Application of SNHG8 in preparation of non-alcoholic fatty liver disease prevention and treatment drugs
By promoting SNHG8 gene expression and using overexpression vectors and bioactive molecules to reduce liver triglyceride levels, the treatment difficulties of non-alcoholic fatty liver disease have been solved, new therapeutic targets and drug bases have been provided, and the occurrence and development of non-alcoholic fatty liver disease have been improved.
Patent Information
- Application Number
- CN202511103677.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-07
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2045-08-07
AI Technical Summary
There is currently no approved standard drug for the treatment of non-alcoholic fatty liver disease, and existing treatments are difficult to maintain their effectiveness. New targets are needed to effectively intervene and treat non-alcoholic fatty liver disease.
By promoting the expression of the SNHG8 gene and increasing the mRNA level of SNHG8 using an overexpression vector or bioactive molecules, drugs for preventing and treating non-alcoholic fatty liver disease are prepared, including plasmid vectors and bioactive molecules such as proteins, peptides or enzymes, to regulate related signal pathways to reduce liver triglyceride content.
It can effectively reduce liver triglyceride content, alleviate liver lipid accumulation and upregulation of lipid metabolism-related protein expression caused by a high-fat and high-cholesterol diet, and prevent or treat non-alcoholic fatty liver disease, especially in the early stages.
Smart Images

Figure CN120571022B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biotechnology, gene function and application, and particularly relates to application of SNHG8 in preparation of a non-alcoholic fatty liver disease prevention and treatment drug. BACKGROUND
[0002] Non-alcoholic fatty liver disease (NAFLD) is a common liver disease, which is composed of excessive accumulation of lipids in the liver, leading to lipotoxicity. The clinical burden of non-alcoholic fatty liver disease is not only limited to liver-related morbidity and mortality, but now there is increasing evidence that non-alcoholic fatty liver disease is a multi-system disease that affects extrahepatic organs and regulatory pathways. There is currently no approved standard drug for the treatment of non-alcoholic fatty liver disease, and the treatment of non-alcoholic fatty liver disease is mainly the intervention of dietary habits and lifestyle, weight loss and the treatment of potential metabolic syndromes after diagnosis, which has an effect but is difficult to maintain. Therefore, it is of great significance to find new targets to effectively intervene and treat non-alcoholic fatty liver disease.
[0003] SNHG8 (small nucleolar RNA host gene 8) is a long non-coding RNA (LncRNA) that has physiological effects in epithelial and muscle satellite cells. It is known in the prior art that SNHG8 can act as a molecular sponge for some miRNAs to regulate their target genes, and can affect the pathogenesis of atherosclerosis, chronic cerebral ischemia, acute gouty arthritis, ischemic stroke and myocardial infarction by regulating multiple molecular axes (such as SNHG8 / miR-384 / Hoxa13 / FAM3A and miR-335 / RASA1) and the NF-κB signaling pathway. There is no in-depth study on the effect of SNHG8 on non-alcoholic fatty liver disease in the early stage of non-alcoholic fatty liver disease. SUMMARY
[0004] In view of the deficiencies in the prior art, the application provides the application of SNHG8 in preparation of a non-alcoholic fatty liver disease prevention and treatment drug, which aims to solve the problems mentioned in the background.
[0005] The application provides the application of SNHG8 in preparation of a non-alcoholic fatty liver disease prevention and treatment drug, which prevents and treats non-alcoholic fatty liver disease by promoting the expression of the SNHG8 gene.
[0006] Further, the drug for promoting the expression of the SNHG8 gene includes a promoter for promoting the mRNA level of the SNHG8 gene.
[0007] Further, the promoter of the mRNA level of the SNHG8 gene includes an overexpression vector or a bioactive molecule that promotes the mRNA level of the SNHG8 gene.
[0008] Further, the overexpression vector includes a plasmid vector or a viral vector.
[0009] Further, the plasmid vector is an overexpression plasmid containing a full-length coding sequence, a cDNA sequence, or a functionally active fragment of the SNHG8 gene.
