Gene hd-zip for judging nitrogen tolerance of wheat under nitrogen deficiency and application thereof

The HD-Zip gene was screened through genome-wide association analysis, and its expression level was detected by qPCR. This solved the problem of low nitrogen use efficiency in wheat under nitrogen-deficient conditions, enabled the effective screening and differentiation of wheat varieties with strong tolerance, and improved nitrogen use efficiency.

CN120574848BActive Publication Date: 2026-03-03ZHEJIANG UNIV ZHONGYUAN INST
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510739130.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-04
Publication Date
2026-03-03
Estimated Expiration
2045-06-04

AI Technical Summary

Technical Problem

In existing technologies, wheat has low nitrogen utilization under high nitrogen conditions, leading to an imbalance between nitrogen supply and demand, and there is a lack of effective methods to identify and screen wheat varieties with strong tolerance.

Method used

The HD-Zip gene was screened using genome-wide association analysis (GWAS), and its expression level under nitrogen-deficient conditions was detected by qPCR to distinguish and screen wheat varieties with strong tolerance.

Benefits of technology

This method enables the effective differentiation and screening of wheat varieties with strong tolerance under nitrogen-deficient conditions, thereby improving nitrogen use efficiency and reducing nitrogen demand.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120574848B_ABST
    Figure CN120574848B_ABST
Patent Text Reader

Abstract

This invention provides a gene, HD-Zip, for determining nitrogen tolerance in wheat under nitrogen deficiency conditions and its application, belonging to the field of bio-agricultural technology. This invention, through genome-wide association analysis and validation using natural wheat varieties from around the world under normal and nitrogen deficiency stress conditions, identified the gene HD-Zip, associated with nitrogen deficiency tolerance. The HD-Zip gene shows downregulated expression in response to nitrogen deficiency stress in wheat. The HD-Zip gene provided by this invention can be used to distinguish between nitrogen-tolerant and nitrogen-sensitive wheat varieties, screen for nitrogen-tolerant wheat varieties, and assess nitrogen content in soils where wheat is grown.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bio-agricultural technology, specifically relating to a gene HD-Zip for judging nitrogen tolerance in wheat under nitrogen deficiency conditions and its application. Background Technology

[0002] Wheat (Triticum aestivum L.) plays a vital role in global food supply as an important staple crop. High wheat yields depend on fertilizer inputs. Among fertilizers, nitrogen is a major nutrient limiting productivity in many ecosystems because wheat grains (number, size, and protein content) are the primary driver of high nitrogen demand. The widespread use of nitrogen fertilizers in wheat production easily leads to an imbalance between nitrogen supply and demand. However, wheat plants grown under high nitrogen conditions exhibit relatively low nitrogen use efficiency, suggesting that wheat can utilize available nitrogen more efficiently, and the potential to reduce nitrogen demand while maintaining high yields remains unrealized. Summary of the Invention

[0003] In view of this, the purpose of the present invention is to provide a wheat HD-Zip gene that has the characteristic of responding to nitrogen deficiency stress, and to use the significant differential expression under nitrogen deficiency conditions to judge the tolerance or sensitivity of wheat.

[0004] This invention provides a wheat gene HD-Zip, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0005] This invention provides the application of detecting the relative expression level of the HD-Zip gene in determining the tolerance of wheat varieties to nitrogen deficiency conditions.

[0006] Preferably, in the method for determining the tolerance of wheat varieties to nitrogen deficiency, when the relative expression level of the HD-Zip gene in the test sample is downregulated compared with the reference sample, it indicates that the test sample is a nitrogen-sensitive wheat variety; if there is no significant difference, the test sample is determined to be a nitrogen-tolerant wheat variety.

[0007] This invention provides the application of detecting the relative expression level of the HD-Zip gene in distinguishing between nitrogen-tolerant and nitrogen-sensitive wheat varieties.

[0008] Preferably, the method for distinguishing between nitrogen-tolerant wheat varieties and nitrogen-sensitive wheat varieties is as follows: when the relative expression level of the HD-Zip gene in the test sample is downregulated compared with the reference sample, the test sample is judged to be a nitrogen-sensitive wheat variety; if there is no significant difference, the test sample is judged to be a nitrogen-tolerant wheat variety.

[0009] This invention provides the application of detecting the relative expression level of the HD-Zip gene in screening nitrogen-deficiency tolerant wheat varieties.

