TAU splicing conversion oligonucleotides and pharmaceutical compositions for treatment or prevention of TAU-related diseases

By using splicing conversion oligonucleotides that bind to intron 1B of TAU pre-mRNA, the splicing process is changed, which solves the problem of difficulty in reducing TAU expression in existing technologies and achieves the effect of effectively treating or preventing TAU-related diseases.

CN120603948APending Publication Date: 2025-09-05OTSUKA PHARM CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202480011542.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-02-10
Filing Date
2024-02-09
Publication Date
2025-09-05

AI Technical Summary

Technical Problem

Existing drugs have not been able to effectively reduce the expression of TAU by regulating splicing, leading to the occurrence of diseases such as Tauopathy.

Method used

A splice-switching oligonucleotide was developed that binds to intron 1B of TAU pre-mRNA and reduces TAU expression by altering the splicing process.

Benefits of technology

By changing the splicing of TAU pre-mRNA, the expression of TAU is significantly reduced, effectively treating or preventing TAU-related diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present invention includes a splice-converted oligonucleotide that binds to the intron 1B of TAU pre-mRNA, and a pharmaceutical composition for treating or preventing TAU-related diseases, containing the splice-converted oligonucleotide.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application claims priority based on Japanese Patent Application No. 2023-019305, the entirety of which is incorporated herein by reference.

[0002] The present invention includes splice-switching oligonucleotides targeting TAU pre-mRNA and pharmaceutical compositions containing the splice-switching oligonucleotides for treating or preventing TAU-related diseases. Background Art

[0003] TAU is a microtubule-binding protein that is expressed in large quantities in the neurons of the central nervous system and is associated with the stabilization of microtubules in axons. Abnormalities in TAU can lead to axonal degeneration, neurofibrillary changes, and abnormal localization of TAU, causing diseases such as tauopathies. In order to reduce the expression of TAU, a variety of antisense oligonucleotides called gapmers have been developed. Gapmers regulate the expression of target proteins by inducing the cleavage of target RNA by ribonuclease H (RNase H) and utilizing the DNA / RNA double strand.

[0004] Splicing is the process of removing introns from the precursor mRNA (pre-mRNA) transcribed from a gene and joining exons. This process produces mature mRNA encoding a protein from the pre-mRNA. The development of splicing regulators that regulate splicing and restore functional proteins is progressing, and some are being practically applied to spinal muscular atrophy. However, no drug that reduces TAU expression by regulating splicing has been marketed to date. Summary of the Invention

[0005] Problems to be solved by the invention

[0006] The object of the present invention is to provide a splice-switching oligonucleotide targeting TAU pre-mRNA, and a pharmaceutical composition containing the same for treating or preventing TAU-related diseases.

[0007] Methods used to solve problems

[0008] In one embodiment, the present invention provides a splice-switching oligonucleotide that binds to intron 1B of TAU pre-mRNA.

[0009] In one embodiment, the present invention provides a pharmaceutical composition for treating or preventing a TAU-related disease, comprising the splice-switching oligonucleotide.

[0010] Effects of the Invention

[0011] The present invention can treat or prevent TAU-related diseases by changing the splicing of TAU pre-mRNA and reducing the expression of TAU. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1A Identification of the sense sequence inserted into exon 1B (1). Shown are the sense strand sequence of TAU pre-mRNA (SEQ ID NO: 38) to which the oligonucleotide complements, the positions of the primers (118, 120) used in RT-PCR, and representative TAU transcripts.

[0013] Figure 1B Identification of the sense sequence inserted into exon 1B (2). iPS cells were treated with 1 μM oligonucleotides (Comparative Example Compound 1, Scramble (scrambled control), Compounds 2 to 5) for 15 days, and RT-PCR was performed on TAU (top) and control ACTB (bottom). As a positive control for PCR, template DNA was synthesized (right end). The transcripts assumed based on molecular weight are recorded on the right.

[0014] Figure 2A Confirmation of exon composition based on Sanger sequencing (1). Figure 1B The three bands at around 335 bp, 235 bp, and 200 bp identified in the sample treated with compound 4 were excised from the gel, cloned into a plasmid, and insertion of the insert was confirmed by PCR and electrophoresis.

[0015] Figure 2B Confirmation of exon composition based on Sanger sequencing (2). Figure 2A (Top) Base sequence of clone 2. Results from a single end of the forward primer are shown. The stop codon (TGA) contained in exon 1B is underlined and marked with "Stop."

[0016] Figure 2C Confirmation of exon composition based on Sanger sequencing (3). Figure 2A (Middle) The base sequence of clone 10. The results from a single end of the forward primer are shown. The stop codon (TGA) contained in exon 1B is underlined and marked with "Stop."

[0017] Figure 2D Confirmation of exon composition based on Sanger sequencing (4). Figure 2A (Bottom) Base sequence of clone 24. Results from a single end of the forward primer are shown.

[0018] Figure 3AConstruction of qPCR for selectively quantifying TAU productive mRNA (TAU productive mRNA) and TAU nonproductive mRNA (TAU nonproductive mRNA) (1). (Top) Shows the positions of primers (arrows) and probes (lines) designed for selective detection of TAU nonproductive mRNA. (Bottom) Serial dilutions of various template synthetic DNAs were performed using a TAU nonproductive mRNA detection kit, and the resulting Ct values ​​and copy numbers are shown in the figure. 6 When the Ct value under copy was greater than 40 and could not be calculated, it was recorded as ND.

[0019] Figure 3B Construction of a qPCR system for selectively quantifying TAU productive mRNA and TAU non-productive mRNA (2). (Top) Shows the positions of primers (arrows) and probes (lines) designed for selective detection of TAU productive mRNA. (Bottom) Serial dilutions of various template synthetic DNAs were performed using a TAU productive mRNA detection kit, and the resulting Ct values ​​and copy numbers are shown in the figure.

[0020] Figure 3C Construction of a qPCR system for selectively quantifying TAU productive and non-productive mRNA (3). (Top) Shows the positions of primers (arrows) and probes (lines) designed for selective detection of TAU pre-mRNA. (Bottom) Serial dilutions of various template synthetic DNAs were performed using a TAU pre-mRNA detection kit, and the resulting Ct values ​​and copy numbers are shown in the figure.

[0021] Figure 4A Detailed investigation of the splicing switching activity of oligonucleotides (1) The sense strand sequence of TAUpre-mRNA complementary to compounds 1 to 6 (SEQ ID NO: 38) and TAU transcription products (productive mRNA and non-productive mRNA linked to exon 4) are shown.

[0022] Figure 4B To investigate the splicing switching activity of oligonucleotides in detail (2), iPS cells were treated with 1 μM oligonucleotides (Scramble, Comparative Example Compound 1, and Compounds 1 to 6) for 15 days, and the copy numbers of non-productive mRNA, productive mRNA, and ACTB were quantified. The results were plotted using ACTB as the reference value, with the non-treated cells as 100%.

[0023] Figure 5Absolute quantification of TAU protein. (Top) Variants of TAU protein expressed in the central nervous system are shown. The combination of the pattern of inserting 2, 1 or 0 N-terminal insertion fragments and the pattern of inserting 4 or 3 C-terminal microtubule binding domains is a total of 6 variants. General abbreviations and amino acid numbers are recorded. (Bottom) The longest 2N4R TAU recombinant protein (cross, dotted line) and the shortest 0N3R TAU recombinant protein (circle, solid line) were quantified using the commercially available HTRF (registered trademark) kit, and the concentration of the recombinant protein and the resulting fluorescence signal were plotted.

[0024] Figure 6A This is a concentration-dependent test I(1). iPS cells were treated with compound 7 at a specified concentration for 15 days, and the expression levels of various proteins were quantified.

[0025] Figure 6B This is a concentration-dependent test I(2). iPS cells were treated with compound 8 at a specified concentration for 15 days, and the expression levels of various proteins were quantified.

[0026] Figure 6C This is a concentration-dependence test I (3). iPS neural cells were treated with a gapmer (Comparative Example Compound 1) at a predetermined concentration for 15 days, and the expression levels of various substances were quantified.

