Goat spermatogonial stem cell anti-BVDV functional target based on CD46 gene editing and application thereof

By editing the goat CD46 gene through the CRISPR/Cas9 system, the problem of lack of specific targets for BVDV infection in goats was solved, the precise development of disease-resistant breeding and the study of viral infection mechanisms were achieved, and it was confirmed that CD46 is the key receptor for BVDV infection in goats.

CN120591273APending Publication Date: 2025-09-05NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510788345.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-12
Publication Date
2025-09-05

AI Technical Summary

Technical Problem

Existing technologies lack specific targets for BVDV infection in goats, resulting in limited effectiveness of prevention and control strategies, hindering the progress of disease-resistant goat breeding and the analysis of cross-species virus pathogenicity mechanisms.

Method used

The CD46 gene of goat spermatogonial stem cells (SSCs) was precisely edited through the CRISPR/Cas9 system. Using sgRNA specifically targeting the goat CD46 gene and a CRISPR/Cas9 gene knockout vector, single-point editing of the CD46 gene was achieved, resulting in a deletion and obtaining a positive cell line resistant to BVDV infection.

Benefits of technology

It was confirmed that CD46 is the key receptor for BVDV infection in goats, which significantly reduces the BVDV infection rate and provides a technical basis for disease-resistant breeding, verifying the antiviral effect of CD46 gene editing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120591273A_ABST
    Figure CN120591273A_ABST
Patent Text Reader

Abstract

The invention relates to the crossing field of a gene editing technology and a veterinary biotechnology, in particular to a goat spermatogonial stem cell anti-BVDV functional target based on CD46 gene editing and application of the goat spermatogonial stem cell anti-BVDV functional target. An anti-virus cell strain is obtained by designing sgRNA of a targeted CD46 CCP1 structural domain and knocking out the gene through a CRISPR-Cas9 system. An infection experiment shows that the virus load of the delta CD46-SSCs is reduced by 90%, and the survival rate is recovered to 85%. The invention reveals that CD46 is a key receptor of goat BVDV infection for the first time, and provides a new strategy for disease-resistant breeding and targeted drug development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the intersection of gene editing technology and veterinary biotechnology, and specifically to anti-BVDV functional targets of goat spermatogonial stem cells based on CD46 gene editing and applications thereof. Background Art

[0002] Bovine viral diarrhea virus (BVDV) is an important pathogen of ruminants, and its key mechanisms of host cell invasion have been extensively studied. In cattle, the CD46 molecule has been clearly confirmed as the primary receptor for BVDV, and its CCP1 domain mediates infection by specifically binding to the viral E2 protein (Krey et al. Function of bovine CD46 as a cellular receptor for bovine viral diarrhea virus is determined by complement control protein 1. J Virol, 2006, 80(8):3912-22.). However, whether this mechanism applies to other susceptible species remains unknown. Goats, as one of the natural hosts of BVDV, exhibit reproductive disorders similar to those of cattle (such as testicular atrophy and abnormal spermatogenesis) after infection, but the molecular targets of viral invasion have long remained unidentified. It is worth noting that the gene sequence of goat CD46 is significantly different from that of cattle (amino acid homology is only 68%), and AlphaFold2 structure prediction found that the CCP1 domains of the two have key differences in three-dimensional conformation (such as differences in β-fold arrangement), which suggests that the infection mechanism of BVDV in goats may be essentially different from that in cattle.

[0003] Currently, prevention and control strategies for BVDV infection in goats mostly rely on research findings from cattle, but due to a lack of understanding of host-specific targets, their actual effectiveness is limited. Traditional disease control measures (such as vaccines) are difficult to block the spread of the virus through germ cells, while gene editing breeding technology has reached a bottleneck due to unclear targets. This research gap in the field has not only hindered the progress of disease-resistant goat breeding, but also limited the comprehensive analysis of the pathogenic mechanisms of cross-species viruses. The core breakthrough of this invention is the first revelation that CD46 is a key receptor for BVDV infection in goat SSCs, providing a new direction for the development of targeted editing strategies and is expected to promote the development of precise disease-resistant goat breeding. Summary of the Invention

[0004] The purpose of the present invention is to provide a functional target for anti-BVDV of goat spermatogonial stem cells based on CD46 gene editing and its application. The present invention uses the CRISPR / Cas9 system to precisely edit the CD46 gene of goat spermatogonial stem cells (SSCs) to resist bovine viral diarrhea virus (BVDV) infection, and describes its application in disease-resistant breeding and research on viral infection mechanisms.