[0010] Preferably, the method for screening nitrogen-deficiency tolerant wheat varieties selects wheat varieties whose relative expression levels of the HD-Zip gene are not significantly different from those of reference samples as breeding materials.

[0011] Preferably, the reference sample includes at least one of the following: Xuzhou 25, Azulon, Chuanmai 41, Shijiazhuang 8, and Shaanxi Mai 512.

[0012] Preferably, the nitrogen deficiency includes conditions where the nitrogen content in the wheat growing environment is below 0.4 mM.

[0013] Preferably, the reagent for detecting the relative expression level of the HD-Zip gene includes qPCR primers;

[0014] The qPCR primers include a forward primer with a nucleotide sequence as shown in SEQ ID NO:2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:3.

[0015] This invention provides a wheat HD-Zip gene, the nucleotide sequence of which is shown in SEQ ID NO:1. This invention screened for the HD-Zip gene in response to nitrogen deficiency stress by combining genome-wide association analysis (GWAS) with normal nitrogen and nitrogen deficiency stress treatments in natural wheat varieties from around the world. qPCR verification showed that the expression level of the HD-Zip gene differed significantly between extremely tolerant and susceptible wheat varieties, and that its expression was significantly downregulated in the susceptible varieties. This indicates that the HD-Zip gene is downregulated in response to nitrogen deficiency stress in wheat. Therefore, the HD-Zip gene provided by this invention can be used to distinguish between nitrogen-tolerant and susceptible wheat varieties, screen for nitrogen-tolerant wheat varieties, and assess the nitrogen content in soils where wheat is grown. Attached Figure Description

[0016] Figure 1 The statistical analysis results of wheat seedling traits under different nitrogen levels in a greenhouse are shown below. a) Plant phenotypes under normal nitrogen (control) and nitrogen deficiency (treatment) conditions (15 days) are shown, with a scale bar of 10 cm. b) Correlation matrices of six phenotypes related to nitrogen tolerance under normal and nitrogen deficiency conditions are shown. Note: All Pearson correlation coefficients shown in the matrix are significant at different levels; blank blocks indicate no significant correlation between corresponding pairs. c–h show the measurement results of six phenotypes in 284 wheat varieties under two different conditions, including stem dry weight (c), root dry weight (d), root-to-shoot ratio (e), stem nitrogen accumulation (f), root nitrogen accumulation (g), and total nitrogen accumulation (h).

[0017] Figure 2The results of correlation analysis of wheat under nitrogen deficiency conditions are as follows: (a) frequency distribution of relative stem dry weight; (b) frequency distribution of relative root dry weight; (c) frequency distribution of relative root-to-shoot ratio; (d) frequency distribution of relative stem nitrogen accumulation; (e) frequency distribution of relative root nitrogen accumulation; (f) frequency distribution of relative total nitrogen accumulation. Note: Correlation analysis between wheat relative aboveground traits includes relative aboveground dry weight (RSDW), relative root-to-shoot ratio (RRS), relative aboveground nitrogen accumulation (RSN), and relative total nitrogen accumulation (RTN) (g); correlation analysis between wheat relative root dry weight (RRDW), relative root-to-shoot ratio, relative root nitrogen accumulation (RRN), and relative total nitrogen accumulation (RTN) and root traits (h).

[0018] Figure 3 The results of the genome-wide association analysis are shown in Figure 1. (a)–(c) are the QQ plot and Manhattan plot of the three relative traits associated with nitrogen deficiency, where RSDW(a), RRDW(b), and RRS(c) are the most significant traits. The dashed lines represent the significance threshold (p > 1 × 10⁻⁶). 3 );

[0019] Figure 4 The results of the genome-wide association analysis are shown in Figure 1. (a)–(c) are QQ plots and Manhattan plots of the three relative traits associated with nitrogen deficiency, where RSN(a), RRN(b), and RTN(c) are represented. The dashed lines indicate the significance threshold (p > 1 × 10⁻⁶). 3 );

[0020] Figure 5 The results of Venn diagram analysis of wheat root nitrogen tolerance genes identified by GWAS;

[0021] Figure 6 Morphological characteristics of the extremely sensitive strain W101 and the extremely tolerant strain W199 after nitrogen deficiency treatment;