[0027] Figure 7A Identification of neural cells with increased TAU non-productive mRNA (1). iPS neural cells were treated with 3 μM of compound 7 or 8 for 15 days, and TAU non-productive mRNA was visualized. Scale bar represents 10 μm.

[0028] Figure 7B Identification of neural cells with increased expression of non-productive mRNA for TAU (2). Figure 7A After the manipulation, cells were immunostained with antibodies against NeuN, a mature neural marker, and GABA, an inhibitory neural marker. Scale bars represent 10 μm.

[0029] Figure 8A This is scRNA-seq (1). The schedule for oligonucleotide treatment of iPS cells is shown.

[0030] Figure 8B scRNA-seq (2) shows the results of two-dimensional clustering by dimensionality reduction of the gene expression profile of each cell.

[0031] Figure 8C This is a heat map of scRNA-seq (3) showing the expression of marker genes in each cluster.

[0032] Figure 8DscRNA-seq (4) Violin plots show the expression levels of TAU (MAPT) in the excitatory and inhibitory neuron populations in the gapmer (Comparative Example Compound 1), Compound 7, or Compound 8-treated groups.

[0033] Figure 8E scRNA-seq (5) shows the mean and 95% confidence interval of the difference in the ratio of TAU (MAPT) expression reduction in excitatory neurons and inhibitory neurons in the compound-treated group, obtained using the bootstrap method.

[0034] Figure 9A The inhibition of excessive neural activity caused by the reduction of endogenous TAU protein (1) is shown. The schedule of oligonucleotide treatment in the culture system of iPS neural cells and iPS astrocytes is shown.

[0035] Figure 9B This figure shows the suppression of excessive neural activity synchronization caused by the reduction of endogenous Tau protein (2). Raster plots are shown before (pre) (left) and after (post) KCl treatment (right). Individual thin lines represent spikes, individual thick lines represent bursts (= generated by continuous spikes lasting several seconds), squares represent network bursts, and clusters represent spike histograms.

[0036] Figure 9C This is the suppression of excessive neural activity synchronization caused by the reduction of endogenous TAU protein (3). The number of network bursts before treatment was set to 100% and the proportion after treatment was corrected. N = 6 wells. Paired T test: <0.05, <0.01.

[0037] Figure 10A This is a concentration-dependent experiment II (1). iPS cells were treated with compound 7 at a specified concentration for 15 days. The expression levels of various proteins were quantified.

[0038] Figure 10B This is a concentration-dependent test II (2). iPS cells were treated with compound 8 at a specified concentration for 15 days, and the expression levels of various proteins were quantified.

[0039] Figure 10C This is a concentration-dependence test II (3). iPS neural cells were treated with a gapmer (Comparative Example Compound 2) at a predetermined concentration for 15 days, and the expression levels of various substances were quantified.

[0040] Figure 10DThis is a concentration-dependence test II (4). iPS neural cells were treated with a gapmer (Comparative Example Compound 3) at a predetermined concentration for 15 days, and the expression levels of various substances were quantified. DETAILED DESCRIPTION

[0041] Unless otherwise specified, the terms used in this specification have the meanings commonly understood by those skilled in the art in the fields of organic chemistry, medicine, pharmacy, molecular biology, microbiology, etc. The following lists several definitions of terms used in this specification, which take precedence over commonly understood meanings in this specification.

[0042] The present invention relates to oligonucleotides capable of reducing the amount of TAU protein by altering the splicing of TAU pre-mRNA.

[0043] TAU is a microtubule-binding protein abundantly expressed in neurons of the central nervous system and involved in the stabilization of axonal microtubules. TAU is divided into four regions, starting from the N-terminus: the N-terminal region, the proline-rich region, the microtubule-binding region, and the C-terminal region. The human TAU gene, also known as the MAPT (microtubule-associated protein tau) gene, is located on chromosome 17. TAU pre-mRNA refers to the unspliced ​​mRNA transcribed from the TAU gene. The human TAU gene is reported to have at least 16 exons, and alternative splicing of the TAU pre-mRNA produces six TAU protein variants ranging from 352 to 441 amino acids in length. The N-terminal region contains two insertions, N1 and N2, encoded by exon 2 and exon 3, respectively. The microtubule-binding region is divided into four domains, R1 to R4, with R2 encoded by exon 10. The N-terminal region includes three types: the 0N type in which both exon 2 and exon 3 are missing, the 1N type in which only exon 2 is present, and the 2N type in which both exon 2 and exon 3 are present. The microtubule-binding region includes two types: the 3R type in which exon 10 is missing and the 4R type in which exon 10 is present. Through the combination of these, there are 6 variants.

[0044] Splicing is the process of removing introns from pre-mRNA transcribed from a gene and joining exons. It is known that during splicing, RNA-binding proteins (RBPs) recognize exonic splicing enhancer (ESE), exonic splicing silencer (ESS), intronic splicing enhancer (ISE), or intronic splicing silencer (ISS) sequences within exons or introns, regulating the skipping or inclusion (insertion) of exons or introns.

[0045] The present inventors focused on the 135 nucleotides (nt) (sequence number 1) registered in the database as ENST00000571311.5, which should have been identified as an intron, but were identified as exons and inserted between exon 1 and exon 2. In this specification, the region on the DNA or RNA corresponding to the insertion sequence is referred to as exon 1B. Due to the insertion of exon 1B, a premature termination codon appears, and therefore TAU protein is not produced by the mRNA containing exon 1B. It is speculated that the mRNA is decomposed by NMD (nonsense-mediated mRNA decay). In the present invention, the mRNA that produces the protein encoded by the gene is referred to as productive mRNA, and the mRNA that does not produce the protein encoded by the gene is referred to as non-productive mRNA.

[0046] In this specification, exon 1B of TAU pre-mRNA (also referred to as TAU exon 1B) refers to the region of TAU pre-mRNA that corresponds to the sequence of SEQ ID NO: 1 when the TAU pre-mRNA and the sequence of SEQ ID NO: 1 are aligned in an optimal state (a state in which the identity is maximized), and is not limited to being composed of the sequence of SEQ ID NO: 1. In this specification, when a base sequence represents an RNA sequence, T in the base sequence should be understood to represent U, and when an RNA sequence is aligned with the base sequence described in this specification, T in the base sequence should be regarded as U.

[0047] TAU exon 1B

[0048] AGGGGAGTGAATTCACTGAGCTGAGAGCTGAGGAACCATTGATCTGATGGCTGAGACACCACTGGGAAGACTGGAGAGGCTTTTCTGGGCATGCAGTGCCAGGCACAGGAGGAGCTGAGGGAAGATGACTAAGAG (serial number 1)

[0049] The oligonucleotides of the present invention can bind to TAU pre-mRNA and change its splicing, as a result, the amount of TAU mRNA containing exon 1B can be increased and the amount of TAU protein can be reduced. The oligonucleotide binds to the pre-mRNA through hydrogen bonds between the bases of its nucleotides and the bases of the nucleotides of the complementary pre-mRNA. When it is said that the oligonucleotide can bind to the pre-mRNA, it means that the oligonucleotide has a degree of complementarity that can form a double strand with the pre-mRNA, and the oligonucleotide does not need to have a sequence that is completely complementary to the sequence of the pre-mRNA. As complementary base pairs, adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G) can be listed.

[0050] In the present invention, oligonucleotides that can change splicing are referred to as splice-switching oligonucleotides (SSOs). That is, the term "oligonucleotide" in this specification includes SSOs, and the description of "oligonucleotides" in this specification also applies to SSOs. Oligonucleotides that act as SSOs do not induce RNase H to decompose TAU pre-mRNA. RNase H is an enzyme that specifically cuts the RNA chain of the DNA / RNA double strand. Unlike SSOs, antisense oligonucleotides called gapmers induce the RNase H to decompose target mRNA. As described in Experiment 5 of the Example, it can be seen that in cells treated with oligonucleotides, when non-productive mRNA increases on the one hand and productive mRNA decreases on the other hand, the oligonucleotide acts as an SSO and does not induce RNase H to decompose TAU pre-mRNA.

