Molecular marker related to number of branches of medicago sativa, identification method, kit and application
By developing the InDel marker Ms_Chr8_2286757 on chromosome 8 of alfalfa and using PCR to detect the number of branches, the time-consuming and labor-intensive problem of branch number selection in alfalfa breeding was solved, and rapid and accurate branch number identification and breeding efficiency were improved.
Patent Information
- Application Number
- CN202510847890.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-24
- Publication Date
- 2025-09-05
AI Technical Summary
The existing technology for selecting the number of branches in alfalfa breeding is time-consuming, labor-intensive, and inaccurate, making it difficult to carry out efficient and accurate breeding through molecular markers.
An InDel marker, Ms_Chr8_2286757, located on chromosome 8 of alfalfa, was developed. PCR was used to detect branching-related traits, and combined with molecular marker-assisted breeding, the number of branches was identified by detecting the length of the PCR product band.
It has achieved rapid and accurate identification of the number of alfalfa branches, simplified the breeding process, improved breeding efficiency and accuracy, and provided genetic resource support.
Smart Images
Figure CN120591452A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and particularly relates to a molecular marker located on chromosome 8 and related to the number of alfalfa branches, an identification method, a kit and applications. Technical Background
[0002] Alfalfa (Medicago sativa L.) is an important legume forage grass, known as the "king of forage grasses". The yield of alfalfa is determined by multiple factors, among which the number of branches is one of the key factors. The number of branches directly determines the plant size and biomass of alfalfa. Studies have shown that an increase in the number of branches can significantly increase the dry matter yield of alfalfa. At present, alfalfa breeding in my country is still in the conventional breeding stage, and the exploration and identification of important traits such as the number of branches is not in-depth enough. By studying the genes related to the number of branches and their regulatory mechanisms, molecular markers closely linked to the branching trait can be developed for use in molecular marker-assisted breeding to improve breeding efficiency and accuracy.
[0003] Traditionally, the selection of new alfalfa varieties with a large number of branches is based on the selection of individual plants according to the number of branches in the breeding offspring. This method is time-consuming and labor-intensive, and has low accuracy. Molecular markers, on the other hand, reflect the differences in genomic DNA fragments of individual organisms, directly reflect the essence of germplasm resources, have the advantages of high efficiency, accuracy and economy, greatly shorten the breeding cycle, and are a powerful supplement to traditional breeding technology. InDel markers are specific primers designed from the gene sequences on both sides of the insertion / deletion site. They can be directly and quickly detected according to the size of the PCR product fragment, and have the advantages of high accuracy, good stability and low cost. The present invention utilizes 258 alfalfa materials to construct a population, resequencing them, and conducting whole-genome association analysis in combination with branching traits to develop an InDel site related to branching. The present invention provides theoretical support and genetic resources for the selection of new alfalfa materials with a large number of branches. Summary of the Invention
[0004] One of the objectives of the present invention is to provide a molecular marker related to the number of branches of alfalfa.
[0005] A second object of the present invention is to provide an application of the above-mentioned molecular marker related to the number of alfalfa branches.
[0006] A third object of the present invention is to provide a method for identifying the number of alfalfa branches.
[0007] In order to achieve the above object, the present invention adopts the following technical solutions:
[0008] The invention discloses a molecular marker related to the number of alfalfa branches, which is located on chromosome 8 of alfalfa. The molecular marker is named Ms_Chr8_2286757.
[0009] The primer pair for amplifying the above molecular markers has the following sequence:
[0010] Ms_Chr8_2286757-F: GTATAAGGGCCACACATTTTGGT (shown in SEQ ID NO. 1);
[0011] Ms_Chr8_2286757-R: CATAGAAGGTCTTGGGCCGC (shown in SEQ ID NO. 2);
[0012] The present invention also discloses the use of the aforementioned molecular marker primer pair in alfalfa branch-assisted breeding. Specifically, the molecular markers of the present invention can be used in future molecular marker-assisted breeding. By extracting DNA from leaves at the seedling stage and detecting the presence of the molecular markers of the present invention, branch-related traits of alfalfa materials can be identified. The detection can be performed using PCR, specifically the aforementioned molecular marker primer pair. The detection can also be performed using sequencing.
