Mite calcium / calmodulin dependent protein kinase II alpha type gene dsRNA and application thereof

Abstract

The invention discloses a dsRNA of a mite calcium / calmodulin dependent protein kinase II alpha type gene and application thereof, the invention proves that the fused dsRNA of the CaMKII alpha gene has important practical significance in the aspect of dust mite prevention and treatment for the first time, and the dsRNA provided by the invention has the advantages of quick response, good mite killing effect, high biological safety and the like, has certain broad spectrum, and can be widely applied to the field of dust mite prevention and treatment. A new target gene is provided for dust mite prevention and control based on RNAi, a new prevention and control way and a new prevention and control strategy are provided for mite prevention and control, and the gene has a wide application prospect in the field of mite prevention and control.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a mite calcium / calmodulin-dependent protein kinase IIα type gene dsRNA and an application thereof. Background Art

[0002] Dust mites are microorganisms widely distributed globally, preferring warm and humid environments, such as beds, sofas, and carpets. In my country, the main species of dust mites include Dermatophagoides farina and Dermatophagoides pteronyssinus. They feed on human dander and reproduce rapidly, with a single gram of dust containing hundreds or even thousands of mites. According to statistics, under favorable conditions, the dust mite population can double every two to three weeks. Dust mites are a hidden killer for human health. Their carcasses, excrement, and shed skin contain potent allergens, which can easily trigger diseases such as allergic rhinitis, asthma, and atopic dermatitis. Medical research indicates that approximately 50% to 80% of allergic diseases are caused by dust mite allergies, and this proportion is as high as over 70% among children with asthma. Dust mites, particularly in spring and autumn, thrive in response to changes in temperature and humidity, leading to a surge in the incidence of allergic diseases. Currently, common methods for controlling dust mites include chemical and physical methods. While chemical acaricides can inhibit dust mite growth to a certain extent, they often contain toxic ingredients and can easily leave chemical residues indoors. This not only pollutes the environment but can also harm human health. Long-term use can even lead to the development of drug resistance in dust mites. Physical mite removal methods, such as high-temperature exposure and mechanical beating, are limited in effectiveness by the environment and conditions, making it difficult to completely eliminate the dust mites that hide in crevices and cracks in homes. Therefore, the development of an effective, safe, and environmentally friendly dust mite control product is urgent. This would not only help improve indoor living environments but also benefit allergy sufferers.

[0003] RNAi (RNA interference) was first discovered in the nematode Caenorhabditis elegans and is widely found in fungi, insects, plants, and animals. The principle of RNAi technology is that double-stranded RNA (dsRNA) specifically binds to the mRNA of a target homologous gene, triggering the RNAi effect. This ultimately degrades the target gene mRNA, inhibiting or affecting the function of the target gene, thereby affecting the growth, development, reproduction, and even death of the organism. RNAi technology has been recognized as a "fourth-generation insecticide" due to its advantages such as high efficiency, specificity, and biosafety. Therefore, RNAi can be used to inhibit specific genes in dust mites, affecting their normal gene function, ultimately reducing their growth and development, or even their death, and reducing their population size, thereby alleviating the harm they pose to human health.

[0004] Calcium / calmodulin-dependent protein kinase II (CaMKII) is widely present in various cells and 2+ / calmodulin and autophosphorylation activation, mediating intracellular Ca 2+ CaMKII is highly expressed in neurons, regulating a variety of neuronal functions, including gene expression, neurotransmitter synthesis and exocytosis, neurotransmitter receptor and ion channel function, cytoskeletal interactions and morphology, and various signaling pathways. Numerous studies have demonstrated that CaMKII plays a key role in the long-term regulation of synaptic transmission (long-term potentiation and depression) at the cellular level, and in complex animal behaviors such as learning and memory. Mammalian CaMKII isoforms are diverse, with four human CaMKII genes (α, β, γ, and δ) generating 40 CaMKII isoforms through alternative splicing. Mammalian CaMKll isoforms are diverse, with four human CaMKll genes generating 40 CaMKll isoforms through alternative splicing. Studies of CaMKII genes in insects are limited, limited to studies in fruit flies, honey bees, silkworms, and brown planthoppers. Studies have shown that CaMKII plays an important role in the development, physiological regulation, and flight of the insect nervous system. However, to date, no CaMKII genes have been reported in dust mites. Therefore, RNAi technology using the dust mite CaMKII gene can lead to the rapid death of dust mites or reduce their population size, and is an effective method for preventing and controlling the health hazards caused by dust mites. Summary of the Invention

