Aspartic acid ammonia lyase mutant and preparation method of beta-aminobutyric acid

Abstract

The invention discloses an aspartic acid ammonia lyase mutant and a preparation method of beta-aminobutyric acid, and belongs to the technical field of gene engineering. The amino acid sequence of the aspartic acid ammonia lyase mutant is as shown in SEQ ID NO. 2. The enzyme activity of the aspartic acid ammonia lyase mutant disclosed by the invention is remarkably improved, so that the yield and the conversion rate of a product beta-aminobutyric acid during preparation of the beta-aminobutyric acid are improved.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a preparation method of an aspartate ammonia-lyase mutant and beta-aminobutyric acid. Background Art

[0002] β-Aminobutyric acid (BABA), also known as 3-aminobutyric acid, is a simple, non-protein β-amino acid composed of two functional groups: an amino group and a carboxyl group, and four carbon atoms. β-Aminobutyric acid is an important bioactive molecule, widely present in organisms. It has multiple physiological functions, including promoting plant growth and enhancing plant stress resistance. It is widely used in agriculture, medicine, food, and other fields.

[0003] The synthesis of β-aminobutyric acid currently mainly includes chemical method and enzyme catalysis method. The chemical method is to use formaldehyde as raw material, obtain 2-butyl tert-butyl butenoate through Horner-Wadsworth-Emmons reaction, and then further synthesize (R)-3-aminobutyric acid, utilize methyl crotonate to synthesize (R)-3-aminobutyric acid, or utilize ammonia and butenoic acid reaction to synthesize β-aminobutyric acid under pressure. The above-mentioned chemical synthesis method reaction conditions are harsh, need to use a large amount of chemical raw materials, cost is high, and can cause heavy metal pollution, which is unfavorable for industrialized large-scale production. The enzyme catalysis method can use aspartate ammonia lyase to synthesize β-aminobutyric acid with butenoic acid as substrate, but the wild-type aspartate ammonia lyase in the prior art has low enzyme activity when preparing β-aminobutyric acid, and the output and conversion rate of β-aminobutyric acid are not high enough. Summary of the Invention

[0004] In view of this, the object of the present invention is to provide an aspartate ammonia lyase mutant and a method for preparing β-aminobutyric acid, so as to overcome the problems in the prior art of low enzymatic activity of aspartate ammonia lyase in preparing β-aminobutyric acid, and insufficient yield and conversion rate of β-aminobutyric acid.

[0005] In a first aspect, the present invention provides an aspartate ammonia-lyase mutant, the amino acid sequence of the aspartate ammonia-lyase mutant is shown in SEQ ID NO.2.

[0006] Compared with the wild-type aspartate ammonia lyase, the enzyme activity of the aspartate ammonia lyase mutant of the present invention is significantly improved, thereby improving the yield and conversion rate of the product β-aminobutyric acid when preparing β-aminobutyric acid.

[0007] Furthermore, the amino acid sequence shown in SEQ ID NO.2 is obtained by mutating the 192nd amino acid of the amino acid sequence shown in SEQ ID NO.1 from A to D.

[0008] In a second aspect, the present invention provides a gene sequence encoding the above-mentioned aspartate ammonia-lyase mutant.

[0009] Optionally, the gene sequence of the aspartate ammonia-lyase mutant is shown in SEQ ID NO.4.

[0010] In a third aspect, the present invention provides an expression vector containing the above-mentioned gene sequence.

[0011] In a fourth aspect, the present invention provides a method for preparing an aspartate ammonia-lyase mutant, which is used to prepare the above-mentioned aspartate ammonia-lyase mutant, comprising the following steps:

[0012] Transforming the above expression vector into a host strain to obtain a recombinant strain;

[0013] The recombinant strain was cultured in LB medium at 35-40°C and 100-150 rpm for 12-16 hours to obtain a seed solution;

[0014] Inoculate the seed solution into another LB medium at a volume ratio of 1-3% and culture at 35-40°C until the OD 600 The value is 0.6-0.8, then the temperature is lowered to 15-20°C, IPTG with a final concentration of 0.5-1.5 mM is added to induce culture for 16-18 hours to obtain fermentation broth;

[0015] The fermentation broth was centrifuged to collect the bacterial cells containing the aspartate ammonia-lyase mutant.

[0016] Furthermore, the centrifugal speed of the fermentation liquid is 5000-8000 rpm.

[0017] In a fifth aspect, the present invention provides a method for preparing β-aminobutyric acid, which utilizes the above-mentioned bacterial cells containing the aspartate ammonia-lyase mutant to catalyze crotonic acid to produce β-aminobutyric acid.