[0013] The present invention also discloses the application of the molecular marker in identifying the branching traits of alfalfa, especially in screening and identifying the number of alfalfa branches. Specifically, the specific steps for identifying the number of alfalfa branches are as follows:
[0014] (1) The DNA of the test germplasm was used as a template for PCR amplification, and the markers Ms_Chr8_2286757-F and Ms_Chr8_2286757-R were used as primers. The PCR amplification reaction system was as shown in Table 1:
[0015] Table 1 PCR amplification reaction system
[0016]
[0017] (2) Pre-denaturation at 94°C for 5 min; 32 cycles of denaturation at 94°C for 30 s, annealing at 72°C for 30 s, and extension at 72°C for 15 s; extension at 72°C for 10 min; and storage at 4°C.
[0018] (3) Agarose gel electrophoresis detection of PCR products: Take 7 μL and determine the number of alfalfa branches based on the results of the bands.
[0019] PCR amplification was performed using primer pairs Ms_Chr8_2286757-F and Ms_Chr8_2286757-R. If the PCR amplification product had only one characteristic band with a length of 250 bp as shown in SEQ ID NO.4, the alfalfa was a type with a large number of branches; if the PCR amplification product had both a characteristic band with a length of 250 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 202 bp as shown in SEQ ID NO.5, the alfalfa was a type with a small number of branches.
[0020] In addition, the present invention also protects a kit for identifying the branching trait of alfalfa, comprising the primer pair Ms_Chr8_2286757-F and Ms_Chr8_2286757-R. The other components of the kit are conventional reagents, specifically including PCR buffer, dNTPs, and Taq DNA polymerase. The present invention does not particularly limit the concentration of the primer pair; primer concentrations well known in the art may be used. The present invention does not particularly limit the sources of the PCR buffer, dNTPs, and Taq DNA polymerase; conventional PCR amplification reagents well known in the art may be used.
[0021] The kit of the present invention can be used to quickly identify whether alfalfa has a large or small number of branches, and can also quickly identify the branching genotype of alfalfa. The specific method refers to identifying whether alfalfa has a trait of a large number of branches. The specific steps are: by performing electrophoresis detection and / or sequencing on the PCR amplification product, if the PCR amplification product has only one characteristic band with a length of 250bp as shown in SEQ ID NO.4, the alfalfa is a homozygous genotype with a large number of branches; if the PCR amplification product has both a characteristic band with a length of 250bp as shown in SEQ ID NO.4 and a characteristic band with a length of 202bp as shown in SEQ ID NO.5, the alfalfa is a heterozygous genotype with a small number of branches.
[0022] The present invention has the following advantages:
[0023] (1) The present invention constructed a population using 258 alfalfa materials, resequenced them, and performed whole-genome association analysis in combination with branching traits, developing an InDel site related to branching, which provides theoretical support and genetic resources for breeding new alfalfa materials with a large number of branches.
[0024] (2) Using the molecular markers of the present invention to screen the branching traits of alfalfa is beneficial to molecular marker-assisted selection breeding. The method is simple and feasible, and is beneficial to improving efficiency and saving costs.
[0025] (3) The molecular marker of the present invention has the characteristics of convenient detection, stable amplification products and high specificity, and can be easily, quickly and high-throughput applied to the identification and breeding of alfalfa materials with a large number of branches. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 This is the genome-wide association analysis result of alfalfa branches, which is a Manhattan plot obtained based on EMMAX software analysis. The green dots indicate the positions of the InDels associated with the present invention.
[0027] Figure 2 This is a box plot of the branch distribution corresponding to the genotype of the Ms_Chr8_2286757 locus of the alfalfa population of the present invention; 0 / 0 means that the genotype of the Ms_Chr8_2286757 locus is a genotype with a large number of homozygous branches, and 0 / 1 means that the Ms_Chr8_2286757 locus is a genotype with a small number of heterozygous branches; the dots are extreme values of the data, and **** represents P < 0.0001.
[0028] Figure 3 This is the partial sequence comparison result of the branch-related region between the materials with a large number of branches and the materials with a small number of branches.
[0029] Figure 4 This is the electrophoresis diagram of molecular markers amplified from 17 alfalfa germplasm resources. The concentration of agarose gel is 2.5%. DETAILED DESCRIPTION
[0030] The present invention will be further described below with reference to specific examples, and the advantages and features of the present invention will become more apparent as the description proceeds. However, the specific experimental methods involved in the following examples, unless otherwise specified, are all conventional methods or are performed under the conditions recommended by the manufacturer's instructions.
[0031] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The experimental methods in the following examples are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be purchased from the market.
[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.