[0005] In view of this, the present invention aims to provide a fusion dsRNA of a dust mite calmodulin-dependent protein kinase IIα gene fragment and the use of the dsRNA in preventing and controlling dust mites in the art.

[0006] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical solutions:

[0007] The first aspect of the present invention provides a dust mite calcium / calmodulin-dependent protein kinase IIα subunit CaMKIIα gene fragment.

[0008] Furthermore, the nucleotide sequence of the dust mite calcium / calmodulin-dependent protein kinase IIα subunit CaMKIIα gene fragment is shown in SEQ ID NO: 1.

[0009] The second aspect of the present invention provides amino acids encoding the dust mite calcium / calmodulin-dependent protein kinase IIα subunit CaMKIIα gene fragment described in the first aspect of the present invention.

[0010] In some embodiments, the sequence corresponding to the amino acids described in the second aspect of the present invention can be obtained by combining the sequence shown in SEQ ID NO: 1 with conventional methods known to those skilled in the art. For example, SEQ ID NO: 1 can be analyzed using an online tool (e.g., NCBI's ORF Finder) to identify the start and stop codons. The ORF is then divided into groups of three bases (codons) and translated into amino acids using the genetic code. Alternatively, automatic translation can be performed using online tools, including but not limited to NCBI's ORF Finder and ExPASy Translate Tool.

[0011] The third aspect of the present invention provides a dsRNA for controlling dust mites.

[0012] Furthermore, the dsRNA is synthesized using the dust mite calcium / calmodulin-dependent protein kinase IIα subunit CaMKIIα gene fragment described in the first aspect of the present invention as a template.

[0013] Furthermore, the nucleotide sequence of the sense strand of the dsRNA is shown in SEQ ID NO: 10, and the nucleotide sequence of the antisense strand is the reverse complementary sequence of SEQ ID NO: 10.

[0014] In some embodiments, the dsRNA (double-stranded RNA) is an RNA molecule formed by the renaturation of two complementary strands. It can be cleaved by the Dicer enzyme to form siRNA, which participates in various important biological processes in organisms. Dust mites are a major allergen that induces diseases such as allergic rhinitis and asthma. The present invention utilizes RNA interference (RNAi) technology to design dsRNA targeting dust mite genes. This dsRNA can silence key dust mite genes, hindering their growth and development or even killing them, thereby achieving preventive and therapeutic effects.

[0015] Nucleic acid pesticides are considered to be the next generation of pesticides that can replace chemical pesticides. They have the characteristics of high efficiency, specific killing, no residue, and green environmental protection. The present invention provides a nucleic acid pesticide from dust mites, which is a double-stranded RNA (dsRNA) of the calcium / calmodulin-dependent protein kinase IIα type gene (CaMKIIα), a key lethal gene of mites. It mainly adopts RNAi technology. Specifically, dsRNA is taken into the mouthparts of mites or penetrates the body wall to bring the dsRNA of the target gene CaMKIIα into the body. After the dsRNA enters the body of the mite, it activates the degradation of CaMKIIαmRNA in a targeted manner, causing the mites to die in a short period of time (48 hours) without rebound phenomenon.

[0016] Furthermore, the dsRNA sequence designed in the present invention is unique. First, the dsRNA is specific for mites, and second, it encompasses homologous sequences from a wide range of mites. The dsRNA provided by the present invention targets only mites, ensuring biosafety. Furthermore, the dsRNA is effective against a wide range of mites, addressing the issue of broad-spectrum efficacy. It offers advantages such as rapid onset of action, excellent acaricidal efficacy, and high biosafety, while also possessing a broad spectrum.