[0022] Figure 7 Results of gene expression in wheat varieties that are extremely nitrogen-tolerant and sensitive to nitrogen deficiency. Detailed Implementation

[0023]

[0024] In this embodiment of the invention, 284 natural wheat varieties were subjected to normal nitrogen and nitrogen deficiency stress treatments. The results showed that nitrogen deficiency stress significantly inhibited aboveground growth and nitrogen accumulation in wheat plants, but promoted root growth. A gene related to improving nitrogen use efficiency in wheat under nitrogen deficiency conditions, namely the HD-Zip gene (TraesCS5A03G0110200, Chinese_Spring1.0_chr5A:39845263-39851540), was screened using genome-wide association analysis (GWAS). The expression levels of the HD-Zip gene in extremely sensitive and extremely tolerant lines under nitrogen deficiency stress were verified using RT-qPCR. The results showed that the HD-Zip gene was downregulated in the extremely sensitive lines, consistent with the GWAS results. This indicates that the HD-Zip gene responds to nitrogen deficiency stress treatment in wheat by downregulating its expression. In this invention, the nitrogen deficiency preferably includes conditions where the nitrogen content in the wheat growing environment is below 0.4 mM. In this embodiment of the invention, a culture medium with a nitrogen content of 0.4 mM was used as a nitrogen-deficient stress treatment. Simultaneously, a culture medium with a nitrogen content of 4 mM was used as a normal growth condition.

[0025] This invention provides the application of detecting the relative expression level of the HD-Zip gene in determining the tolerance of wheat varieties to nitrogen deficiency conditions.

[0026] In this invention, the reagent for detecting the relative expression level of the HD-Zip gene preferably includes qPCR primers. The qPCR primers preferably include a forward primer with the nucleotide sequence shown in SEQ ID NO:2 (CTGCTGTCGAATGGGTGC) and a reverse primer with the nucleotide sequence shown in SEQ ID NO:3 (CGATAGTTCCACCATTACCC). The preferred qPCR reaction system is: 50 ng cDNA template, 0.4 μl each of forward and reverse primers (10 μM), mix 10 μl, and add ddH2O to a final volume of 20 μl. The preferred qPCR reaction program is: pre-denaturation at 94°C for 30 seconds, followed by 45 cycles, each cycle consisting of denaturation at 94°C for 5 seconds, annealing at 60°C for 15 seconds, extension at 72°C for 10 seconds, followed by melting curve analysis, collecting fluorescence signals every 0.5°C from 60°C to 95°C for 5 seconds per degree Celsius.

[0027] In this invention, the method for determining the tolerance of wheat varieties to nitrogen deficiency is preferably such that when the relative expression level of the HD-Zip gene in the test sample is significantly downregulated compared to the reference sample, it indicates that the test sample is a nitrogen-sensitive wheat variety. If there is no significant difference, the test sample is determined to be a nitrogen-tolerant wheat variety. The reference sample is selected from nitrogen-tolerant wheat varieties, such as Xuzhou 25, Azulon, Chuanmai 41, Shijiazhuang 8, and Shanmai 512.

[0028] This invention provides the application of detecting the relative expression level of the HD-Zip gene in distinguishing between nitrogen-tolerant and nitrogen-sensitive wheat varieties.

[0029] The method for distinguishing between nitrogen-tolerant and nitrogen-sensitive wheat varieties is that when the relative expression level of the HD-Zip gene in the test sample is downregulated compared with that of the reference sample, the test sample is judged to be a nitrogen-sensitive wheat variety. The reference sample preferably includes at least one of the following: Xuzhou 25, Azulon, Chuanmai 41, Shijiazhuang 8, and Shanmai 512.

[0030] This invention provides the application of detecting the relative expression level of the HD-Zip gene in screening nitrogen-deficiency tolerant wheat varieties.

[0031] In this invention, the method for screening nitrogen-deficiency-tolerant wheat varieties selects wheat varieties whose relative expression levels of the HD-Zip gene are not significantly different from those of reference samples as breeding materials. The reference samples preferably include at least one of the following: Xuzhou 25, Azulon, Chuanmai 41, Shijiazhuang 8, and Shanmai 512.