[0051] In this specification, the intron between exon 1B and exon 2 is referred to as intron 1B. The oligonucleotide of the present invention binds to intron 1B of TAU pre-mRNA. As long as the oligonucleotide changes splicing in a way that increases the amount of TAU mRNA containing exon 1B, it can bind to any region of intron 1B. The representative sequence of the sense chain of intron 1B of TAU pre-mRNA is shown in sequence number 2. Intron 1B of TAU pre-mRNA refers to the region of TAU pre-mRNA that corresponds to the sequence of sequence number 2 when TAU pre-mRNA is aligned with the sequence of sequence number 2 in the optimal state (the state in which the consistency reaches the maximum), and is not limited to being composed of the sequence of sequence number 2. In one embodiment, the oligonucleotide contains a sequence complementary to a portion of intron 1B of TAU pre-mRNA, or is composed of the above sequence.

[0052] TAU intron 1B

[0053]

[0054] In one embodiment, the oligonucleotide contains a sequence that is complementary to a sequence having a sequence identity of 70%, 75%, 80%, 85%, 90% or more to the sequence of 5'-GGCAAAGAATTCAGAAATT-3' (SEQ ID NO: 3), or is composed of the above sequence; or, it contains a sequence that is complementary to the sequence of 5'-GGCAAAGAATTCAGAAATT-3' (SEQ ID NO: 3) or a sequence that is complementary to a sequence obtained by modifying 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 or 2 bases in the sequence of SEQ ID NO: 3, or is composed of the above sequence.

[0055] The sequence of SEQ ID NO: 3 corresponds to the sequence from positions 6 to 24 of the sense strand sequence of intron 1B of TAU pre-mRNA shown in SEQ ID NO: 2.

[0056] In one embodiment, the oligonucleotide contains a sequence complementary to a sequence consisting of at least 13 consecutive bases (i.e., 13, 14, 15, 16, 17, 18, or 19 bases) in the sequence 5'-GGCAAAGAATTCAGAAATT-3' (SEQ ID NO: 3), or consists of the above sequence.

[0057] In one embodiment, the oligonucleotide comprises or consists of a sequence complementary to a sequence having 70%, 75%, 80%, 85%, 90% or 95% sequence identity or greater with the sequence 5'-GGCAAAGAATTCAGAAAT-3' (SEQ ID NO: 4) or 5'-GCAAAGAATTCAGAAATT-3' (SEQ ID NO: 5); or comprises or consists of a sequence complementary to the sequence 5'-GGCAAAGAATTCAGAAAT-3' (SEQ ID NO: 4) or 5'-GCAAAGAATTCAGAAATT-3' (SEQ ID NO: 5), or a sequence complementary to a sequence in which 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 or 2 bases are modified in the sequence 5'-GGCAAAGAATTCAGAAAT-3' (SEQ ID NO: 4) or 5'-GCAAAGAATTCAGAAATT-3' (SEQ ID NO: 5).

[0058] In one embodiment, the oligonucleotide comprises a sequence complementary to the sequence of 5'-GGCAAAGAATTCAGAAAT-3' (SEQ ID NO: 4) or 5'-GCAAAGAATTCAGAAATT-3' (SEQ ID NO: 5), or consists of the above sequence.

[0059] In one embodiment, the oligonucleotide contains a sequence complementary to the sequence of 5'-GCAAAGAATTCAGAAATT-3' (SEQ ID NO: 5), or consists of the above sequence.

[0060] In one embodiment, the oligonucleotide comprises a sequence having 70%, 75%, 80%, 85%, 90% or 95% or more sequence identity to the sequence of 5'-ATTTCTGAATTCTTTGCC-3' (SEQ ID NO: 6) or 5'-AATTTCTGAATTCTTTGC-3' (SEQ ID NO: 7), or consists of the above sequence; or, the oligonucleotide comprises the sequence of 5'-ATTTCTGAATTCTTTGCC-3' (SEQ ID NO: 6) or 5'-AATTTCTGAATTCTTTGC-3' (SEQ ID NO: 7), or a sequence in which 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 or 2 bases are modified from the sequence of SEQ ID NO: 6 or SEQ ID NO: 7, or consists of the above sequence.

[0061] In one embodiment, the oligonucleotide comprises or consists of the sequence 5'-ATTTCTGAATTCTTTGCC-3' (SEQ ID NO: 6) or 5'-AATTTCTGAATTCTTTGC-3' (SEQ ID NO: 7).

[0062] In one embodiment, the oligonucleotide contains the sequence 5'-AATTTCTGAATTCTTTGC-3' (SEQ ID NO: 7) or consists of the aforementioned sequence.

[0063] In this specification, oligonucleotide refers to a compound containing multiple nucleotides bonded to each other by internucleotide bonds. Nucleotide refers to a compound containing a sugar component and a base component. Nucleotides include ribonucleotides and deoxyribonucleotides. The oligonucleotides of the present invention may contain any nucleotides and internucleotide bonds known in the art and may be manufactured by known nucleic acid synthesis techniques. In the oligonucleotides of the present invention, the nucleotides may be natural nucleotides or non-natural nucleotides, and the internucleotide bonds may be natural internucleotide bonds or non-natural internucleotide bonds. Non-natural nucleotides and / or oligonucleotides containing non-natural internucleotide bonds are also referred to as modified oligonucleotides.

[0064] Nucleotides can be natural or non-natural nucleotides. Natural nucleotides refer to compounds containing natural sugar components and natural base components, while non-natural nucleotides refer to compounds containing non-natural sugar components and / or non-natural base components.

[0065] The natural sugar component is furanose-type ribose or 2'-deoxyribose. The non-natural sugar component may include modifications of one or more atoms of the ribofuranose ring (e.g., one or more positions selected from the 2', 4', and 5' positions), bridging of two atoms of the ribofuranose ring (bicyclic sugar), substitution of the oxygen atom (O) of the ribofuranose ring with other atoms (e.g., S, N, or C), substitution of the ribofuranose ring with other structures, and any combination thereof.

[0066] Examples of modifications of the ribofuranose ring include halogen, amino, thiol, alkyl, alkenyl, alkynyl, O-alkyl, O-alkenyl, O-alkynyl, S-alkyl, S-alkenyl, S-alkynyl, N-alkyl, N-alkenyl, N-alkynyl, allyl, O-allyl, S-allyl, N-allyl, O-alkyl-O-alkyl (wherein the alkyl, alkenyl, alkynyl, and allyl groups may be substituted or unsubstituted alkyl, alkenyl, alkynyl, and allyl groups). In one embodiment, the modification of the ribofuranose ring is selected from 2'-F, 2'-OCH3(O-methyl), 2'-O(CH2)2OCH3(MOE), 4'-S, 5'-vinyl, and 5'-methyl.

[0067] Examples of nucleotides containing a bicyclic sugar include nucleotides in which the atom at the 2' position is bridged with the atom at the 4' position, such as LNA (locked nucleic acid / 2'-O,4'-C-methylene bridged nucleic acid), AmNA (amido bridged nucleic acid), and ENA (ethylene bridged nucleic acid).

[0068] Non-natural nucleotides may be compounds such as peptide nucleic acids (PNA) in which the sugar component is replaced with a non-cyclic structure.

[0069] Natural base is adenine (A), thymine (T), cytosine (C), guanine (G), uracil (U). As non-natural base, can enumerate the substitution body of natural base, comprise for example 5-methylcytosine, 5-hydroxymethylcytosine, 6-methyladenine, 6-methylguanine, 4-thiouracil, 5-fluorouracil etc. In this specification sheets, except the situation that has special record, all represent the sequence of oligonucleotide with natural base, but the oligonucleotide that is defined by such sequence includes the oligonucleotide that contains the non-natural base corresponding to this natural base.