[0017] A fourth aspect of the present invention provides an agent for controlling dust mites.

[0018] Furthermore, the reagent contains the dsRNA described in the third aspect of the present invention.

[0019] In some embodiments, the dosage form of the agent includes, but is not limited to, a liquid dosage form, a solid dosage form, a sustained-release dosage form, or a special application dosage form.

[0020] In some embodiments, the liquid dosage form includes, but is not limited to, sprays or drops. The spray is in the form of an aqueous or oily solution containing dsRNA, which is evenly sprayed onto furniture surfaces, carpets, mattresses, and other areas prone to dust mite breeding using a sprayer (e.g., a pneumatic or electric sprayer). Stabilizers (e.g., trehalose or glycerol) can be added to the spray to prevent dsRNA degradation, and surfactants (e.g., Tween-80) can be added to enhance the solution's adhesion to fabric surfaces. The drops are in the form of a high-concentration dsRNA solution, which is precisely dripped onto specific areas (e.g., air conditioning filters, gaps in pet litter pads, and other narrow spaces where dust mites gather in high density) using a dropper.

[0021] In some embodiments, the solid dosage form includes, but is not limited to, powders / granules or tablets / effervescent tablets. The powder / granules are in the form of dry powders or granules mixed with an inert carrier (e.g., silica, starch), which can be applied by sprinkling or using a duster. The carrier must have adsorptive and sustained-release capabilities, such as porous silica that adsorbs the dsRNA and slowly releases it. The tablets / effervescent tablets are in the form of tablets compressed with a disintegrant (e.g., sodium bicarbonate, citric acid). Upon contact with water, carbon dioxide is released and the solution disintegrates. The solution can be used for soaking and cleaning fabrics such as mattresses and pillows, or formulated as a spray.

[0022] In some embodiments, the sustained-release dosage form includes, but is not limited to, a nano-delivery system or a sustained-release film / patch. The nano-delivery system is in the form of dsRNA encapsulated in nanoparticles (such as liposomes, polymer nanoparticles) to form a stable colloidal solution or freeze-dried powder. It can be used in public places (such as hotels and hospitals) where long-term control is required. The sustained-release film / patch is in the form of a film or patch made of dsRNA and a degradable polymer (such as polyvinyl alcohol or chitosan), which is attached to the edge of furniture, bed frames, etc., and is suitable for long-term protection (such as laying a sustained-release film under a mattress).

[0023] In some embodiments, the special application formulation includes but is not limited to: textile treatment agents or air purifier additives. The textile treatment agent is in the form of an emulsion or resin containing dsRNA, which is attached to the surface of textiles (such as sheets, curtains) through processes such as padding and coating. The dsRNA needs to be covalently bound to chemical groups (such as hydroxyl groups) on the surface of the fiber to ensure washing resistance. It is suitable for people at high risk of allergy to dust mites (such as asthma patients). The air purifier additive is in the form of dsRNA loaded on an adsorption material such as activated carbon and zeolite, which is loaded into the air purifier filter element. Aerosols containing dust mites are captured through air circulation. The dsRNA exerts an interference effect after contacting the dust mites, and is suitable for continuous purification of indoor air.

[0024] In some embodiments, the dosage form of the agent also includes an intelligent dosage form, an eco-friendly carrier, and a multi-target compound preparation. Among them, the intelligent dosage form refers to the combination of microencapsulation technology, which triggers the release of dsRNA by temperature and humidity (such as release when the temperature of the mattress rises). The eco-friendly carrier refers to the use of natural polysaccharides (such as cellulose, hyaluronic acid) instead of synthetic polymers to reduce environmental residues. The multi-target compound preparation refers to a mixture of dsRNA targeting different genes of dust mites, reducing the risk of drug resistance while optimizing the compatibility of the dosage form.

[0025] It should be noted that the present invention does not particularly limit the specific dosage form of the reagent, and those skilled in the art can make routine selections based on actual needs. The reagent of the present invention is not limited to a specific dosage form, as long as the reagent contains the dsRNA of the present invention as described above, it falls within the scope of protection of the present invention.