[0010] Further, the bioactive molecule includes a protein, a polypeptide, or an enzyme that promotes the transcription of the SNHG8 gene and / or enhances the mRNA stability of the SNHG8 gene.
[0011] Further, the prevention and treatment of non-alcoholic fatty liver disease is the prevention, treatment, or alleviation of non-alcoholic fatty liver disease.
[0012] The present application has the following technical effects: SNHG8 is applied to the preparation of a drug for preventing and treating non-alcoholic fatty liver disease. The drug can effectively reduce the liver triglyceride content by promoting the expression of the SNHG8 gene, alleviate the increase in liver lipid accumulation and the up-regulation of lipid metabolism-related protein expression induced by high-fat high-cholesterol diet, and prevent, treat, or alleviate non-alcoholic fatty liver disease, thereby achieving the purpose of preventing and treating non-alcoholic fatty liver disease. This shows that overexpression of SNHG8 can improve the occurrence and development of non-alcoholic fatty liver disease, especially in the early stage of non-alcoholic fatty liver disease. Therefore, SNHG8 can provide a new theoretical basis and therapeutic target for the preparation of a drug for preventing and treating non-alcoholic fatty liver disease. BRIEF DESCRIPTION OF DRAWINGS
[0013] The exemplary embodiments of the present application can be more completely understood by referring to the following drawings:
[0014] Figure 1 is a graph of the results of the mRNA level analysis of the SNHG8 gene of each group of mice in Example 2 of the present application by RT-qPCR, * indicates p<0.05, and ## indicates p<0.01;
[0015] Figure 2 is the triglyceride content determination results of each group of mice in Example 3 of the present application, **** indicates p<0.0001, and # indicates p<0.05;
[0016] Figure 3 is a graph of the pathological changes of the liver tissue observed under a microscope after hematoxylin-eosin staining and oil red O staining of each group of mice in Example 4 of the present application;
[0017] Figure 4Figure is a result graph of analyzing the expression of lipid metabolism related proteins of each group of mice of Example 5 of the present application by Western blotting, and β-Actin is an internal reference protein. DETAILED DESCRIPTION
[0018] In order to make the technical problems to be solved by the present application, technical solutions and beneficial effects more clearly understood, the present application will be further described in detail below in combination with the drawings and examples. It should be understood that the specific examples described herein are only used to explain the present application, and are not used to limit the present application.
[0019] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs; the terms used herein are only for the purpose of describing specific examples, and are not intended to limit the present application.
[0020] The present application provides the application of SNHG8 in the preparation of a drug for preventing and treating non-alcoholic fatty liver disease, which prevents and treats non-alcoholic fatty liver disease by promoting the expression of the SNHG8 gene.
[0021] In some examples, the drug for promoting the expression of the SNHG8 gene includes a promoter for promoting the mRNA level of the SNHG8 gene.
[0022] In some examples, the promoter for promoting the mRNA level of the SNHG8 gene includes an overexpression vector or a bioactive molecule for promoting the mRNA level of the SNHG8 gene.
[0023] In some examples, the overexpression vector includes a plasmid vector or a viral vector.
[0024] In some examples, the plasmid vector is an overexpression plasmid containing the full-length coding sequence, the cDNA sequence or the functionally active fragment of the SNHG8 gene.
[0025] In some examples, the bioactive molecule includes a protein, a polypeptide or an enzyme for promoting the transcription of the SNHG8 gene and / or enhancing the mRNA stability of the SNHG8 gene.
[0026] In some examples, preventing and treating non-alcoholic fatty liver disease is preventing, treating or relieving non-alcoholic fatty liver disease.
[0027] Experimental materials and methods:
[0028] 1. Obtaining of SNHG8 overexpression plasmid
[0029] (1) The SNHG8 overexpression plasmid is purchased from Beijing Genki Biological Technology Co., Ltd. The overexpression plasmid is inserted with the complete sequence of SNHG8 with pLIVE vector, Sal I and BamH I as enzyme cutting sites.