[0070] The internucleotide bond can be a natural or non-natural internucleotide bond. The natural internucleotide bond is a phosphodiester bond. Non-natural internucleotide bonds include phosphotriesters, phosphorothioates, boranophosphates, phosphorodithioates, alkylphosphonates, phosphoguanidines, methylphosphonates, methylenemethylamino (-CH2-N(CH3)-O-CH2-), thiodiesters (-OC(O)-S-), thiocarbamates (-OC(O)(NH)-S-), siloxanes (-O-Si(H)2-O-) and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-).

[0071] An oligonucleotide may contain two or more nucleotides and / or two or more internucleotide bonds. When an oligonucleotide contains two or more nucleotides and / or two or more internucleotide bonds, the ratio and order of the nucleotides and internucleotide bonds are arbitrary.

[0072] In order to make the oligonucleotide function as an SSO, the type of nucleotides and / or the internucleotide bond can be selected in a manner that avoids inducing RNase H to decompose RNA. Those skilled in the art can appropriately select the type and position of nucleotides and internucleotide bonds required for the oligonucleotide to function as an SSO. In one embodiment, the oligonucleotide does not contain more than 6, more than 5, more than 4, more than 3 or more than 2, preferably more than 6, more than 5 or more than 4 consecutive natural deoxyribonucleotides. Gapmers can be oligonucleotides composed of a central region containing more than 4, more than 5 or more than 6 consecutive natural deoxyribonucleotides and a region (referred to as a 5' flanking region and a 3' flanking region) containing at least one non-natural nucleotide and having a length of more than 2 bases (e.g., 2 to 10 bases, 3 to 7 bases or 4 to 5 bases) at its 5' end and 3' end. Therefore, in one embodiment, the oligonucleotide of the present invention is not an oligonucleotide composed of a central region containing 4 or more, 5 or more, or 6 or more consecutive natural deoxyribonucleotides and a region of 2 bases or more in length (e.g., 2 to 10 bases in length, 3 to 7 bases in length, or 4 to 5 bases in length) located at the 5' and 3' ends thereof and containing at least one non-natural nucleotide.

[0073] The oligonucleotide can be 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 bases in length or more and 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 bases in length, where the upper and lower limits can be selected independently. In one embodiment, the oligonucleotide is 13 to 23, 14 to 22, 15 to 21 or 16 to 20 bases in length, for example 16, 17, 18, 19 or 20 bases in length.

[0074] In this specification, the term "a sequence comprising" a predetermined base sequence is used to include a sequence in which one or more bases are added to the predetermined base sequence and a sequence consisting of the predetermined base sequence.

[0075] Sequence identity refers to the proportion of identical bases between two sequences when aligned optimally (maximum identity). Sequence identity is calculated using the following formula: Sequence identity (%) = [(Number of identical bases between the two sequences) / (Alignment length)] × 100. Sequence identity can be calculated using programs such as FASTA and BLAST.

[0076] Base modifications include deletion, substitution, insertion, and addition. The modification may be any one of deletion, substitution, insertion, and addition, or a combination of two or more of these. For example, in modifications of two or more bases, each modification may be independently selected from deletion, substitution, insertion, and addition.

[0077] In one embodiment, the oligonucleotide increases the amount of TAU mRNA containing exon 1B by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, or 400% compared to a control.

[0078] In one embodiment, the oligonucleotide reduces the amount of TAU protein by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% compared to a control.

[0079] Whether an oligonucleotide can alter splicing to increase the amount of TAU mRNA containing exon 1B can be confirmed by quantitative PCR (qPCR) as described in Experiment 5 of the Examples. qPCR uses a set of forward primers designed to span between exon 1B and exon 4 and a reverse primer designed within exon 4, as well as a set of forward primers designed to span between exon 1 and exon 4 and a reverse primer designed within exon 4. If the amplification product of the former primer set increases and the amplification product of the latter primer set decreases, it can be determined that the oligonucleotide alters splicing to increase the amount of TAU mRNA containing exon 1B.

[0080] In one embodiment, the oligonucleotide can selectively increase the amount of TAU mRNA containing exon 1B in excitatory nerves. In this specification, the oligonucleotide can selectively increase the amount of TAU mRNA containing exon 1B in excitatory nerves means that the increase in the amount of TAU mRNA containing exon 1B in excitatory nerves caused by the oligonucleotide is greater than the increase in inhibitory nerves. As excitatory nerves, glutamatergic nerves can be listed, and as inhibitory nerves, GABAergic nerves can be listed. Whether the oligonucleotide can selectively increase the amount of TAU mRNA containing exon 1B in excitatory nerves can be confirmed, for example, by visualizing the TAU mRNA in excitatory nerves and inhibitory nerves using a probe that can detect TAU ​​mRNA containing exon 1B as described in Experiment 8 of the Example.

[0081] Whether the oligonucleotide can reduce the amount of TAU protein can be confirmed by conventional quantitative methods such as qPCR that are believed to reflect the amount of protein. In one embodiment, the oligonucleotide can selectively reduce the amount of TAU protein in excitatory nerves. By selectively reducing the amount of TAU protein in excitatory nerves, it is possible to inhibit neurodegeneration caused by excessive synchronization of neural activity and avoid side effects caused by unnecessary TAU inhibition. In this specification, the oligonucleotide can selectively reduce the amount of TAU protein in excitatory nerves means that the reduction in the amount of TAU protein in excitatory nerves caused by the oligonucleotide is greater than the reduction in inhibitory nerves. As excitatory nerves, glutamatergic nerves can be listed, and as inhibitory nerves, GABAergic nerves can be listed. Whether the oligonucleotide can selectively reduce the amount of TAU protein in excitatory nerves can be confirmed, for example, by measuring the expression level of TAU mRNA that is believed to be related to the amount of TAU protein by single-cell RNA sequencing (scRNA-seq) as described in Experiment 9 of the embodiment, and comparing the expression changes between the oligonucleotide-treated groups in excitatory nerves and inhibitory nerves.

[0082] In one embodiment, the oligonucleotide causes an increase in the amount of TAU mRNA containing exon 1B or a decrease in the amount of TAU protein in excitatory neurons that is at least 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390% or 400% greater than the increase or decrease in inhibitory neurons.

[0083] In one embodiment, the oligonucleotide causes an increase in the amount of TAU mRNA containing exon 1B or a decrease in the amount of TAU protein in excitatory nerves that is at least 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2.0-fold, 2.1-fold, 2.2-fold, 2.3-fold, 2.4-fold, 2.5-fold, 2.6-fold, 2.7-fold, 2.8-fold, 2.9-fold or 3.0-fold greater than the increase or decrease in inhibitory nerves.

[0084] In one embodiment, the oligonucleotide is selected from the following.

[0085]

[0086] The oligonucleotides of the present invention can reduce the amount of TAU protein and can be used to treat or prevent TAU-related diseases. In this specification, TAU-related diseases refer to diseases or conditions related to the accumulation or abnormal localization of TAU and its occurrence or development.

[0087] Examples of TAU-associated diseases include tauopathies and epilepsy. Other examples of TAU-associated diseases include dementias such as Alzheimer's dementia (AD), vascular dementia, dementia with Lewy bodies (DLB), Parkinson's disease, amyotrophic lateral sclerosis (ALS), Down syndrome (Down), Pick's disease (Pick), chronic traumatic encephalopathy (CTE), progressive supranuclear palsy (PSP), basal ganglia degeneration (CBD), and myotonic dystrophy type 1 (DM1). Other TAU-related diseases include Dravet syndrome, tuberous sclerosis complex (TSC), episodic ataxia (EA) (e.g., EA-1 and EA-2), cortical dysplasia-focal epilepsy (CDFE) syndrome, and developmental and epileptic encephalopathy (DEE) 14 or 18. Other TAU-related diseases include ophthalmic diseases such as glaucoma and age-related macular degeneration (AMD).

[0088] Treatment of TAU-related diseases includes amelioration of one or more symptoms or findings of the disease and inhibition of progression. Prevention of TAU-related diseases includes inhibition and delay of the onset of the disease.