[0026] A fifth aspect of the present invention provides any of the following methods:

[0027] (1) A method for controlling dust mites, comprising: treating dust mites with the dsRNA described in the third aspect of the present invention or the reagent described in the fourth aspect of the present invention;

[0028] (2) A method for synthesizing the dsRNA according to the third aspect of the present invention, comprising: using the upstream primer shown in SEQ ID NO: 2 and the downstream primer shown in SEQ ID NO: 3 to synthesize a PCR product by PCR, using the product as a template for synthesizing the dsRNA, and then synthesizing the dsRNA by in vitro transcription.

[0029] Furthermore, the minimum dosage of the dsRNA is 0.2 μg / g.

[0030] Furthermore, the optimal dosage of the dsRNA is greater than or equal to 0.6 μg / g.

[0031] In specific embodiments of the present invention, experimental verification has shown that when 0.6 μg or more of dsCaMKIIα-1 (i.e., the dsRNA described in the third aspect of the present invention) is present in every gram of artificial dust mite diet, the mite killing rate can reach 100%. In contrast, when the dosage of dsCaMKIIα-2 or dsCaMKIIα-3 reaches 1.0 μg / g, the mite killing rate does not reach above 80%. This shows that dsCaMKIIα-1 has the highest mite killing efficiency, a result that is unexpected by those skilled in the art based on the existing technology.

[0032] In some embodiments, the present invention does not particularly limit the specific dosage of the dsRNA and can be flexibly adjusted according to the actual application scenario, control objectives, and environmental conditions. As long as the dsRNA provided by the present invention achieves the corresponding effect (especially the effect of controlling dust mites), the specific dosage used falls within the scope of protection of the present invention.

[0033] In a specific embodiment of the present invention, the PCR product synthesized by the upstream and downstream primers is After purification using the SV Gel and PCR Clean-Up System (Promega) kit, the dsRNA was synthesized as a template using the T7 RiboMAX TM The Express RNAi System (Promega) kit was used to synthesize dsRNA by in vitro transcription. The concentration of the obtained dust mite CaMKIIα gene fusion dsRNA was measured using a SpectraMax 190 microplate reader. After calculating the total mass, the dsRNA was lyophilized into powder.

[0034] The sixth aspect of the present invention provides a set of primers for synthesizing the dsRNA according to the third aspect of the present invention.

[0035] Furthermore, the primers include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO: 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 3.

[0036] A seventh aspect of the present invention provides any of the following applications:

[0037] (1) Use of the dsRNA described in the third aspect of the present invention in controlling dust mites;

[0038] (2) Use of the dsRNA described in the third aspect of the present invention in the preparation of an agent for preventing and controlling dust mites.

[0039] Furthermore, the dust mites are house dust mites and / or dust mites.

[0040] In some embodiments, the control includes both prevention and treatment, aiming to reduce dust mite population density and allergen release through active intervention and ongoing management, thereby alleviating threats to human health (such as allergic rhinitis and asthma) and damage to objects (such as textiles and home environments). Prevention refers to preventing the growth and spread of dust mites, while treatment refers to directly reducing the number of existing dust mites.

[0041] In some embodiments, the dust mite is a microscopic arthropod belonging to the class Arachnida, subclass Acari. In the present invention, the dust mite includes, but is not limited to, house dust mite, dust mite farinae, dust mite merantii, tropical anaplasmosis, tyrophagous putrescentiae, wood mite herxophila, and / or warehouse mite. In specific embodiments of the present invention, the dust mite is house dust mite and / or dust mite farinae.

[0042] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0043] (1) The present invention has experimentally demonstrated that a certain amount of dry powder of the fusion dsRNA (dsCaMKIIα-1) of the CaMKIIα gene synthesized by the present invention is fully mixed with the artificial feed of dust mites, and can effectively inhibit the expression of the target gene within 24 hours. When the concentration of dsRNA reaches 0.6 μg / g, the mortality rate of mites is as high as 100%. Comparative experiments have also demonstrated that the effect of dsCaMKIIα-1 is significantly better than that of dsCaMKIIα-2 and dsCaMKIIα-3. This result is a technical effect that would not have been anticipated by those skilled in the art based on the prior art.