[0032] In this invention, the preferred method for distinguishing between nitrogen-deficiency-tolerant and nitrogen-deficiency-sensitive wheat varieties is that the relative expression level of the HD-Zip gene in the test sample is downregulated compared to the reference sample, indicating that the test sample is a nitrogen-deficiency-sensitive wheat variety. If there is no significant difference, the test sample is judged to be a nitrogen-deficiency-tolerant wheat variety. The reference sample is the same as described in the above technical solution and will not be repeated here.

[0033] This invention provides the application of detecting the relative expression level of the HD-Zip gene in screening nitrogen-deficiency tolerant wheat varieties.

[0034] In this invention, the method for screening nitrogen-deficiency-tolerant wheat varieties preferably involves selecting wheat varieties whose relative expression levels of the HD-Zip gene are not significantly different from those of a reference sample as breeding material. The reference sample is the same as described in the above technical solution and will not be repeated here.

[0035] The following detailed description, in conjunction with embodiments, illustrates the HD-Zip gene for determining nitrogen tolerance in wheat under nitrogen deficiency conditions and its application, but these should not be construed as limiting the scope of protection of this invention.

[0036] Example 1

[0037] A method for screening genes associated with nitrogen deficiency tolerance in wheat.

[0038] 1. Materials and Methods

[0039] 1.1 Plant materials and growing conditions

[0040] We collected 284 common wheat germplasm accessions from around the world (see Table 1).

[0041] Table 1 Summary of 284 wheat germplasm information

[0042]

[0043]

[0044]

[0045]

[0046]

[0047]

[0048]

[0049]

[0050]

[0051] Seeds of all wheat varieties were disinfected with 3% hydrogen peroxide for 30 minutes, rinsed three times with tap water, and then transferred to a sand bed. After germination, the endosperm of 7-day-old seedlings (two-leaf stage) was removed, and the seedlings were transplanted into a hydroponic solution prepared in distilled water (1 mM ammonium sulfate, 1 mM potassium nitrate, 1.5 mM calcium chloride, 1 mM magnesium sulfate, 0.5 mM potassium dihydrogen phosphate, 0.046 mM H3BO3, 9.6 μM manganese chloride·4H2O, 0.01 mM (NH4)6Mo7O). 24The culture medium consisted of 4 mM ZnSO4·7H2O, 0.4 mM CuSO4·5H2O, and 0.095 mM Fe(III)-EDTA (pH 5.8), and the seedlings were allowed to acclimate for 7 days. Over the next 15 days, the plants were divided into two treatments: a culture medium containing 4 mM nitrogen (N) was used as a control, and a culture medium containing 0.4 mM nitrogen (N) was used for nitrogen deficiency treatment. The culture medium was refreshed every 3 days.

[0052] In the experiment, wheat was grown in a natural light greenhouse at the Central Plains Research Institute of Zhejiang University in Zhengzhou, China, with day and night temperatures of 22 / 18℃.

[0053] 1.2 Dry weight and nutritional analysis

[0054] Each wheat plant was photographed and its stems and roots were separated. The plants were then treated at 105°C for 30 min and dried to constant weight in an oven at 80°C. The dry weight of the stems and roots was recorded. The nitrogen content in the raw material was determined by the Kjeldahl method. Approximately 0.3 g of the raw material was added to a dry 100 mL Kjeldahl flask and hydrolyzed for 2 h in 15 mL of concentrated sulfuric acid (H2SO4) solution containing 0.4 g CuSO4 and 4 g K2SO2 in a heating block at 420°C. After cooling, 20 mL of H2O was added to the hydrolysis product, followed by titration and neutralization to measure the nitrogen content in the raw material.

[0055] Root to shoot ratio (RS) = root dry weight (RDW) / stem dry weight (SDW) Formula I;

[0056] Total nitrogen accumulation (TN) = Aboveground nitrogen accumulation (SN) + Root nitrogen accumulation (RN) Formula II

[0057] Each treatment was repeated three times, with three plants randomly selected. Correlation between traits was calculated using SPSS 21.0 (IBM, Armonk, NY, USA), and the mean phenotype of each treatment was compared using a t-test.

[0058] The nitrogen deficiency tolerance index is used to characterize the relative changes in SDW, RDW, RS, SN, RN, and TN (labeled RSDW, RRDW, RRS, RSN, RRN, and RTN, respectively) under nitrogen deficiency stress. The relative change in each trait is calculated as the value under nitrogen deficiency treatment / normal treatment, for example, RSDW = (SDW (control) - SDW (nitrogen deficiency)) / SDW (control).