[0005] The object of the present invention is achieved through the following technical solutions: The present invention provides an sgRNA that specifically targets the goat CD46 gene. The specific sequence of the sgRNA is shown in SEQ ID NO.1.

[0006] Furthermore, the sgRNA targets the sequence from position 3569 to position 3588 of the CD46 gene.

[0007] The present invention also provides a CRISPR / Cas9 gene knockout vector that specifically targets the goat CD46 gene, wherein the CRISPR / Cas9 gene knockout vector comprises the sgRNA sequence according to any one of claims 1 to 2.

[0008] Furthermore, the vector is a pSpCas9(BB)-2A-Puro (PX459) vector.

[0009] The present invention also provides a use of the sgRNA or the CRISPR / Cas9 gene knockout vector in preparing a product for knocking out the goat CD46 gene.

[0010] The present invention also provides a method for knocking out the goat CD46 gene using the CRISPR / Cas9 system, comprising the step of introducing the CRISPR / Cas9 gene knockout vector into cells, causing single-point editing of the CD46 gene to result in fragment deletion, and obtaining positive cells.

[0011] Furthermore, the introduction method is electroporation transfection.

[0012] Furthermore, the electroporation parameters are voltage 500-1000 V, pulse width 20-50 ms, and pulse number 1-3.

[0013] Furthermore, the cells are goat spermatogonial stem cells.

[0014] Furthermore, the positive cells are obtained by using primers with sequences as shown in SEQ ID NO. 4-5 to determine the positive cell lines.

[0015] Beneficial effects

[0016] This study provides a sgRNA sequence specifically targeting the goat CD46 gene, as well as a CRISPR / Cas9 gene knockout vector containing this sgRNA. The goat spermatogonial stem cell line generated using this vector, which edits the goat CD46 gene, exhibits resistance to BVDV infection, confirming for the first time that CD46 is a key receptor for BVDV infection in goats. This provides a technical foundation for the breeding of disease-resistant breeding stock and the development of targeted drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0018] Figure 1 Schematic diagram of the goat CD46 protein structure and sgRNA target location in Example 1 of the present invention.

[0019] Figure 2 This is a diagram of the pSpCas9(BB)-2A-Puro (PX459) vector used in Example 1 of the present invention.

[0020] Figure 3 Figures 2A and 2B show the PCR and Sanger sequencing results of the ΔCD46-SSCs monoclonal cell line screened in Example 2 of the present invention; Figure A is a nucleic acid gel image of the PCR product of goat CD46, and the PCR product of the ΔCD46-SSCs monoclonal cell line has a 51-base deletion; Figure B is the Sanger sequencing result of the 51-base deletion.

[0021] Figure 4 This is a graph showing the off-target effect Sanger sequencing results of the top five potential off-target sites of the sgRNA targeting goat CD46 predicted by the website in Example 2 of the present invention.

[0022] Figure 5 3 is a comparison of the BVDV infection rates of ΔCD46-SSCs and wild-type SSCs in Example 3 of the present invention; A is immunofluorescence staining of BVDV E2 protein in cells; B is BVDV infection rate statistics.

[0023] Figure 6 This is a graph showing the results of detecting the intracellular BVDV viral load of ΔCD46-SSCs and wild-type SSCs in Example 3 of the present invention.

[0024] Figure 7 Graph showing the cell viability (CCK-8) test results of ΔCD46-SSCs and wild-type SSCs in Example 3 of the present invention. DETAILED DESCRIPTION

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0027] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0028] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0029] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0030] Unless otherwise specified, the chemical reagents, biochemical reagents and materials used in the present invention can be obtained from commercial channels.

[0031] Example 1 CD46 target design and CRISPR / Cas9 vector construction The mechanism of BVDV infection of cattle cells is based on the binding of viral capsid protein to the CCP1 structure of bovine CD46. In this example, sgRNA was designed in the CCP1 gene sequence of goat CD46. The protein structure and sgRNA target position of goat CD46 are shown in Figure 2. Figure 1 shown.