[0044] (2) The present invention demonstrates for the first time that the fusion dsRNA of the CaMKIIα gene has important practical significance in preventing and controlling dust mites. The dsRNA provided by the present invention has the advantages of rapid onset, good mite-killing effect, high biosafety, and a certain broad spectrum. The present invention provides a new target gene for RNAi-based dust mite control, and provides a new control approach and control strategy for the control of mites, and has broad application prospects in the field of mite control. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 :The lethal effects of different fusion dsRNA fragments of the CaMKIIα gene (dsCaMKIIα-1, dsCaMKIIα-2, dsCaMKIIα-3) on house dust mites;

[0046] Figure 2 :The phenotype of mites after being treated with CaMKIIα gene fusion dsCaMKIIα-1 for 24h and 48h;

[0047] Figure 3 : Silencing efficiency of target gene after mites were treated with different fusion dsRNAs of CaMKIIα gene (dsCaMKIIα-1, dsCaMKIIα-2, dsCaMKIIα-3) for 24 h, **P<0.01. DETAILED DESCRIPTION

[0048] The present invention will be further described below with reference to specific embodiments. The following specific embodiments are intended only to illustrate the present invention and are not to be construed as limiting the present invention. Those skilled in the art will appreciate that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the present invention. The scope of the present invention is defined by the claims and their equivalents.

[0049] The experimental consumables, reagents, and raw materials used in the present invention are readily available to those of ordinary skill in the art and, unless otherwise specified, can be obtained commercially. Experimental methods for which specific conditions are not specified in the present invention are generally performed under conventional conditions or as recommended by the manufacturer. In particular, the following examples are intended only to illustrate the present invention and should not limit the scope of the present invention in any way. It should be noted that the experimental conditions and results described in the following examples are intended only to illustrate the present invention and should not, and will not, limit the present invention described in detail in the claims.

[0050] Example 1 Design of dsRNA sequence for dust mite CaMKIIα gene fusion

[0051] Using the genome databases of the house dust mite (Dermatophagoides pteronyssinus) (https: / / www.ncbi.nlm.nih.gov / datasets / taxonomy / 6956 / ) and the dust mite (Dermatophagoides farina) (https: / / www.ncbi.nlm.nih.gov / datasets / taxonomy / 6954 / ), we searched for the full-length mRNA sequences of the calcium / calmodulin-dependent protein kinase II (CaMKII) α-type genes of these two dust mites. These gene sequences were further analyzed using bioinformatics methods, and multiple fusion short short RNAs (dsCaMKIIα-1, dsCaMKIIα-2, and dsCaMKIIα-3) were designed targeting highly conserved sequences. The dsCaMKIIα-1 is 442 bp long and its sequence is shown in SEQ ID NO: 1. The fusion dsCaMKIIα-1 sequence showed 98.7% and 98.4% similarity to the dsRNA regions of Dermatophagoides farinae and Dermatophagoides pteronyssinus, respectively. dsCaMKIIα-2 and dsCaMKIIα-3 are 391 bp and 464 bp in length, respectively, and their sequences are SEQ ID NO: 4 and SEQ ID NO: 5, respectively. The dsCaMKIIα-2 sequence showed 98.7% and 97.7% similarity to the dsRNA regions of Dermatophagoides farinae and Dermatophagoides pteronyssinus, respectively. The dsCaMKIIα-3 sequence showed 98.3% and 97.6% similarity to the dsRNA regions of Dermatophagoides farinae and Dermatophagoides pteronyssinus, respectively. The resulting fusion dsRNA sequence was synthesized by Shanghai Sangon Biotech Co., Ltd., and its sequence accuracy was verified by sequencing.