[0033] Example 1 Development of molecular markers associated with alfalfa branch number
[0034] The present invention uses the number of branches (unit: pieces) of alfalfa at the initial flowering stage as a measurement standard. The higher the value, the more branches the alfalfa has; the lower the value, the fewer branches the alfalfa has. After measuring the number of branches in 258 alfalfa populations, a GWAS analysis was performed to locate an InDel site in alfalfa ( Figure 1 The green locus is named Ms_Chr8_2286757. This locus is located on chromosome 8 at position 2286757 in the Medicago sativa reference genome (download the "ZhongmuNo.1_genome.fasta.gz" file from the URL: https: / / figshare.com / articles / dataset / Medicago_sativa_genome_and_annotation_files / 12623960, which is the Medicago sativa genome sequence). The first allele is 0 / 0, and the second allele is 0 / 1. A boxplot of the number of branches corresponding to the genotypes at the Ms_Chr8_2286757 locus is shown ( Figure 2 ), indicating that the number of branches of the alfalfa strain with genotype 0 / 0 was significantly greater than that of the alfalfa strain with genotype 0 / 1. At position 2286757 on chromosome 8 of alfalfa, the insertion / deletion fragment CTTCTGTTTTTTATTTGACATTTTTTCCTTCACCTTTTTTCATGATTT (shown in SEQ ID NO.3) ( Figure 3 ), which has an impact on the number of branches of alfalfa. The alfalfa into which the fragment shown in SEQ ID NO.3 is inserted has a large number of branches; the alfalfa into which the fragment shown in SEQ ID NO.3 is deleted has a small number of branches.
[0035] Based on the InDel variant and its upstream and downstream sequences, the following primers were designed using NCBI software:
[0036] Ms_Chr8_2286757-F: GTATAAGGGCCACACATTTTGGT (shown in SEQ ID NO. 1); Ms_Chr8_2286757-R: CATAGAAGGTCTTGGGCCGC (shown in SEQ ID NO. 2);
[0037] Then, the primers were used to perform PCR amplification on the test samples. The results showed that the PCR product of the homozygous alfalfa sample with a large number of branches had only a 250bp characteristic band, while the PCR product of the heterozygous alfalfa sample with a small number of branches had both a 250bp characteristic band and a 202bp characteristic band.
[0038] Example 2 Verification of the Accuracy of the Molecular Markers Described in the Present Invention
[0039] 123 germplasms were identified using the above molecular marker primer pairs. The specific germplasm materials used are shown in Table 2:
[0040] Table 2 Genotypes and branch numbers corresponding to the Ms_Chr8_2286757 locus of 123 materials
[0041]
[0042]
[0043]
[0044] 1) using the genomic DNA of alfalfa to be identified as a template, performing PCR amplification using the primer pair to obtain a PCR product;
[0045] (4) The PCR amplification reaction system is as follows: 10-100 ng of template DNA, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 10 μL of 2× SanTaq PCR Mix, and deionized water to 20 μL. The PCR amplification reaction procedure is preferably as follows: 94°C pre-denaturation for 5 min; 32 cycles of 94°C denaturation for 30 s, 72°C annealing for 30 s, and 72°C extension for 15 s; 72°C extension for 10 min; and storage at 4°C. Separation is performed by electrophoresis on a 2.5% agarose gel. After spotting, the samples are electrophoresed at 120 V DC for 60 min, and the PCR band pattern of each sample is read.
[0046] 2) Judging whether the number of branches of the alfalfa is large or small based on the size of the PCR product: when the fragment shown in SEQ ID NO. 3 is inserted into the PCR product of the alfalfa to be identified, the alfalfa to be identified is alfalfa with a large number of branches;
[0047] When the fragment shown in SEQ ID NO. 3 is missing from the PCR product of the alfalfa to be identified, the alfalfa to be identified is alfalfa with a small number of branches;
[0048] Specifically, when the fragment shown in SEQ ID NO. 3 is inserted into the PCR product of the alfalfa to be identified, and the band length of the PCR product is 250 bp, the alfalfa to be identified is alfalfa with a large number of branches.
[0049] The sequence of SEQ ID NO.4 is as follows:
[0050] GTATAAGGGCCACACATTTTTGGTAATAATACAAGAGTAATTCTATCTAATTGTAGACAAGTTCCTATCTATTCTAAACTATGAATAAGAGCCACACATGTTACAATCTGCTTCTGTTTTTTATTTGACATTTTTTCCTTCACCTTTTTTCATGATTTTTCTTTTTCATTTTTTTATCTAAAATATATGAATGTTTCTATTAAGATGAAAACAAGCTTTCAAATTGAACTGGCGGCCCAAGACCTTCTATG.