[0030] The amplified sequence is:
[0031] F: GAATTATTCTTTTACATTTCAGTTTTTCTGCTAGCAGGCGCGCCAGTCGACCTCTTTGGCTGCGAT (SEQ ID NO. 1);
[0032] R: ATGTGATGTTACTCGAGTCCGCGGTGAGCTCTGGATCCTTATTACACACCAAACATCTTTTATT (SEQ ID NO. 2).
[0033] pLIVE The vector (liver in vivo expression vector) is designed to achieve high level and long term expression of transgene in mouse liver. The vector utilizes a chimeric promoter consisting of mouse alpha fetoprotein enhancer II and mouse minimal albumin promoter, and two introns are designed in the vector to enhance the expression of the delivered transgene. Downstream of the first intron is a multiple cloning site (MCS) with eight unique restriction enzyme sites for easy insertion of the gene of interest. Compared with classic promoters such as CMV immediate early promoter, the chimeric promoter and two introns together can promote high level and long term expression of transgene in liver.
[0034] (2) Amplification of the purchased plasmid: transformation with E. coli competent cells, plating, and inversion in a 37°C incubator overnight; remove the overnight cultured plate from the 37°C incubator, pick the clone and shake the bacteria, and perform colony PCR (polymerase chain reaction) to identify positive clones.
[0035] The PCR identification primers are as follows:
[0036] F: TTACTCGAGTCCGCGGTGAG (SEQ ID NO. 3);
[0037] R: TTCTGCTAGCAGGCGCG (SEQ ID NO. 4).
[0038] (3) 5-10 μl of bacterial solution with positive PCR identification is inoculated into 100 ml of LB (with resistance) medium, and incubated in a 37°C shaker at 220 rpm overnight (12-16 h). The overnight cultured bacterial solution is used to extract endotoxin-free plasmid from the turbid bacterial solution using an endotoxin-free extraction kit. Finally, the plasmid is diluted with physiological saline and used for subsequent tail vein injection.
[0039] 2. Mouse tail vein injection
[0040] (1) Irradiate the mouse with an incandescent lamp for a few minutes before injection to promote vasodilation.
[0041] (2) Fix the mouse: Place the mouse into the transparent fixer, expose the tail, and tighten the rear knob of the fixer (be careful not to tighten too much to avoid compressing the breath).
[0042] (3) Observe the blood vessels: The mouse tail vein is located on both sides of the tail, which is blue-purple and relatively thin; the artery is located in the middle, which is red and pulsates obviously, and needs to be avoided during injection.
[0043] (4) Disinfect the tail with an alcohol cotton ball, and after the alcohol evaporates (to avoid stimulating vasospasm), hold the syringe with the right hand, with the needle at a 10-15° angle to the tail, and insert the needle from the 1 / 3 of the tail tip. The depth of insertion is about 1-2 mm, and after the needle is inserted, the clear outline of the needle in the blood vessel can be seen, if there is a small amount of blood in the syringe, it means that the needle tip is in the blood vessel, then inject the plasmid solution.
[0044] 3. Experimental animals and feeding
[0045] (1) Species, gender, age, and source of experimental animals: C57BL / 6 (C57) mice, male, 6-8 weeks old, purchased from Jisui Yekang Biotechnology Co., Ltd.
[0046] (2) Experimental animal feed formula: High-fat high-cholesterol feed (purchased from Boaopai, item number D09100310), energy composition ratio: 40 kcal% fat (palm oil), 20 kcal% fructose, and 2% cholesterol.
[0047] (3) Animal feeding and environmental conditions: All mice were raised in the SPF animal room of the Transgenic Animal Center of the Translational Medicine Research Institute of Nanchang University (license number: SYXK (Jiangxi) 2021-0001). Every 12 hours of alternating lighting, temperature 24±2℃, humidity 40-70%, mice free to drink water and eat.