[0018] Compared with the prior art, the aspartate ammonia lyase mutant of the present invention has improved enzyme activity. Using the aspartate ammonia lyase mutant to catalyze the conversion of crotonic acid to β-aminobutyric acid can increase the yield and conversion rate of β-aminobutyric acid. The crotonic acid can be specifically selected as crotonic acid.

[0019] Furthermore, the above-mentioned reaction step of catalyzing crotonic acid to produce β-aminobutyric acid includes: adding crotonic acid, a metal ion cofactor, an ammonium salt and bacteria containing an aspartate ammonia-lyase mutant into the reaction system, and adding ammonia water to adjust the pH value to 8.5-9.5, and reacting at 45-55°C to produce β-aminobutyric acid.

[0020] Furthermore, the metal ion cofactor includes at least one of magnesium chloride and magnesium sulfate; and the ammonium salt includes at least one of ammonium sulfate and ammonium chloride.

[0021] The magnesium ions contained in the magnesium chloride and magnesium sulfate in the above technical solution can act as a cofactor to activate enzyme activity. The ammonium ions in ammonium sulfate and ammonium chloride hydrolyze in the solution to form a weakly acidic environment, which, together with the ammonia, adjusts the pH of the reaction system, affecting the catalytic pathway or product selectivity.

[0022] Furthermore, in the reaction system, the concentration of crotonic acid is 250-350 g / L, the concentration of metal ion cofactor is 15-20 g / L, the concentration of ammonium salt is 18-22 g / L, and the concentration of bacteria containing the aspartate ammonia-lyase mutant is 30-40 g / L. DETAILED DESCRIPTION

[0023] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0024] It should be understood that the raw materials used in the following examples are all commercially available raw materials unless otherwise specified.

[0025] Example 1

[0026] Construction of mutant plasmid:

[0027] The gene sequence of wild-type aspartate ammonia lyase from Escherichia coli was ligated into the expression vector pET28a to obtain the original plasmid pET28a-aspA. The gene sequence of the wild-type aspartate ammonia lyase is shown in SEQ ID NO. 3.

[0028] S1. Reverse PCR amplification: Reverse PCR amplification was performed using the original plasmid pET28a-aspA as a template and A192D-F and A192D-R as mutant primers. The reaction system and reaction conditions for the reverse PCR amplification reaction are shown in Tables 1 and 2.

[0029] Mutation primers:

[0030] A192D-F: GGCCGCTATCATCTGCAGGATGCGGT (SEQ ID NO. 5).

[0031] A192D-R: AGATGATAGCGGCCCATTTTAATCACG (SEQ ID NO. 6).

[0032] Table 1 Reverse PCR reaction system (20 μL)

[0033] Components Volume (μL) <![CDATA[Sterile ddH2O]]> 6 10× buffer for PCR (10× PCR buffer) 5 2mM dNTPS (2mM deoxyribonucleotides) 5 A192D-F 1 A192D-R 1 pET28a-aspA 1 KDO-Plus (High-fidelity PCR enzyme) 1

[0034] Table 2 Reaction conditions for inverse PCR

[0035] step time Number of cycles 95 1min 98 10s 30 59 30s 30 68 2min 30 4 ∞

[0036] S2. Template Elimination: After the inverse PCR amplification reaction is completed, add 1 μL of restriction endonuclease Dpn I to the reaction solution. Mix thoroughly with a pipette and incubate at 37°C for 1 hour to eliminate the template and obtain a digestion solution. Verify the digestion solution by agarose gel electrophoresis.

[0037] S3. Self-cyclization of PCR products: Prepare the reaction solution according to Table 3, mix gently, and react at 16°C for 1 hour to obtain a mutant plasmid containing the aspartate ammonia-lyase mutant gene.

[0038] Table 3 Product cyclization system

[0039] Components Volume (μL) Enzyme digestion products 2 Ligationhigh (high efficiency ligation reagent) 1 T4 Polynucleotide Kinase (T4 Polyphosphate Kinase) 1 <![CDATA[Sterile ddH2O]]> 6

[0040] S4. Verification of the mutant plasmid: The cyclization product obtained in step S3 above was chemically transformed into E. coli DH5α competent cells. Specifically, the cyclization product from step S3 above was added to E. coli DH5α competent cells. The cells were placed on ice for 30 minutes, then heat-shocked in a 42°C water bath for 60 seconds. The cells were then incubated on ice for 5 minutes. The cells were then transferred to 500 μL of LB liquid medium and shaken at 37°C for 1 hour. 100 μL of the culture solution was then plated.

[0041] Single clones on the plates were picked for plasmid extraction and DNA sequencing, and the plasmid with successful mutation was named M.

