the ligand is: fC-s-mC-s-fC-mU-fC-mA-fG-fC-fU-mU-fC-mU-fU-mC-fU-mU-fC-mA-fA-mG-mU-L96; The modified siRNA antisense strand sequence is as follows: mU-s-fU-s-mG-fA-mA-fG-mA-fA-mG-fA-mA-mG-mC-fU-mG-fA-mG-fG-mG-s-mU-s-mG.

4. The biological material associated with any of the siRNAs described in claims 1-3 is any one of the following: 1) A vector containing any of the siRNAs described in claims 1-3; 2) A reagent or kit containing the siRNA as described in any one of claims 1-3 or the vector as described in 1); 3) A pharmaceutical composition comprising the siRNA molecule as described in any one of claims 1-3 and other pharmaceutically acceptable components.

5. The biomaterial as described in claim 4, characterized in that, The dosage form of the pharmaceutical composition is a liquid preparation or a lyophilized powder for injection.

6. The use of the siRNA as described in any one of claims 1-3 or the biomaterial as described in any one of claims 4-5 in the preparation of a drug for treating hyperuricemia.

Citation Information

Patent Citations

  • SiRNA and conjugate thereof

    CN115927337A

  • Xanthine dehydrogenase (XDH) irna compositions and methods of use thereof

    US20180216114A1

  • Nucleic acids for inhibiting expression of XDH in a cell

    WO2022223557A1