[0052] dsCaMKIIα-1:CACGAAAACAGAAGTGATCAAAGTAACGGAACAATTA TTGGAAGCAATCAATACGGGCGATTATGATACATATGCAAAATTATGCGATCCAAATATAACAGCATTCGAACCGGCAGCATTGGGAAACCTAGTGGAGGGTGTGGACTTCCATAAATTCTACTTTGACAATGTATTTGGAAAGAATTGTAAATCAATCAATTCAACTATATTGAATCCATCGGTTCATCTATTGGGTGATGATGCCGCCTGTATCGCCTATATCCGTTTGACACAATATGTTGACAAACAAGGCGTTGCTCATACTCAACAATCGGAAGAGACAAGAGTATGGTTACGTAAAGATGGTAAATGGCAAAATTGTCATCTACATCGTTCAATGCGTACAGTATCTGGTCATCAATTAGCATTTTGACCATCACCATTAAGAATCAATGTCGTTGT(SEQ ID NO:1)。

[0053] dsCaMKIIα-2:GGCTATCCACCCTTTTGGGATGAAGATCAACATCGTTTA TATGCTCAGATAAGCCGGAGCCTATGATTATCCATCACCTGAATGGGATACAGTAACACCGGAAGCTAAAAATTTAATAAATTCAATGCTAACGGTAAATCCGGCAAAACGTATAACAGCAGCCGAAGCATTGAAACATCCTTGGATATGTCAACGTGAACGTGTTGCTAGTACCT TACATCGGCAAGAAACAGTGGATTGTTTGAAAAAATTCAATGCAAGACGTAAGCTTAAAGGAGCTATATTGACCACTATGTTAGCAACTAGAAATTTTTCCAGTCGATCGATCATCAATAAGAAAAGTGATGGTTCACAAGTAAAAGAAAGCACCGATTCATCCAACACAACGT(SEQ ID NO:4)。

[0054] dsCaMKIIα-3: AGAAGAGCTCGGAAAAGGAGCATTTTCTGTTGTACGAC GATGTGTACAAAAATCTACATGCCTGGAATTTGCTGCCAAAATAATCAACACTAAAAAAACTTTCATCTCGAGATTTTCAAAAACTCGAACGTGAAGCACGTATATGTCGTAAATTAAATCATCCTAATATTGTTCGTTTACATGACAGCATCCAGGAAGAAGGATTTCATTATCTTATTTTTGATCTGGTTACCGGTGGTGAATTATTT GAAGATATTGTTGCACGTGAATATTATTCCGAAGCAGATGCTTCCCATTGTATACAACAGATATTGGAATCCGTTAACCATTGCCATATGAATAATGTTGTTCATCGAGATCTAAAGCCGGAAAATTTACTATTGGCCAGTAAAGCTAAAGGTGCCGCCGTTAAATTGGCTGACTTTGGCTTGGCCATTGAAGTTCAAGGTGAACAACAAGCGTGGT(SEQ ID NO:5).

[0055] Example 2 Synthesis of Dust Mite CaMKIIα-type Gene Fusion dsRNA

[0056] Based on the dsCaMKIIα-1 fusion sequence SEQ ID NO: 1, upstream and downstream primers containing T7 promoter sequences were designed, and their sequences were SEQ ID NO: 2 and SEQ ID NO: 3, respectively. Similarly, upstream and downstream primers for dsCaMKIIα-2 and dsCaMKIIα-3 were designed, and their sequences were SEQ ID NO: 6 and SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9, respectively. All primers used were synthesized by Shanghai Sangon Biotechnology Co., Ltd. The PCR products synthesized with the above upstream and downstream primers were After purification using the SV Gel and PCR Clean-Up System (Promega) kit, the dsRNA was synthesized as a template using the T7 RiboMAX TM The Express RNAi System (Promega) kit (containing RNase A) was used to synthesize dsRNA by in vitro transcription. The concentration of the obtained dust mite CaMKIIα-type gene fusion dsRNA was measured using a SpectraMax 190 microplate reader, and the total mass was calculated and then lyophilized into powder.

[0057] Taking dsCaMKIIα-1 as an example, the sense strand of the prepared dsRNA is consistent with SEQ ID NO: 1 (T is replaced by U, i.e., the sequence shown in SEQ ID NO: 10); the antisense strand is the reverse complement of SEQ ID NO: 1 (T is replaced by U).