[0042] The gene sequence of the aspartate ammonia-lyase mutant contained in the mutant plasmid M is shown in SEQ ID NO.4, and the amino acid sequence encoded by the gene is shown in SEQ ID NO.2.

[0043] Compared to the amino acid sequence of the wild-type aspartate ammonia-lyase (shown in SEQ ID NO.1), the aspartate ammonia-lyase mutant of the present invention has a mutation at amino acid position 192 of the amino acid sequence shown in SEQ ID NO.1, from A (alanine) to D (aspartic acid), and thus the aspartate ammonia-lyase mutant is named A192D.

[0044] Example 2

[0045] Construction of mutant strains and induced expression

[0046] Add 1 μL of the correctly sequenced mutant plasmid M to E. coli BL21 competent cells. Place on ice for 30 minutes, then heat shock in a 42°C water bath for 60 seconds, followed by incubation on ice for 5 minutes. Transfer the cells to 500 μL of LB liquid medium and shake at 37°C for 1 hour. Plate 100 μL of the culture to obtain positive transformants.

[0047] The positive transformants were cultured in liquid LB medium at 37°C and 120 rpm for 14 h to obtain seed solution. The seed solution was inoculated into another LB medium at a volume ratio of 2% and cultured at 37°C until the OD 600 The value reached 0.6, and then the temperature was lowered to 18°C, and IPTG with a final concentration of 1.0 mM was added to induce the culture for 17 h to obtain the fermentation broth containing the aspartate ammonia-lyase mutant A192D.

[0048] Example 3

[0049] Isolation and Purification of Aspartate Ammonia-lyase Mutant A192D

[0050] The fermentation broth from Example 2 was centrifuged at 8000 rpm at 4°C for 15 minutes. The supernatant was discarded, and the cells in the fermentation broth were collected. The cells were resuspended in 0.1 mM phosphate buffer at pH 8.5 and disrupted using a high-pressure homogenizer at 800 bar for 15 minutes. The cells were then centrifuged at 12000 rpm at 4°C for 1 hour, and the cell debris pellet was discarded. The collected supernatant was the crude enzyme solution of aspartate ammonia-lyase mutant A192D. After Ni affinity chromatography, the eluted protein was ultrafiltered into 0.1 mM phosphate buffer at pH 8.5 to remove imidazole and other metal ions in the eluate, obtaining the aspartate ammonia-lyase mutant A192D enzyme solution. The concentration of this enzyme solution was 4 mg / ml.

[0051] Example 4

[0052] Enzyme activity assay

[0053] Configure the following reaction system to determine enzyme activity:

[0054] Reaction system 1: 80 g / L crotonic acid, 0.6 mM MgCl2, 10 mM ammonium sulfate, 2 mg / mL aspartate ammonia-lyase mutant A192D enzyme solution, add ammonia water to adjust the pH value of the reaction system to 9.0, react at 50°C for 60 minutes, and boil for 10 minutes to terminate the reaction.

[0055] Reaction system 2: Compared with the above reaction system 1, an equal amount of the aspartate ammonia-lyase mutant A192D enzyme solution was replaced with the wild-type aspartate ammonia-lyase enzyme solution of the same concentration, and the other components and reaction conditions remained unchanged.

[0056] Enzyme activity (U) is defined as the amount of enzyme required to catalyze the synthesis of 1 μmol of β-aminobutyric acid per unit time (min) under the above reaction conditions.

[0057] Table 4

[0058] Aspartate ammonia lyase enzyme solution Enzyme activity Wild-type aspartate ammonia lyase enzyme solution 4U Aspartate ammonia lyase mutant A192D enzyme solution 6.7U

[0059] As shown in Table 4, compared with the wild-type aspartate ammonia-lyase, the enzyme activity of the aspartate ammonia-lyase mutant A192D of the present invention is significantly improved.

[0060] Example 5

[0061] Preparation of β-aminobutyric acid

[0062] The original plasmid pET28a-aspA was introduced into Escherichia coli BL21 competent cells according to the method of Example 2, and the obtained positive transformants were fermented and induced according to the method of Example 2 to obtain a fermentation broth containing wild-type aspartate ammonia-lyase. The fermentation broth was centrifuged at 4°C and 8000 rpm for 15 min, and the supernatant was discarded to obtain recombinant bacteria containing wild-type aspartate ammonia-lyase.

[0063] The fermentation broth containing the aspartate ammonia-lyase mutant A192D obtained in Example 2 was centrifuged at 4° C. and 8000 rpm for 15 min, and the supernatant was discarded to obtain recombinant bacteria containing the aspartate ammonia-lyase mutant A192D.