[0048] Example 1:
[0049] Construction of non-alcoholic fatty liver disease mouse model: The purchased mice were ear tagged and weighed, and then randomly divided into four groups: normal diet group, high-fat diet group, high-fat control group and high-fat experimental group. After adaptive feeding for one week, the mice in the normal diet group, high-fat diet group, high-fat control group and high-fat experimental group were injected with physiological saline diluted empty plasmid into the tail vein of the mice in the high-fat control group, and physiological saline diluted overexpression SNHG8 plasmid was injected into the mice in the high-fat experimental group. Thereafter, except for the normal diet group, the remaining three groups of mice were changed to high-fat high-cholesterol feed, and the total feeding time was 14 weeks, and the mice in the high-fat experimental group were injected with physiological saline diluted overexpression SNHG8 plasmid again at the 7th week to maintain the high expression of SNHG8 in the liver.
[0050] The mice in each group were injected intraperitoneally with anesthetic (sodium pentobarbital, the dose was adjusted according to the weight of the mice), and the liver tissue was dissected; part of the fresh liver tissue was immediately frozen in liquid nitrogen and stored at -80°C for subsequent RNA extraction, triglyceride, oil red O staining and Western blotting; part of the liver tissue was fixed with 4% paraformaldehyde for subsequent HE (hematoxylin-eosin) staining.
[0051] Example 2:
[0052] The frozen liver tissues of the mice in the normal diet group, high-fat diet group, high-fat control group and high-fat experimental group were taken, and the mRNA level of the SNHG8 gene was analyzed by RT-qPCR (reverse transcription-quantitative polymerase chain reaction). Specifically, total RNA was extracted from the liver tissue using TRIzol reagent (purchased from Invitrogen Life Technology Co., Ltd.). cDNA was synthesized using Hifair ® III 1stStrand cDNA Synthesis Kit (gDNA digester plus) kit (purchased from Yixing, item number 11139ES60). According to the manufacturer's instructions, Hieff ® qPCR SYBR Green Master Mix (Low RoxPlus) (purchased from Yixing, item number 11202ES08) was used for gene amplification. RT-qPCR was performed on an ABI7500 real-time fluorescent quantitative PCR system, and the relative gene expression was calculated using the 2-ΔΔCT method, and β-Actin was used as an internal control.
[0053] Primer sequences:
[0054] m-β-Actin-F: GGCTGTATTCCCCTCCATCG (SEQ ID NO. 5);
[0055] m-β-Actin-R: CCAGTTGGTAACAATGCCATGT (SEQ ID NO. 6);
[0056] m-SNHG8-F: TTTCTAGGAAACGCCGGGA (SEQ ID NO. 7);
[0057] m-SNHG8-R: AAAGGCCCACTCACTACCCA (SEQ ID NO. 8).
[0058] The results of the mRNA level analysis of the SNHG8 gene in each group of mice by RT-qPCR are shown in Table 1. Figure 1 The results show that the overexpression of SNHG8 in the high-fat experimental group of mice is successful; and the mRNA level of the SNHG8 gene in the liver of the high-fat diet group of mice is lower than that of the normal diet group.
[0059] Example 3:
[0060] The frozen liver tissues of the normal diet group, the high-fat diet group, the high-fat control group and the high-fat experimental group of mice were taken for triglyceride content determination, specifically: the tissue cell triglyceride lipase method determination kit (Puli Lei, E1013) was used for determination;
[0061] (1) The centrifuge tube was accurately weighed, and then weighed after adding the liver tissue block. The difference between the two (i.e. the weight loss method) was calculated as the tissue weight (50 mg). One milliliter of RIPA lysis buffer was added, and the tissue was broken by a homogenizer. It was placed on ice for 10 minutes;
[0062] (2) Take an appropriate amount of supernatant and transfer it to a 1.5 ml centrifuge tube. Heat at 70ºC for 10 minutes. The remaining lysis buffer is quantified by the BCA method (bicinchoninic acid method) protein quantification kit;
[0063] (3) Centrifuge at 2000 rpm for 5 minutes at room temperature. The upper clear liquid can be used for enzymatic determination;
[0064] (4) Working solution preparation: mix 4 ml of reagent R1 with 1 ml of reagent R2 at a ratio of 4:1. It can be used immediately or stored at 4ºC for <1 day. Discard if it changes color;
[0065] (5) Standard dilution: dilute the 4 mM glycerol standard with distilled water, physiological saline or the same liquid as the sample buffer to 1000, 500, 250, 125, 62.5, 31.25, 15.625, 7.8125 µmol / L. Take 4-6 tubes and set up a 0 concentration control reaction tube;
[0066] (6) Add 10 uL of sample and 190 uL of working solution to each well of a 96-well plate;
[0067] (7) React at 37°C for 15 minutes, and then use an enzyme-labeled instrument to measure the OD value;
[0068] (8) Compare the actual triglyceride content of each group according to the ratio of the triglyceride concentration to the protein concentration of each sample.