[0058] Upstream primer for fusion with dsCaMKIIα-1: TAATACGACTCACTATAGGGCACGAAA ACAAGAAGTGATC (SEQ ID NO: 2);

[0059] Downstream primer for fusion with dsCaMKIIα-1: TAATACGACTCACTATAGGGACAACGAC ATTGATTCTTAA (SEQ ID NO: 3);

[0060] Upstream primer for fusion of dsCaMKIIα-2: TAATACGACTCACTATAGGGGGCTATCC ACCCTTTTGGGA (SEQ ID NO: 6);

[0061] Downstream primer for fusion with dsCaMKIIα-2: TAATACGACTCACTATAGGGACGTTGTG TTGGATGAATCG (SEQ ID NO: 7);

[0062] Upstream primer for fusion of dsCaMKIIα-3: TAATACGACTCACTATAGGGAGAAGAG CTCGGAAAAGGAG (SEQ ID NO: 8);

[0063] Downstream primer for fusion with dsCaMKIIα-3: TAATACGACTCACTATAGGGACCACGCTTGTTGTTCACCT (SEQ ID NO: 9).

[0064] SEQ ID NO: 10: CACGAAAACAAGAAGUGAUCAAAGUAACGGAACA AUUAUUGGAAGCAAUCAAUACGGGCGAUUAUGAUACAUAUGCAAAAUUAUGCGAUCCAAAUAUAACAGCAUUCGAACCGGCAGCAUUGGGAAACCUAGUGGAGGGUGGACUUCCAUAAAUUCUACUUUGACAAUGUAUUUGGAAAGAAUUGUAAAUCAAUCAAUUCAACUAUAUUGAAUCCAUCGGUUCAUCUAUUGGGUGA UGAUGCCGCCUGUAUCGCCUAUAUCCGUUUGACACAAUAUGUUGACAAACAAGGCGUUGCUCAUACUCAACAAUCGGAAGAGACAAGAGUAUGGUUACGUAAAGAUGGUAAAUGGCAAAAUUGUCAUCUACAUCGUUCAAUGCGUACAGUAUCUGGUCAUCAAUUAGCAUUUUGACCAUCACCAUUAAGAAUCAAUGUCGUUGU.

[0065] Example 3 Application of Dust Mite CaMKIIα-type Gene Fusion dsRNA in Controlling Dust Mites

[0066] Weigh a certain amount of the fused dsRNA dry powder prepared in Example 2 and thoroughly mix it with the artificial feed for house dust mites. Five dosage gradients of fused dsRNA to feed mass ratios were set: 1.0 μg / g, 0.8 μg / g, 0.6 μg / g, 0.4 μg / g, and 0.2 μg / g. The fused dsRNA was fed to the animals according to the test method specified in the agricultural industry standard "Test Methods and Evaluation of Indoor Efficacy of Registered Pesticides for Public Health Use - Part 2: Mite Killers and Acaricide Repellents" (NY / T 1151.2-2006).

[0067] The standard test insect was the dust mite (Dermatophagoides farina), and the test environment was 25°C and 85% humidity. Four 3-cm-diameter Petri dishes were uniformly coated on the upper edge of each of the five mass ratio gradients. A mixture of white oil and petroleum jelly was applied evenly to the upper edge of the inner wall. Three of the dishes were filled with 0.05 g of artificial dust mite diet mixed with fused dsRNA; one dish contained only 0.05 g of artificial dust mite diet as a control. After 200 test insects were placed in the center of each dish, the dishes were placed in a watertight incubator for observation. Dead mites were counted using a dissecting microscope after 24 and 48 hours.

[0068] According to the formula Calculate the mite killing rate, where P is the mite killing rate; R is the number of dead test insects; N is the number of test insects. When the mite mortality rate in the control group is less than 5%, no correction is required; when the mite mortality rate in the control group is between 5% and 20%, the formula Calculate the adjusted mortality rate, where P t To correct the mite killing rate; P y is the mite killing rate of the experimental group; P x is the mite killing rate of the control group.