[0064] The following reaction system was configured to prepare β-aminobutyric acid using crotonic acid as a substrate:

[0065] 300g of crotonic acid, 18g of MgCl2, and 20g of ammonium sulfate were added to the reaction system. Ammonia was then added to adjust the pH to 9.0. 40g of recombinant bacteria containing wild-type aspartate ammonia-lyase was added at 50°C. The reaction was then started by diluting the volume to 1L with 1mM phosphate buffer (pH 9.0). After 12 hours of reaction, the reaction was terminated by boiling for 10 minutes.

[0066] 300g of crotonic acid, 18g of MgCl2, and 20g of ammonium sulfate were added to the reaction system. Ammonia was then added to adjust the pH to 9.0. 40g of recombinant bacteria containing the aspartate ammonia-lyase mutant A192D was added at 50°C. The reaction was then started by diluting the volume to 1L with 1mM phosphate buffer (pH 9.0). After 12 hours of reaction, the reaction was terminated by boiling for 10 minutes.

[0067] After the reaction was completed, the yield and conversion rate of β-aminobutyric acid were detected. The results are shown in Table 5.

[0068] Conversion rate of β-aminobutyric acid = yield of β-aminobutyric acid ÷ 103.12 (molecular weight of β-aminobutyric acid) ÷ [300 (mass of crotonic acid) ÷ 86.09 (molecular weight of crotonic acid)] × 100%.

[0069] Table 5

[0070] Recombinant bacteria β-aminobutyric acid production Conversion rate of β-aminobutyric acid Recombinant bacteria containing wild-type aspartate ammonia lyase 328.33g 91.37％ Recombinant bacteria containing aspartate ammonia lyase mutant A192D 346.84g 96.52％

[0071] As shown in Table 5, compared with the wild-type aspartate ammonia-lyase, the catalytic reaction using the aspartate ammonia-lyase mutant A192D of the present invention increased the yield and conversion rate of β-aminobutyric acid.

[0072] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art will be able to modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein with equivalents. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. An aspartate ammonia-lyase mutant, characterized in that: The amino acid sequence of the aspartate ammonia-lyase mutant is shown in SEQ ID NO.

2.

2. The aspartate ammonia-lyase mutant according to claim 1, characterized in that The amino acid sequence shown in SEQ ID NO.2 is obtained by mutating the 192nd amino acid in the amino acid sequence shown in SEQ ID NO.1 from A to D.

3. A gene sequence encoding the aspartate ammonia-lyase mutant according to claim 1 or 2.

4. An expression vector containing the gene sequence according to claim 3.

5. A method for preparing an aspartate ammonia-lyase mutant, for preparing the aspartate ammonia-lyase mutant according to claim 1 or 2, characterized in that: The following steps are involved: Transforming the expression vector according to claim 4 into a host strain to obtain a recombinant strain; The recombinant strain is cultured in LB medium at 35-40° C. and 100-150 rpm to obtain a seed solution; The seed solution was inoculated into another LB medium at an inoculum volume ratio of 1-3%, and cultured at 35-40°C until the OD 600 The value is 0.6-0.8, then the temperature is lowered to 15-20°C, IPTG is added with a final concentration of 0.5-1.5 mM to induce the culture, and the fermentation broth is obtained; The fermentation broth is centrifuged to collect bacterial cells containing the aspartate ammonia-lyase mutant.

6. The preparation method according to claim 5, characterized in that The centrifugal speed of the fermentation liquid is 5000-8000 rpm.

7. A method for preparing β-aminobutyric acid, characterized in that: The invention relates to a method for catalyzing the production of β-aminobutyric acid from crotonic acid by using a bacterial cell containing the aspartate ammonia-lyase mutant according to claim 1 or 2.

8. The preparation method according to claim 7, characterized in that The reaction steps of catalyzing crotonic acid to generate β-aminobutyric acid include: adding crotonic acid, a metal ion cofactor, an ammonium salt and bacteria containing an aspartate ammonia-lyase mutant into a reaction system, adding ammonia water to adjust the pH value to 8.5-9.5, and reacting at 45-55° C. to generate β-aminobutyric acid.

9. The preparation method according to claim 8, characterized in that The metal ion cofactor includes at least one of magnesium chloride and magnesium sulfate; the ammonium salt includes at least one of ammonium sulfate and ammonium chloride.

10. The preparation method according to claim 8, characterized in that In the reaction system, the concentration of crotonic acid is 250-350 g / L, the concentration of metal ion cofactor is 15-20 g / L, the concentration of ammonium salt is 18-22 g / L, and the concentration of bacteria containing the aspartate ammonia-lyase mutant is 30-40 g / L.