[0069] The triglyceride content determination results of the mice in each group are shown in Table 1. Figure 2 The results show that, compared with the normal diet group, the triglyceride content of the liver tissue of the mice in the high-fat diet group increased significantly; but compared with the high-fat control group, the increase in the triglyceride content of the liver tissue of the mice in the high-fat experimental group was alleviated.
[0070] Example 4:
[0071] The fixed liver tissues of the mice in the normal diet group, the high-fat diet group, the high-fat control group, and the high-fat experimental group were stained with hematoxylin-eosin, and the pathological changes of the liver tissues of the mice in each group were observed under a microscope. The frozen liver tissues of the mice in each group were stained with oil red O, and the pathological changes of the liver tissues of the mice in each group were observed under a microscope.
[0072] The results of observing the pathological changes of the liver tissues of the mice in each group after hematoxylin-eosin staining and oil red O staining are shown in Table 2. Figure 3 The results of hematoxylin-eosin staining show that, compared with the normal diet group, the liver tissue of the mice in the high-fat diet group showed a large amount of fatty degeneration, and round vacuoles of varying sizes were visible in the cytoplasm, and the nucleus was shifted; however, compared with the high-fat control group, the lipid accumulation and fatty degeneration in the liver tissue of the mice in the high-fat experimental group were significantly improved. The results of oil red O staining show that diffuse orange-red lipid droplets were observed in the high-fat diet group and the high-fat control group, and the area of red lipid droplets in the high-fat experimental group was significantly reduced.
[0073] Example 5:
[0074] The frozen liver tissues of the mice in the normal diet group, the high-fat diet group, the high-fat control group, and the high-fat experimental group were taken, and the expression of lipid metabolism-related proteins (FASN, ACC1, ACLY, and SCD1) was analyzed by Western blotting.
[0075] The results of analyzing the expression of lipid metabolism-related proteins in the mice in each group by Western blotting are shown in Table 3. Figure 4 The results show that high-fat high-cholesterol diet significantly up-regulated the expression of lipid metabolism-related proteins, but overexpression of SNHG8 significantly reversed this phenomenon.
[0076] In summary, overexpression of SNHG8 can improve the occurrence and development of non-alcoholic fatty liver disease, and therefore SNHG8 can provide a new theoretical basis and therapeutic target for the preparation of drugs for preventing and treating non-alcoholic fatty liver disease.
[0077] The above merely describes preferred embodiments of the present application and is not used to limit the present application, and any modification, equivalent replacement and improvement made within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. The use of a vector for promoting overexpression of the mRNA level of the SNHG8 gene in the preparation of a drug for preventing and treating non-alcoholic fatty liver disease, characterized in that: The medicine prevents and treats non-alcoholic fatty liver disease by promoting SNHG8 gene expression.
2. Use according to claim 1, characterized in that: The overexpression vector includes a plasmid vector or a viral vector.
3. Use according to claim 2, wherein: The plasmid vector is an overexpression plasmid containing a full-length coding sequence of the SNHG8 gene and a cDNA sequence.
4. Use according to claim 3, wherein: Preventing and treating non-alcoholic fatty liver disease refers to preventing, treating or relieving non-alcoholic fatty liver disease.
Citation Information
Patent Citations
Function and application of SH3 domain-containing RING finger protein 2 (Sh3rf2) in preparing drugs for treating non-alcoholic fatty liver disease and / or type-2 diabetes
CN111194724A
Construction method and application of mLs model based on LncRNA
CN117174174A