[0089] The oligonucleotide is administered to the subject in an amount (referred to as an effective amount in this specification) that can exert a desired effect (e.g., a therapeutic or preventive effect on a TAU-related disease). The dosage can be appropriately selected according to the age, weight, health status, etc. of the subject. The oligonucleotide can be administered, for example, in a dosage of 0.01 mg to 10 mg, 0.01 mg to 5 mg, 0.01 mg to 1 mg, 0.01 mg to 0.5 mg, or 0.05 mg to 0.5 mg per kg of body weight. The oligonucleotide can be administered multiple times, can be administered daily, can be administered once a day or several days, once a week or several weeks, once a month or several months, or once for several years or for a lifetime. During the administration period, the dosage can be changed. The amount for one day can be administered once or divided into several doses (e.g., 2 to 4 times).

[0090] The method of administration can be appropriately selected according to the age, weight, health status, etc. of the subject. The method of administration can be oral administration or parenteral administration, preferably parenteral administration. As parenteral administration, subcutaneous administration, intradermal administration, intramuscular administration, intraperitoneal administration, intravenous administration, intramedullary administration, subarachnoid administration, brain parenchyma administration, intraventricular administration, intravitreal administration, suprachoroidal administration or subretinal administration can be listed. The oligonucleotide is administered, for example, by injection.

[0091] In the pharmaceutical composition, in addition to the oligonucleotide, it can also contain pharmaceutically acceptable carriers or additives such as sterile water, physiological saline, stabilizers, excipients, antioxidants, buffers, preservatives, surfactants, chelating agents, and binding agents. The oligonucleotide can be enclosed in carriers such as liposomes suitable for the administration of nucleic acid drugs. The dosage form is not limited, for example, it is an injection. As an injection, it includes solution injection, suspension injection, emulsion injection and injection prepared in time (such as lyophilized injection). The pharmaceutical composition can be provided in the form of a kit, and the kit can also contain the buffer used in the preparation, instructions for use, etc.

[0092] The subject can be a mammal, such as a human or a non-human mammal. Examples of non-human mammals include mice, rats, rabbits, cats, dogs, sheep, pigs, horses, cows, and monkeys. In one embodiment, the subject is a human.

[0093] In one embodiment, the present invention relates to a method for treating or preventing a TAU-related disease, comprising the step of administering to a subject an effective amount of a splice-switching oligonucleotide that binds to intron 1B of TAU pre-mRNA.

[0094] In one embodiment, the present invention relates to a splice-switching oligonucleotide that binds to intron 1B of TAU pre-mRNA, which is used for treating or preventing TAU-related diseases.

[0095] In one embodiment, the present invention relates to the use of a splice-switching oligonucleotide that binds to intron 1B of TAU pre-mRNA for the manufacture of a medicament for treating or preventing a TAU-related disease.

[0096] Exemplary embodiments of the present invention are described below.

[0097] [1]

[0098] A splice-switching oligonucleotide that binds to intron 1B of TAU pre-mRNA.

[0099] [2]

[0100] The splice switching oligonucleotide according to 1 above is capable of increasing the amount of TAU mRNA containing TAU exon 1B.

[0101] [3]

[0102] The splice switching oligonucleotide according to 1 or 2 above, which is capable of reducing the amount of TAU protein.

[0103] [4]

[0104] The splice switching oligonucleotide according to any one of 1 to 3 above, comprising a sequence complementary to a portion of intron 1B of TAU pre-mRNA.

[0105] [5]

[0106] The splice switching oligonucleotide according to any one of 1 to 4 above, comprising a sequence complementary to at least a portion of positions 6 to 24 of SEQ ID NO: 2.

[0107] [6]

[0108] The splice-switching oligonucleotide according to any one of 1 to 5 above, comprising a sequence complementary to a sequence having a sequence identity of 70%, 75%, 80%, 85%, 90% or 95% or more to the sequence of 5'-GGCAAAGAATTCAGAAATT-3' (SEQ ID NO: 3); or

[0109] The present invention comprises a sequence complementary to 5'-GGCAAAGAATTCAGAAATT-3' (SEQ ID NO: 3) or a sequence complementary to a sequence obtained by modifying 1 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 or 2 bases in the sequence of SEQ ID NO: 3.

[0110] [7]

[0111] The splice switching oligonucleotide according to any one of 1 to 6 above, comprising a sequence complementary to a sequence consisting of at least 13 consecutive bases in the sequence of 5'-GGCAAAGAATTCAGAAATT-3' (SEQ ID NO: 3).

[0112] [8]

[0113] The splice switching oligonucleotide according to any one of 1 to 7 above, comprising a sequence complementary to a sequence having 70%, 75%, 80%, 85%, 90% or 95% sequence identity or greater with the sequence 5'-GGCAAAGAATTCAGAAAT-3' (SEQ ID NO: 4) or 5'-GCAAAGAATTCAGAAATT-3' (SEQ ID NO: 5); or

[0114] The present invention comprises a sequence complementary to the sequence of 5'-GGCAAAGAATTCAGAAAT-3' (SEQ ID NO: 4) or 5'-GCAAAGAATTCAGAAATT-3' (SEQ ID NO: 5), or a sequence complementary to a sequence in which 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 or 2 bases are modified in the sequence of 5'-GGCAAAGAATTCAGAAAT-3' (SEQ ID NO: 4) or 5'-GCAAAGAATTCAGAAATT-3' (SEQ ID NO: 5), or consists of the above sequence.

[0115] [9]

[0116] The splice switching oligonucleotide according to any one of 1 to 8 above, comprising or consisting of a sequence complementary to 5'-GGCAAAGAATTCAGAAAT-3' (SEQ ID NO: 4) or 5'-GCAAAGAATTCAGAAATT-3' (SEQ ID NO: 5).

[0117]

[10]

[0118] The splice switching oligonucleotide according to any one of 1 to 9 above, comprising a sequence having 70%, 75%, 80%, 85%, 90% or 95% or more sequence identity with the sequence of 5'-ATTTCTGAATTCTTTGCC-3' (SEQ ID NO: 6) or 5'-AATTTCTGAATTCTTTGC-3' (SEQ ID NO: 7); or

[0119] A sequence comprising 5'-ATTTCTGAATTCTTTGCC-3' (SEQ ID NO: 6) or 5'-AATTTCTGAATTCTTTGC-3' (SEQ ID NO: 7), or a sequence in which 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 or 2 bases are modified in the sequence of SEQ ID NO: 6 or SEQ ID NO: 7, or consisting of the above sequence.

[0120]

[11]

[0121] The splice switching oligonucleotide according to any one of 1 to 10 above, comprising or consisting of a sequence of 5'-ATTTCTGAATTCTTTGCC-3' (SEQ ID NO: 6) or 5'-AATTTCTGAATTCTTTGC-3' (SEQ ID NO: 7).

[0122]

[12]

[0123] The splice-switching oligonucleotide according to any one of 1 to 11 above, which does not contain 6 or more, 5 or more, or 4 or more consecutive natural deoxyribonucleotides.

[0124]

[13]

[0125] The splice-switching oligonucleotide according to any one of 1 to 12 above, which is not an oligonucleotide consisting of a central region comprising 4 or more, 5 or more, or 6 or more consecutive natural deoxyribonucleotides and a region of 2 bases or more in length located at the 5' and 3' ends thereof and comprising at least one non-natural nucleotide.

[0126]

[14]

[0127] The splice switching oligonucleotide according to any one of 1 to 13 above, which has a length of 16 to 20 bases.

[0128]

[15]

[0129] The splice switching oligonucleotide according to any one of 1 to 14 above, which is capable of selectively increasing the amount of TAU mRNA containing TAU exon 1B in excitatory neurons.

[0130]

[16]

[0131] The splice-switching oligonucleotide according to any one of 1 to 15 above, which is capable of increasing the amount of TAU mRNA containing TAU exon 1B in excitatory neurons by at least 5% more than the increase in inhibitory neurons.

[0132]

[17]

[0133] The splice switching oligonucleotide according to any one of 1 to 16 above, which can selectively reduce the amount of TAU protein in excitatory neurons.