[0059] 1.3 Genome-wide association analysis (GWAS)

[0060] Capital Bio genotyped all 284 accessions using a wheat 90K single nucleotide polymorphism (SNP; Illumina, 81,587 SNPs) chip. SNPs used for subsequent GWAS analysis were obtained after quality control (minor allele frequencies >0.05, missing data <20%). The physical locations of the SNPs were obtained from the International Wheat Genome Sequencing Consortium website (IWGSC, http: / / www.wheatgenome.org / IWGSC v1.1).

[0061] Population structure was analyzed using the Additives 1.3.0 program. ADMIXTURE was run from K=1 to K=20 clusters to determine the optimal K value. A phylogenetic tree was created using R-packaged monkeys to observe the genetic relationships of the samples and eliminate outliers.

[0062] Genome-wide association analysis (GLM) was performed on nitrogen deficiency tolerance indices for phenotypic traits using TASSEL v5.2 software. In this embodiment, the p-value indicates whether a SNP is associated with the corresponding trait, and R... 2 This indicates the phenotypic variation explained by the marker.

[0063] Because the Bonferroni-Holm correction (Holm, 1979) for multiple detection (α = 0.05) was too conservative, and this criterion did not detect significant marker-trait associations (MTAs), markers with an adjusted -log10 (p-value) ≥ 3.0 were selected as significantly associated markers. Furthermore, the Manhattan and QQ plots were drawn using the CM plotting package implemented in R3.6.

[0064] 1.4 Candidate Gene Analysis and Annotation

[0065] Candidate genes were identified as all genes located in regions surrounding significant SNPs (±50 kb) at each important site in IWGSC3 (IWGSC v1.1). An interactive web server, wGRN (http: / / wheat.cau.edu.cn / wGRN), was then used to accurately prioritize candidate genes associated with nitrogen deficiency responsiveness in genome-wide association studies. Inputting QTLs from the GWAS results and previously identified homologous genes involved in rice nitrogen metabolism revealed genes associated with improved nitrogen use efficiency in wheat under nitrogen deficiency conditions.

[0066] 2. Results

[0067] 2.1 Phenotypic Response of Nitrogen-Responsive Traits to Different Environments

[0068] Six agronomic indices for nitrogen deficiency tolerance were observed and calculated in the experiment, including SDW, RDW, RS, SN, RN, and TN. All traits showed extensive variation across 284 wheat germplasms. Continuous variation was observed across all traits, with a distribution approximating a normal distribution. The figures show the seedlings exposed to normal nitrogen (control) and nitrogen deficiency (treatment) conditions (15 days). Figure 1 (a) Compared with the control group, all traits except RRDW and RRS decreased under nitrogen deficiency. The mean values ​​of SDW, SN, RN, and TN decreased by 35.5%, 67.5%, 32.2%, and 61.7%, respectively, under nitrogen deficiency. In contrast, the mean values ​​of RRDW and RRS increased by 41.8% and 121.1%, respectively, under nitrogen deficiency. Figure 1 (c)-(h)). Furthermore, significant positive correlations were observed among the data for all six nitrogen deficiency-related traits under both nitrogen conditions. Figure 2 The values ​​in (a)-(f) indicate that most phenotypic variations originate from genetic factors.

[0069] To further explore the relationships between six nitrogen deficiency-related traits under different nitrogen conditions, a correlation matrix was constructed. Figure 1 (b) The results showed a significant positive correlation between SDW and SN, with Pearson correlation coefficients (r) of 0.727 and 0.731 under normal and nitrogen-deficient conditions, respectively. Furthermore, a significant positive correlation was observed between RDW and RN data under both nitrogen conditions. These results indicate that SDW and RDW can serve as key phenotypic indicators characterizing nitrogen use efficiency in wheat. At different nitrogen levels, RS showed a significant negative correlation with SN and TN (p<0.01), suggesting that an increase in the root-to-shoot ratio may significantly reduce nitrogen use efficiency in wheat.

[0070] 2.2 Growth response of wheat varieties to nitrogen deficiency stress

[0071] To identify the response of extreme wheat lines to nitrogen deficiency, relative traits (RSDW, RRDW, RRS, RSN, RRN, RTN) were used as composite selection indicators at different nitrogen levels.