[0032] This example provides an sgRNA that specifically targets the goat CD46 gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0033] This example uses the sgRNA that specifically targets the goat CD46 gene to construct a CRISPR / Cas9 gene knockout vector containing the sgRNA, which specifically includes the following steps: (1) Plasmid linearization The pSpCas9(BB)-2A-Puro plasmid was digested with BbSⅠ; Enzyme digestion reaction system: plasmid 1 μg, BbSⅠ 1 μL, 10× Buffer 2 μL, ddH2O to 20 μL; Enzyme digestion reaction program: 37°C 30 min; Its plasmid map is as follows Figure 2 shown.

[0034] (2) sgRNA insertion The annealed sgRNA duplex (containing BbSⅠ sticky ends) was ligated to the linearized vector (T4 ligase, 22°C for 1 hour). DH5α competent cells were then transformed. Positive clones were isolated and shaken, and the culture was sent to the company for sequencing verification (primers: U6-F (SEQ ID NO. 2): 5'-CCGTAACTTGAAAGTATTTCG-3'; PX459-test-R (SEQ ID NO. 3): 5'-ATGGAAAGTCCCTATTGGC-3'). Positive single clones with correct sequencing results were expanded and the gene knockout vector was extracted.

[0035] Example 2 Gene Editing and Cell Line Establishment This example uses the CRISPR / Cas9 gene knockout vector constructed in Example 1 to edit the goat CD46 gene and screen to obtain positive cells, specifically including the following steps: (1) Electroporation transfection Cell pretreatment: Goat SSCs were seeded in 6-well plates and digested and collected when the density reached 80%. 120 mM KCl, 25 mM Hepes) and resuspended to 1 × 10 6 cells / mL; Transfection parameters: 10 μg of plasmid DNA was mixed with the cell suspension, and the electroporator (BTX ECM630) was set to 500–1000 V, 20–50 ms, and 1–3 pulses; Post-treatment: After transfection, add DMEM / F12 medium containing 10% FBS and culture at 37°C for 24 hours.

[0036] (2) Positive cell screening and monoclonal expansion Puromycin selection: Add 5 μg / mL puromycin for 3-5 days and select continuously. Then, dilute the surviving cells to 96-well plates. Sequencing verification: Genomic DNA of monoclonal cells was extracted and the CD46 target region was amplified by PCR (primers: CD46-goat-CCP1-F: 5'-GCTCTTATTCTCATTATTCCTAGATGC-3' (SEQ ID NO. 4), CD46-goat-CCP1-R: 5'-CCTCTAAGGAGCCTA-3' (SEQ ID NO. 5)). The PCR product was as follows: Figure 3 As shown in A, the PCR fragment of ΔCD46-SSCs is 51 bp shorter than that of wild-type SSCs. Figure 3 As shown in B, Sanger sequencing confirmed the 51-base deletion.

[0037] (3) Off-target site detection To test whether sgRNA would cause off-target effects in the genome, DNA sequencing was performed on the top five potential off-target sites predicted by the website; the PCR primers and off-target site sequences used to detect the top five predicted off-target sites are as follows: Off-target-1-F: CGACTTCCAGTCCTGTTGCT Off-target-1-R:GTGCCCCACGGAAATGACTA Off-target-2-F: AGGCTCCTGGTGTGTTCATG Off-target-2-R: TTCGAGGGGTGAAAGGCTTC Off-target-3-F: ACACTCACTACACAGGCTGC Off-target-3-R: CTCTGCTCCCGTAATCACCC Off-target-4-F:ACTCTGCAGGTGCTTGTGAA Off-target-4-R: CGGGAGCATCAAAGAGGTGT Off-target-5-F: CTGGGCTTCAGAGAAGTCGG Off-target-5-R:AACAGGGGATGCCCTTTCTG The off-target effect Sanger sequencing results of off-target sites are as follows Figure 4As shown, sequencing results showed that no editing occurred at the five potential off-target sites, indicating that the sgRNA was highly specific.