[0134]

[18]

[0135] The splice-switching oligonucleotide according to any one of 1 to 17 above, which is capable of reducing the amount of TAU protein in excitatory neurons by at least 5% more than that in inhibitory neurons.

[0136]

[19]

[0137] An oligonucleotide comprising or consisting of a sequence complementary to a sequence having 70%, 75%, 80%, 85%, 90% or 95% sequence identity or greater to the sequence 5'-GGCAAAGAATTCAGAAAT-3' (SEQ ID NO: 4) or 5'-GCAAAGAATTCAGAAATT-3' (SEQ ID NO: 5); or

[0138] The present invention comprises a sequence complementary to the sequence of 5'-GGCAAAGAATTCAGAAAT-3' (SEQ ID NO: 4) or 5'-GCAAAGAATTCAGAAATT-3' (SEQ ID NO: 5), or a sequence complementary to a sequence in which 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 or 2 bases are modified in the sequence of 5'-GGCAAAGAATTCAGAAAT-3' (SEQ ID NO: 4) or 5'-GCAAAGAATTCAGAAATT-3' (SEQ ID NO: 5), or consists of the above sequence.

[0139]

[20]

[0140] An oligonucleotide comprising or consisting of a sequence having 70%, 75%, 80%, 85%, 90% or 95% or greater sequence identity to the sequence 5'-ATTTCTGAATTCTTTGCC-3' (SEQ ID NO: 6) or 5'-AATTTCTGAATTCTTTGC-3' (SEQ ID NO: 7); or

[0141] A sequence comprising 5'-ATTTCTGAATTCTTTGCC-3' (SEQ ID NO: 6) or 5'-AATTTCTGAATTCTTTGC-3' (SEQ ID NO: 7), or a sequence in which 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 or 2 bases are modified in the sequence of SEQ ID NO: 6 or SEQ ID NO: 7, or consisting of the above sequence.

[0142] [twenty one]

[0143] A pharmaceutical composition comprising the splice-switching oligonucleotide according to any one of 1 to 18 above or the oligonucleotide according to 19 or 20 above.

[0144] [twenty two]

[0145] The pharmaceutical composition according to the above 21 is used for treating or preventing TAU-related diseases.

[0146] [twenty three]

[0147] The pharmaceutical composition according to item 22 above, wherein the TAU-related disease is tauopathy or epilepsy.

[0148] [twenty four]

[0149] The pharmaceutical composition according to the above 22, wherein the above TAU-related disease is selected from the group consisting of Alzheimer's dementia, vascular dementia, Lewy body dementia, Parkinson's disease, amyotrophic lateral sclerosis, Down syndrome, Pick's disease, chronic traumatic encephalopathy, progressive supranuclear palsy, basal ganglia degeneration and myotonic dystrophy type 1.

[0150]

[25]

[0151] The pharmaceutical composition according to the above 22, wherein the TAU-related disease is selected from the group consisting of Dravet syndrome, tuberous sclerosis, periodic ataxia, CDFE syndrome and DEE14 or 18.

[0152]

[26]

[0153] The pharmaceutical composition according to item 22 above, wherein the TAU-related disease is selected from the group consisting of glaucoma and age-related macular degeneration.

[0154]

[27]

[0155] The pharmaceutical composition according to item 21 above is used for suppressing neurodegeneration caused by excessive synchronization of neural activity.

[0156]

[28]

[0157] A method for treating or preventing a TAU-related disease, comprising administering an effective amount of the splice switching oligonucleotide according to any one of 1 to 18 above, the oligonucleotide according to 19 or 20 above, or the pharmaceutical composition according to any one of 21 to 27 above to a subject.

[0158]

[29]

[0159] The splice switching oligonucleotide according to any one of 1 to 18 above, or the oligonucleotide according to 19 or 20 above, which is used for treating or preventing a TAU-related disease.

[0160]

[30]

[0161] Use of the splice switching oligonucleotide according to any one of 1 to 18 above or the oligonucleotide according to 19 or 20 above for the manufacture of a medicament for treating or preventing a TAU-related disease.

[0162] Example

[0163] 1. Synthesis and Purification of Oligonucleotides

[0164] The oligonucleotides shown in Table 1 were synthesized.

[0165] [Table 1]

[0166]

[0167] <Method>

[0168] The synthesis of compounds 1, 2, 3, 4, 5, 6, 7 and 8 (Table 1) was carried out according to the steps shown in Table 2. Using commercially available 5'-O-DMTr nucleotide CPG (1 μmol scale), steps 1-8 of Table 2 were repeated by a nucleic acid automatic synthesizer (M-8-MX manufactured by Japan Technosapiens) to extend the chain, and then the 5'-O-DMTr group was removed by 3% DCA in CH2Cl2. The deprotection of the nucleic acid base protecting groups and phosphate protecting groups of compounds 1, 2, 3, 4, 5 and 6 and the cleavage of the linker were achieved by treating them in a 25% NH3 aqueous solution at 55°C for 5 hours. On the other hand, the deprotection of the nucleic acid base protecting groups and phosphate protecting groups of compounds 7 and 8 and the cleavage of the linker were achieved by treating them in 20% diethylamine in MeCN at 25°C for 1 hour and then treating them in a mixture of TEA-MeOH-water (1:1:2, v / v / v) at 65°C for 20 hours. The resulting crude product was purified using ion-exchange HPLC (DNAPac PA100, manufactured by Thermo Scientific). Fractions containing the target oligonucleotide were collected, purified using a simple reverse-phase column (Sep-Pak, manufactured by Waters), and freeze-dried. The yield was determined by UV quantification at 260 nm (Shimazu UV-1800), and the composition was identified by LC-MS (Xevo G2-XS Qtof, manufactured by Waters).

[0169] Results

[0170] Compound 1: Yield 1.2 mg, ESI-MS: m / z calculated 6031.6, found 6030.7.

[0171] Compound 2: Yield 1.1 mg, ESI-MS: m / z calculated 6006.5, found 6005.7.

[0172] Compound 3: Yield 0.2 mg, ESI-MS: m / z calculated 6006.5, found 6006.0.

[0173] Compound 4: Yield 1.0 mg, ESI-MS: m / z calculated 6016.5, found 6015.7.

[0174] Compound 5: Yield 0.7 mg, ESI-MS: m / z calculated 6042.5, found 6041.7.

[0175] Compound 6: Yield 1.4 mg, ESI-MS: m / z calculated 6026.5, found 6025.9.

[0176] Compound 7: Yield 0.8 mg, ESI-MS: m / z calculated 6768.2, found 6768.3.

[0177] Compound 8: Yield 2.6 mg, ESI-MS: m / z calculated 6775.3, found 6777.9.

[0178] [Table 2]

[0179]

[0180] Scramble and Comparative Example Compound 1 were synthesized in the same manner. Scramble served as a negative control. Comparative Example Compound 1 is an example of a gapmer-type antisense oligonucleotide targeting TAU mRNA.

[0181] 2. Identification of the sense sequence inserted into exon 1B

[0182] To identify SSO-type antisense oligonucleotides, cDNA from human iPS cell-derived neural cells (hereinafter referred to as "iPS neural cells") treated with Compound 2, 3, 4, or 5 was subjected to RT-PCR and electrophoresis to qualitatively evaluate splicing switching activity.

[0183] <Method>

[0184] iCell GlutaNeurons 01279 (FUJIFILM Cellular Dynamics, Inc.), a commercial product containing a mixture of glutamatergic neurons (excitatory neurons) and GABAergic neurons (inhibitory neurons), was used according to the instructions provided with the product. TMAfter poly-D-lysine 384-well black transparent flat-bottom TC-treated microplates (Corning), coated with poly-L-ornithine (Sigma-Aldrich) and Corning (registered trademark) Matrigel basement membrane matrix low growth factor (Corning), iPS neurons were suspended in (without antibiotics) Complete BrainPhys medium (hereinafter referred to as culture medium) and seeded (26,000 to 30,000 cells / well, final volume 40 μL / well). The next day, an equal volume of 2-fold concentration of 2 μM oligonucleotide-containing culture medium (final volume 80 μL / well) was added to the cells so that the final concentration of the oligonucleotides in the culture medium reached 1 μM. For conditions without oligonucleotide treatment, distilled water (hereinafter referred to as dw, Otsuka Pharmaceutical Factory Co., Ltd.) was added in a manner to reach 0.1%. In order to replace the culture medium, the operation of discarding 40 μL of the culture supernatant and adding a new 40 μL of 1 μM oligonucleotide-containing culture medium was repeated every 3 days.