[0072] Under nitrogen deficiency stress, compared with the control group, all wheat lines showed reduced stem dry weight and nitrogen accumulation. Figure 2 (a)-(f)). However, approximately 94% of the lines showed an increased root dry weight response to nitrogen deficiency. Furthermore, compared to the control group, over 90% of the lines exhibited reduced root nitrogen accumulation.

[0073] Furthermore, by selecting the top 15% of the relative stem and root biomass indices under nitrogen deficiency treatment, W268 (CA1119), W193 (Emai W23), W101 (Afu), W94 (Aca601), and W4 (Fengchan 3) were considered extremely nitrogen-deficient lines. Meanwhile, W299 (Azulon), W187 (Chuanmai 41), W110 (Shijiazhuang 8), W53 (Shanmai 512), and W199 (Xuzhou 25) showed stronger tolerance to nitrogen deficiency because the bottom 15% of the relative stem and root biomass indices were a response to nitrogen deficiency stress. Subsequently, 10 wheat lines exhibiting extreme nitrate responsiveness were used as material for further candidate gene analysis.

[0074] Furthermore, correlation analysis was performed on nitrogen deficiency response traits in seedlings under nitrogen deficiency stress, and correlation coefficients for six traits were presented. Multivariate analysis showed robust covariance between stem-related parameters (RSDW, RSN) and root structure indices (RRDW, RRN) under nitrogen deficiency conditions (p<0.01). Figure 2 (g)-(h)).

[0075] 2.3 Marker-Association-of-Traits (MTAs) Analysis

[0076] Genome-wide association analysis (GLM) was performed on nitrogen deficiency tolerance indices for phenotypic traits. At a p-value of 0.001 (log10 value of 3), 70 SNPs (MTAs) significantly associated with six nitrogen deficiency tolerance-related traits (including RSDW, RRDW, RRS, RSN, RRN, and RTN) were identified. Figure 3 and Figure 4 ).

[0077] The highest number of loci were found in genome A (33) and genome B (22), while 15 loci were found in genome D. Of these loci, RSDW detected 16, RRDW detected 21, RRS detected 15, RSN detected 18, RRN detected 9, and RTN detected 5.

[0078] Notably, nine loci (BobWhite_c19327_314, BobWhite_c47740_85, BobWhite_c8037_1135, BS00106306_51, Excalibur_c3004_250, Excalibour_rep_c70996_188, IAAV8527, Kukri_c17417_291, Tdurum_contig46954_406, wsnp_CAP11_rep_c4111_1943520, and wsnp_Ra_c38873-46699852) were identified as having two or more traits, demonstrating the presence of pleiotropic regions. Furthermore, the QQ plots of all traits indicate that false positives in this GWAS were adequately controlled.

[0079] As a result, 67, 27, 39, 48, 61, and 10 genes were identified using RRDW, RRN, RRS, RSDW, RSN, and RTN, respectively. Figure 5 ).

[0080] Using QTLs identified in GWAS as input, 220 candidate genes were predicted by wGRN in combination with known homologs in rice. In this example, based on its connectivity with genes in the functional network, wGRN preferentially selected TraesCS5A03G0110200 (HD-Zip) as a high-confidence candidate.

[0081] Example 2

[0082] The expression level of the HD-Zip gene in extreme varieties was verified using RT-qPCR.

[0083] Ten extremely nitrogen-tolerant and nitrogen-sensitive wheat lines were treated for 15 days under nitrogen-deficient (0.4 mM N) or normal (4 mM N) conditions. Morphological characteristics of the treated wheat plants were then observed by photography. RNA was extracted from the wheat plants for RT-qPCR detection, with three biological replicates per sample. Total RNA was extracted from stems using a plant RNA kit (ER302; TransGenBiotech, Beijing, China), and cDNA was synthesized using a cDNA synthesis kit (AU341; TransGenBiotech, Beijing, China). Quantitative reverse transcription polymerase chain reaction (qPCR) analysis was performed using a Green qPCR kit (AQ601; TransGenBiotech, Beijing, China) to determine gene expression levels. Triple copies of the experiments were performed. The primers used for qPCR detection are as follows: F_HD-Zip: CTGCTGTCGAATGGGTGC (SEQ ID NO:2); R_HD-Zip: CGATAGTTTCCACCATTACCC (SEQ ID NO:3); F_Actin: CAACGAGCTCCGTGTCGCA (SEQ ID NO:4); R_Actin: GAGGAAGCGTGTATCCCTCATAG (SEQ ID NO:5). The preferred qPCR reaction system is: 50 ng cDNA template, 0.4 μl each of forward and reverse primers (10 μM), mix 10 μl, and add ddH2O to a final volume of 20 μl. The qPCR reaction program is: 94℃ pre-denaturation for 30 seconds, followed by 45 cycles, each cycle consisting of 94℃ denaturation for 5 seconds, 60℃ annealing for 15 seconds, and 72℃ extension for 10 seconds. After that, melting curve analysis is performed, collecting fluorescence signals every 0.5℃ from 60℃ to 95℃ for a duration of 5 seconds per degree Celsius.