[0038] Example 3 Anti-virus function verification In this example, the ΔCD46-SSCs obtained in Example 2 were used to verify the antiviral function of goat CD46-deficient BVDV. The specific steps were as follows: (1) BVDV infection rate detection Wild-type SSCs and ΔCD46-SSCs were plated into 48-well plates, with 1.3×10 cells per well. 4 When the cells adhered to the wall and grew to 80% density, ΔCD46-SSCs and wild-type SSCs were infected with BVDV NADL strain at MOI=1, and the culture medium was replaced after 1 hour of adsorption. After 24 hours of infection, cells were fixed with 4% paraformaldehyde and incubated with antibodies against the capsid protein E2 of BVDV at 4°C overnight. Then, FITC-labeled goat anti-mouse IgG was incubated at room temperature in the dark for 1 hour, and images were captured under a fluorescence microscope. Figure 5 As shown in A; ImageJ was then used to analyze the BVDV infection rate, infection rate = number of cells positive for E2 immunofluorescence staining / total number of cells × 100%; infection rate as shown in Figure 5 As shown in B.

[0039] (2) Viral load detection Wild-type SSCs and ΔCD46-SSCs were plated into 6-well plates, with 1.2×10 5 When the cells adhered to the wall and grew to 80% density, ΔCD46-SSCs and wild-type SSCs were infected with BVDV NADL strain at MOI=1, and the culture medium was replaced after 1 hour of adsorption. Total cellular RNA was extracted 1, 6, 12, 24, 48, and 72 hours after infection, and viral copy number was detected by RT-qPCR (primers targeting BVDV 5'-UTR); Figure 6 It showed that the viral copy number in the ΔCD46 group decreased by 90%; The primer sequences are: 5'-UTR-F:ATGCCCTTAGTAGGACTAGCA 5'-UTR-R: TCAACTCCATGTGCCATGTAC.

[0040] (3) Cell activity assay Wild-type SSCs and ΔCD46-SSCs were plated into 96-well plates, with 4.5 × 10 cells per well. 3After 12 hours, ΔCD46-SSCs and wild-type SSCs were infected with BVDV NADL strain at MOI=1, and the culture medium was replaced after 1 hour of adsorption. Cell activity was detected using CCK-8 reagent at 1, 6, 12, and 24 hours after infection.

[0041] from Figure 7 It can be seen that BVDV had a significant inhibitory effect on the proliferation of WT SSCs at 12 h and 24 h after infection, but had no obvious toxic effect on ΔCD46-SSCs.

[0042] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.

Claims

1. A sgRNA specifically targeting goat CD46 gene, characterized in that The specific sequence of the sgRNA is shown in SEQ ID NO.

1.

2. The sgRNA according to claim 1, characterized in that The sgRNA targets the sequence from position 3569 to position 3588 of the CD46 gene.

3. A CRISPR / Cas9 gene knockout vector specifically targeting the goat CD46 gene, characterized in that: The CRISPR / Cas9 gene knockout vector comprises the sgRNA sequence according to any one of claims 1 to 2.

4. The CRISPR / Cas9 gene knockout vector according to claim 3, characterized in that The vector is a pSpCas9(BB)-2A-Puro (PX459) vector.

5. Use of the sgRNA according to any one of claims 1 to 2 or the CRISPR / Cas9 gene knockout vector according to any one of claims 3 to 4 in preparing a product for knocking out the goat CD46 gene.

6. A method for knocking out the goat CD46 gene using the CRISPR / Cas9 system, characterized in that: The method comprises the step of introducing the CRISPR / Cas9 gene knockout vector according to any one of claims 3 to 4 into cells, causing single-point editing of the CD46 gene to cause fragment deletion, and obtaining positive cells.

7. The method according to claim 6, characterized in that The introduction method is electroporation transfection.

8. The method according to claim 7, characterized in that The electroporation parameters are voltage 500-1000 V, pulse width 20-50 ms, and pulse number 1-3.

9. The method according to claim 6, characterized in that The cells are goat spermatogonial stem cells.

10. The method according to claim 6, characterized in that The positive cells obtained are positive cell lines determined by using primers with sequences as shown in SEQ ID NO. 4-5.