[0185] On the 16th day after sowing, in order to recover the lysate, all the culture medium was removed and 7 μL of RIPA buffer 1× pre-made solution (Nakarai Tesku) without protease inhibitors was added. After stirring, the cells were frozen and thawed to lyse (RIPA lysate). Then, cDNA was synthesized by the following steps. Referring to the instructions attached to the SuperPrep (registered trademark) II Cell Lysis & RT Kit for qPCR (TOYOBO), 9 μL of lysis buffer (a mixture of 8.75 μL of lysis solution, 0.2 μL of RNase inhibitor and 0.05 μL of gDNA remover) and 1 μL of RIPA lysate were mixed and allowed to stand at room temperature for 5 minutes to decompose genomic DNA to obtain a solution containing RNA. Then, for reverse transcription, 5X RT Master Mix, a solution containing RNA and dw were mixed and reacted under the conditions of 37°C (15 minutes), 50°C (5 minutes), and 98°C (5 minutes) to obtain a cDNA solution, which was diluted 10 times with dw.

[0186] For PCR, primers for TAU were added to PrimeSTAR (registered trademark) GXL Premix (TAKARA) to a final concentration of 200 nM, or primers for β-actin (ACTB) were diluted with distilled water and added to a final concentration of 100 nM. The following primers were synthesized and used (Integrated DNA Technologies, Inc. / IDT).

[0187] <For TAU mRNA detection>

[0188] 118 (118-Fw-Mapt-Exon 1) (5'-CATGCACCAAGACCAAGAGG-3') (SEQ ID NO: 18), 120 (120-Rv-Mapt-Exon 4) (5'-TCACGTGACCAGCAGCTTC-3') (SEQ ID NO: 19)

[0189] <For ACTB mRNA detection>

[0190] Primers (5'-ACAGAGCCTCGCCTTTG-3') (SEQ ID NO: 20) and (5'-CCTTGCACATGCCGGAG-3') (SEQ ID NO: 21) contained in Hs.PT.39a.22214847 of IDT

[0191] Each template synthetic DNA for the positive control of RT-PCR was synthesized using the following sequence (gBLOCKS, IDT).

[0192] 110-TAU non-productive mRNA (DNA-standard) (E1B-E4): Contains the sequence of exon 1B between exon 1 and exon 4.

[0193] 110(5'-TCAGGGGGGCTACACCATGCACCAAGACCAAGAGGGTGACACGGACGCTGGCCTGAAAGAGGGGAGTGAATTCACTGAGCTGAGAGCTGAGGAACCATTGATCTGATGGCTGAGACACCACTGGGAAGACT GGAGAGGCTTTTCTGGGCATGCAGTGCCAGGCACAGGAGGAGCTGAGGGAAGATGACTAAGAGCTGAAGAAGCAGGCATTGGAGACACCCCCAGCCTGGAAGACGAAGCTGCTGGTCACGTGACCCAA-3') (serial number 22)

[0194] 111-TAU productive mRNA (DNA standard) (E1-E4): has a sequence that follows exon 1 to exon 4.

[0195] 111(5'-TCAGGGGGGCTACACCATGCACCAAGACCAAGAGGGTGACACGGACGCTGGCCTGAAAGCTGAAGAAGCAGGCATTGGAGACACCCCCAGCCTGGAAGACGAAGCTGCTGGTCACGTGACCCAAG-3') (Serial number 23)

[0196] ACTB(5'-GCATCGACATCGACTAACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGTCCACACCCGCCGCCAGCTCACCATGGATGATGATATCGCCGCGCTCGTCGTCGACAACGGCTCCGGCATGTGCAAGGCCGGCTTCGCGGGCGACGATGCCCCCCGG GCCGTCTTCCCCTCCATCGTGGGGCGCCCCAGGCACCAGGGCGTGATGGTGGGCATGGGTCAGAAGGATTCCTATGTGGGCGACGAGGCCCAGAGCAAGAGAGGCATCCTCACCCTGAAGTACCCCATCGAGCACGGCATCGTCACCAACTGGGACGACATGGAGAAAATCTGGCACCACAC-3') (Serial No. 24)

[0197] In the touchdown PCR, the reaction was carried out using a thermal cycler GeneAmp PCR System 9700 (Applied Biosystems) under the following conditions: 3 cycles [denaturation: 98°C (10 seconds); 66°C (15 seconds); 68°C (15 seconds)], followed by 3 cycles [denaturation: 98°C (10 seconds); 64°C (15 seconds); 68°C (15 seconds)], followed by 10 cycles [denaturation: 98°C (10 seconds); 62°C (15 seconds); 68°C (15 seconds)], and finally 40 cycles [denaturation: 98°C (10 seconds); 60°C (15 seconds); 68°C (15 seconds)]. Then, 1 μL of Gel Loading Dye, Purple (6X) (Niu Ying Landon Biolabs, Inc.) was mixed with 5 μL of the PCR amplification product, and electrophoresis was performed using 3% agarose 21 (for low molecular weight nucleic acid separation) (Fujifilm Wako Pure Chemical Industries, Ltd.) and TAE (Nippon Chemical). 100 bp DNA LadderOne (Nakarai Tesku) was used as a marker. To detect the bands, SYBR TM Gold nucleic acid gel stain (10000X Concentrate, in DMSO) (Thermo Fisher Scientific) was used to stain the gel in the dark using Amersham TM ImageQuant TMFluorescence (Cy2) of 800 series (IQ800) (Surface Co., Ltd.) was visualized.

[0198] Results

[0199] The 135 nucleotides (nt) identified as introns were registered as exons as ENST00000571311.5. The 135 nucleotides (nt) were inserted between exon 1 and exon 2 ( Figure 1A ). Hereinafter, this 135nt exon will be referred to as exon 1B. The insertion of exon 1B causes the appearance of a premature termination codon, so it is speculated that this transcription product will be degraded by NMD (nonsense-mediated mRNA degradation), and is therefore called non-productive mRNA. Among the productive mRNAs that form the basis of TAU protein in the human body, three types have been reported as variants of the N-terminal region: "1N TAU" containing exon 2 but not exon 3, "2N TAU" containing exons 2 and 3, and "0N TAU" containing neither exon 2 nor exon 3 (Wang JZ et al., Prog Neurobiol. 85. 148-75. 2008, Figure 5 ). Based on this, it is believed that there are also three patterns of non-productive mRNA containing exon 1B. However, this time, RT-PCR detected mainly two patterns of non-productive mRNA expression in iPS neurons. Figure 1A Only the transcripts actually detected in this experiment are shown.

[0200] In order to identify the sense sequence located on the side of the pre-mRNA that increases non-productive mRNA by forced insertion of exon 1B using SSO, we evaluated the mRNA variants (transcription products) of TAU by allowing iPS neurons to take up 1 μM of an 18-base oligonucleotide without using an introduction reagent (in a free uptake manner). To clarify the transcription product, forward primer 118 was designed for exon 1 and reverse primer 120 was designed for exon 4, and the molecular weight difference of the RT-PCR product was evaluated. As a result, bands were detected at about 100 bp (base pairs) and about 200 bp without oligonucleotide treatment ( Figure 1B, above). The band observed at approximately 100 bp was detected at the same molecular weight as the template synthetic DNA of the positive control of 0N TAU, and was therefore considered to be productive mRNA connected to exon 4 after exon 1. The band observed at approximately 200 bp was considered to have a molecular weight equivalent to that of 1N TAU. Next, as a result of oligonucleotide treatment, in the case of compounds 3 and 4, a new band of 135 bp was detected in addition to the aforementioned bands of approximately 100 bp and approximately 200 bp ( Figure 1B , above). The approximately 235 bp band has the same molecular weight as the template synthetic DNA of the positive control, which is formed by inserting 135 bp of exon 1B into 104 bp of 0NTau, and is therefore considered to be equivalent to non-productive mRNA. The band observed at approximately 335 bp is considered to be equivalent to the non-productive mRNA formed by inserting 135 bp into 1N TAU of 191 bp. It should be noted that β-actin was used as a loading control to confirm the presence of cDNA other than TAU ( Figure 1B ,Down).