[0084] See results Figure 6 and Figure 7 To validate the function of candidate genes, extremely tolerant and sensitive lines were exposed to normal nitrogen (control) and nitrogen deficiency (treatment) conditions. The results showed that nitrogen deficiency stress significantly inhibited aboveground growth and nitrogen accumulation in wheat plants, but promoted root growth. HD-Zip expression was downregulated in all extremely nitrogen-deficiency-sensitive and tolerant lines, with a greater relative downregulation in extremely sensitive lines, indicating different expression and regulatory patterns among extreme lines responding to nitrogen starvation.

[0085] Ten wheat plants were cultured for 15 days under nitrogen-deficient (0.4 mM N) conditions, using W199 (Xuzhou 25) as a reference sample. The RT-qPCR detection method described above was used for analysis. The determination method was that a downregulation of the relative expression level of the HD-Zip gene in the test sample compared to the reference sample indicated that the test sample was a nitrogen-deficient wheat variety; if no significant difference was found, the test sample was determined to be a nitrogen-tolerant wheat variety. The results showed that 7 wheat plants were nitrogen-deficient wheat varieties, and the remaining 3 were nitrogen-tolerant wheat varieties, achieving a 100% phenotypic concordance rate.

[0086] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A wheat gene HD-Zip Its characteristics are, The nucleotide sequence is shown in SEQ ID NO:

1.

2. The detection method described in claim 1 HD-Zip The application of relative gene expression levels in assessing the tolerance of wheat varieties to nitrogen deficiency, the method for assessing the tolerance of wheat varieties to nitrogen deficiency, and the test samples. HD-Zip When the relative expression level of a gene is significantly downregulated compared to the reference sample, it indicates that the test sample is a nitrogen-deficient wheat variety. If there is no significant difference, the test sample is judged to be a nitrogen-tolerant wheat variety. The reference sample includes at least one of the following: Xuzhou 25, Azulon, Chuanmai 41, Shijiazhuang 8, and Shanmai 512.

3. The test according to claim 1 HD-Zip The application of gene expression levels in distinguishing between nitrogen-deficiency-tolerant and nitrogen-deficiency-sensitive wheat varieties, wherein the method for distinguishing between nitrogen-deficiency-tolerant and nitrogen-deficiency-sensitive wheat varieties is based on the expression levels of the tested samples. HD-Zip When the relative expression level of a gene is downregulated compared to a reference sample, the test sample is identified as a nitrogen-deficient wheat variety; if there is no significant difference, the test sample is identified as a nitrogen-tolerant wheat variety. The reference sample includes at least one of the following: Xuzhou 25, Azulon, Chuanmai 41, Shijiazhuang 8, and Shanmai 512.

4. The test according to claim 1 HD-Zip The application of relative gene expression levels in screening nitrogen-deficiency-tolerant wheat varieties, and the method for screening nitrogen-deficiency-tolerant wheat varieties, comparing the screening results with reference samples. HD-Zip Wheat varieties with no significant difference in the relative expression level of genes were used as breeding materials; the reference samples included at least one of the following: Xuzhou 25, Azulon, Chuanmai 41, Shijiazhuang 8, and Shanmai 512.

5. The application according to any one of claims 2 to 4, characterized in that, The nitrogen deficiency refers to conditions where the nitrogen content in the wheat growing environment is below 0.4 mM.

6. The application according to any one of claims 2 to 4, characterized in that, The detection HD-Zip Reagents for determining the relative expression level of genes include qPCR primers; The qPCR primers include a forward primer with a nucleotide sequence as shown in SEQ ID NO:2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:3.