[0051] When the fragment shown in SEQ ID NO. 3 is missing from the PCR product of the alfalfa to be identified, the length of the PCR product band is 202 bp, and the alfalfa to be identified is alfalfa with a small number of branches.
[0052] The sequence of SEQ ID NO.5 is as follows:
[0053] GTATAAGGGCCACACATTTTTGGTAATAATACAAGAGTAATTCTATCTAATTGTAGACAAGTTCCTATCTATTCTAAACTATGAATAAGAGCCACACATGTTACAATCTGTTCTTTTTCATTTTTTTATCTAAAATATATGAATGTTTCTATTAAGATGAAAACAAGCTTTCAAATTGAACTGGCGGCCCAAGACCTTCTATG.
[0054] Furthermore, as shown in Table 2, of the 123 alfalfa accessions identified in this study, 59 were homozygous for a high-branching genotype (0 / 0). The average number of branches for these 59 accessions was 38.39. Sixty-four accessions were heterozygous for a low-branching genotype (0 / 1). The average number of branches for these 64 accessions was 31.31, lower than the average for the 59 high-branching accessions. Analysis of variance indicated that the branch numbers for the high-branching genotypes were significantly different from those for the low-branching genotypes (P < 0.0001). Figure 4The PCR test results of 17 germplasms (Salt-Tolerant Star, Zhongmu No. 4, Gongnong No. 4, CF001174, Nongjing No. 1, CF040656, CF031930, Pioneer, CF050057, Jueneng 2, CF021077, Saite, CF039747, Yingster, Gongnong No. 6, Knight 2, and Xinmu No. 1) are shown. In the figure, the 0 / 0 type material only amplified a band of 250bp in length, which is a genotype with a large number of homozygous branches, which is consistent with the actual results of the first 10 materials with a large number of branches; while the 0 / 1 type material amplified both a band of 250bp in length and a band of 202bp in length, which is a genotype with a small number of heterozygous branches, which is consistent with the actual results of the last 7 materials with a small number of branches. Therefore, the InDel molecular marker of the present invention can effectively identify the branch number trait of alfalfa and can be used for the prediction and screening of alfalfa materials with a large number of branches.
[0055] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, it is of course possible to easily make other implementation methods by replacing or changing the technical content disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.
Claims
1. A molecular marker associated with the number of branches in alfalfa, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.4 or SEQ ID NO.
5. The molecular marker is an insertion / deletion fragment CTTCTGTTTTTTATTTGACATTTTTTCCTTCACCTTTTTTCATGATTT on chromosome 8 of the alfalfa reference genome. The molecular marker is named Ms_Chr8_2286757. The sequence of the primer pair for amplifying the molecular marker is: Ms_Chr8_2286757-F: GTATAAGGGCCACACATTTTGGT; Ms_Chr8_2286757-R: CATAGAAGGTCTTGGGCCGC.
2. Use of the primer pair corresponding to the molecular marker described in claim 1 in molecular marker-assisted breeding of alfalfa.
3. The use according to claim 2, characterized in that The molecular marker is used for predicting, identifying or assisting in identifying the number of alfalfa branches.
4. A method for identifying the number of alfalfa branches, characterized in that: The method comprises the following steps: (1) Extracting genomic DNA of alfalfa to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) Determine based on the electrophoresis bands and / or sequencing results of step (2), with the specific criteria being: PCR amplification was performed using primers Ms_Chr8_2286757-F and Ms_Chr8_2286757-R. If the PCR amplification product had only one characteristic band of 250 bp in length as shown in SEQ ID NO.4, the alfalfa was a type with a large number of branches; if the PCR amplification product had both a characteristic band of 250 bp in length as shown in SEQ ID NO.4 and a characteristic band of 202 bp in length as shown in SEQ ID NO.5, the alfalfa was a type with a small number of branches.
5. A kit for identifying alfalfa branching genotypes, characterized in that: The kit comprises a primer pair corresponding to the molecular marker described in claim 1.
6. The use according to claim 5, characterized in that The method for identifying alfalfa branch genotypes using the kit comprises the following steps: (1) Extracting genomic DNA of alfalfa to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) The PCR amplification products were subjected to electrophoresis detection and / or sequencing. If the PCR amplification product had only one characteristic band of 250 bp in length as shown in SEQ ID NO. 4, the alfalfa was a genotype with a large number of homozygous branches. If the PCR amplification product had both one characteristic band of 250 bp in length as shown in SEQ ID NO. 4 and one characteristic band of 202 bp in length as shown in SEQ ID NO. 5, the alfalfa was a genotype with a small number of heterozygous branches.