[0069] The results of 48h mite killing rate of three fusion dsRNA with five dosage gradients are as follows Figure 1 The results show that when the amount of dsCaMKIIα-1 per gram of artificial dust mite diet is 0.6 μg or more, the mite killing rate can reach 100%. In contrast, when the amount of dsCaMKIIα-2 or dsCaMKIIα-3 reaches 1.0 μg / g, the mite killing rate does not reach above 80%. This shows that dsCaMKIIα-1 has the highest mite killing efficiency, which is a technical effect that was unexpected by those skilled in the art based on the existing technology.

[0070] After 24 and 48 hours of dsCaMKIIα-1 application, the mite-killing effect was as follows Figure 2 Results showed that 24 hours after dsCaMKⅡα-1 treatment, approximately 64% of the dust mites showed no signs of life, with approximately 20% moving their appendages with their abdomens facing upward, while the rest moved slowly. By 48 hours after treatment, 100% of the dust mites had died. In contrast, both adult and nymph dust mites in the control group (CK) crawled around rapidly.

[0071] The target gene silencing efficiency of D. farinae was tested 24 hours after feeding. 100 whole insects were used for RNA extraction, with three biological replicates per group. Total RNA from each sample was extracted and reverse transcribed into first-strand cDNA. Real-time PCR was used to detect the relative expression levels of the target gene (CaMKⅡα) and the housekeeping gene (β-actin) to calculate the silencing efficiency of the target gene. The results are shown in Figure 2. Figure 3 As shown in the results, the gene silencing efficiency of Dermatophagoides farinae CaMKⅡ type 24 hours after the use of dsCaMKⅡα-1 could reach 92.7%, while the gene silencing efficiency of dsCaMKⅡα-2 or 3 had no significant difference compared with the control group.

[0072] The above experimental results indicate that the dsCaMKIIα-1 prepared in the present invention can be used for the efficient prevention and treatment of dust mites.

Claims

1. A dust mite calcium / calmodulin-dependent protein kinase IIα subunit CaMKIIα gene fragment, characterized in that: The nucleotide sequence of the dust mite calcium / calmodulin-dependent protein kinase IIα subunit CaMKIIα gene fragment is shown in SEQ ID NO:

1.

2. Amino acids encoding the dust mite calcium / calmodulin-dependent protein kinase II α subunit CaMKIIα gene fragment according to claim 1.

3. A dsRNA for controlling dust mites, characterized in that: The dsRNA is synthesized using the dust mite calcium / calmodulin-dependent protein kinase IIα subunit CaMKIIα gene fragment as a template.

4. The dsRNA according to claim 3, characterized in that The nucleotide sequence of the sense strand of the dsRNA is shown in SEQ ID NO: 10, and the nucleotide sequence of the antisense strand is the reverse complementary sequence of SEQ ID NO:

10.

5. An agent for preventing and controlling dust mites, characterized in that: The reagent contains the dsRNA according to claim 3 or 4.

6. Any of the following methods: (1) A method for preventing and controlling dust mites, characterized in that: The method comprises: treating dust mites with the dsRNA according to claim 3 or 4 or the reagent according to claim 5; (2) A method for synthesizing dsRNA according to claim 3 or 4, characterized in that the method comprises: using the upstream primer shown in SEQ ID NO: 2 and the downstream primer shown in SEQ ID NO: 3 to synthesize a PCR product by PCR, using the PCR product as a template for synthesizing dsRNA, and synthesizing the dsRNA by in vitro transcription.

7. The method according to claim 6, characterized in that The minimum dosage of the dsRNA is 0.2 μg / g.

8. A set of primers for synthesizing the dsRNA according to claim 3 or 4, characterized in that: The primers include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO: 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

3.

9. Any of the following applications: (1) Use of the dsRNA according to claim 3 or 4 in controlling dust mites; (2) Use of the dsRNA according to claim 3 or 4 in the preparation of an agent for controlling dust mites.

10. The use according to claim 9, characterized in that The dust mites are house dust mites and / or dust mites.

Images