[0201] 3. Confirmation of exon composition based on Sanger sequencing

[0202] To investigate at which exon-exon junction the 135 nt exon 1B was inserted, the approximately 235 bp and approximately 335 bp bands observed in the compound 4-treated sample were excised, cloned, and subjected to Sanger sequencing.

[0203] <Method>

[0204] For the cDNA from the sample treated with compound 4 obtained in Experiment 2, PCR was performed using primers 118 and 120, followed by electrophoresis. Bands around 335 bp, 235 bp, and 200 bp were cut out from the gel and purified using the GEL / PCR Purification Mini Kit (FAVORGEN) according to the manual. In order to add dA using 10×A-attachment Mix (TOYOBO), 0.5 μL of 10×A-attachment Mix was added to 4.5 μL of the purified sample, and the reaction was carried out at 60°C for 30 minutes. In order to clone into pT7Blue T-vector (Novagen), 2 μL of each sample was added to 0.5 μL of pT7Blue T-Vector and mixed, and 2.5 μL of DNA ligation kit <Mighty Mix> (TAKARA) was added, and the reaction was carried out at 16°C for 30 minutes. The competent cells (Escherichia coli JM109 strain) after the total amount of the prepared solution was transformed by heat treatment (42°C, 30 seconds) and smeared on LB agar medium plates containing ampicillin (Unitech Co., Ltd., Cat. No. LBA-Op) supplemented with X-gal and IPTG. After culturing overnight at 37°C, white or light blue colonies were picked and cultured with LB medium containing 100 μL of ampicillin (final concentration 100 μg / mL, Unitech Co., Ltd.). 2 μL of the freshly suspended LB medium was mixed with PrimeSTAR GXLDNA Polymerase (TAKARA) and primers (final concentration 0.2 or 0.3 μM) to prepare a PCR reaction solution (reaction scale of 15 μL). Regarding primers, the following primers were used. pT7Blue-F-m13r (5'-CAGGCTTTACACTTTATGCTTCC-3') (SEQ ID NO: 25); pT7Blue-R2-u19 (5'-CGATTTCGGCCTATTGGTTA-3') (SEQ ID NO: 26). PCR was performed using a GeneAmp PCR System 9700 (Applied Biosystems) thermal cycler for 30 cycles [denaturation: 98°C (10 seconds); 60°C (15 seconds); 68°C (30 seconds)]. Colony PCR amplification (5 μL) of each clone was electrophoresed on a 2% agarose gel to confirm band size. Selected clones were cultured in 1 mL of LB medium containing ampicillin, and plasmids were extracted using the standard alkaline SDS method. For sequence analysis, paired-end sequencing was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) with the purified plasmid (template) and any of the above primers (pT7Blue-F-m13r or pT7Blue-R2-u19).Sequencing was performed for 25 cycles [denaturation: 96°C (10 seconds), 50°C (5 seconds), 60°C (2 minutes)]. An ABI PRISM 3130xl Genetic Analyzer (Applied Biosystems) was used for the assay.

[0205] Results

[0206] The band around 335 bp observed in the RT-PCR of the compound 4 treated sample was excised and purified, and then cloned into the plasmid ( Figure 2A , above, 24 clones). Two clones (No. 2 and No. 10) were detected as clones containing a band of about 335bp inserted near 750bp. On the other hand, three clones were detected with a band (450bp) equivalent to a plasmid without any insertion (No. 6, No. 7, and No. 11). Therefore, clone No. 2 was confirmed by Sanger sequencing, and the results were as follows: Figure 2B As shown in the electrophoresis pattern, exon 1B of 135 nt exists after exon 1, followed by exon 2 of 87 nt, and then exon 4. Then, the band around 235 bp observed in the RT-PCR from the sample treated with compound 4 was also analyzed in the same manner ( Figure 2A , in, 16 clones). Sanger sequencing was performed on clone 10 (about 700 bp) of the 16 clones, which was assumed to contain a PCR product of about 235 bp of the analysis object. The results were as follows: Figure 2C As shown, there is a 135 nt exon 1B after exon 1, which is connected to exon 4. Finally, the band around 200 bp observed in the RT-PCR from the sample treated with compound 4 was also analyzed ( Figure 2A , below, 24 clones). Sanger sequencing was performed on clone 24, which was assumed to contain a PCR product of about 200 bp of the analysis object, and the results were as follows: Figure 2D As shown, exon 2 is connected to exon 1, followed by exon 4. The above is a single-end analysis from the forward primer side, and the same sequence can be confirmed by double-end analysis from the reverse primer side (data not shown).

[0207] 4. Construction of qPCR for Selective Quantification of TAU Productive and TAU Non-productive mRNA

[0208] Using "TAU non-productive mRNA" with 135 nt of exon 1B inserted between exon 1 and exon 4, or synthetic DNA equivalent to "TAU productive mRNA" with exon 1 and exon 4 linked as templates, we confirmed that the designed primers and probes functioned in qPCR.

[0209] <Method>

[0210] As template synthetic DNA, 110-TAU and 111-TAU described in the <Method> of Experiment 2 and 117-TAU described below (gBLOCKS, IDT) were synthesized. Hereinafter, 110-TAU, 111-TAU, and 117-TAU may be abbreviated as 110, 111, and 117, respectively.

[0211] 117-TAU pre-mRNA (DNA-standard) (I3-E4): Contains a sequence that changes from intron 3 to exon 4.

[0212] 117 (5'-tctagtaaacaataactgtcttgcttttaccccccttcatttgctgacacatacaccagCTGAAGAAGCAGGCATTGGAGACACCCCCAGCCTGGAAGACGAAGCTGCTGGTCACGTGACCCAAG-3') (Serial Number 27).

[0213] In order to perform qPCR, a PCR reaction solution (15 μL of PCR reaction solution) containing a template synthetic DNA (110, 111, or 117) and THUNDERBIRD (registered trademark) PROBE qPCR MIX (TOYOBO), a qPCR probe (final concentration 0.15 μM), and a primer (final concentration 0.4 μM) was prepared according to the accompanying instructions. In order to accurately evaluate the amplification efficiency of PCR and quantify the copy number in absolute form, 110, 111, or 117 with a known copy number was serially diluted with dw containing yeast RNA (final concentration 10 μg / mL, invitrogen), and the obtained Ct value was used to prepare a standard curve. The copy number provided for the reaction (X-axis) and the obtained Ct (Y-axis) were plotted ( Figure 3A 、 3B , 3C, bottom). Graphs were generated using GraphPad PRISM version 6.07. qPCR was performed using ViiA7 (Applied Biosystems), with an initial denaturation of 95°C (1 minute) and 40 cycles of [95°C (15 seconds) and 60°C (45 seconds)]. The following primers and probes were used.

[0214] <For detection of TAU non-productive mRNA>

[0215] 112 (Fw-Mapt-Exon1B-4) (5'-AGGGAAGATGACTAAGAGCTGA-3') (SEQ ID NO: 28)

[0216] 114 (Rv-Mapt-Exon4) (5'-TCACGTGACCAGCAGCTT-3') (SEQ ID NO: 29)

[0217] 113 (Probe-Mapt-Exon4) (5'- / 56-FAM / AGACACCCC / ZEN / CAGCCTGGAAGA / 3IABkFQ / -3') (SEQ ID NO: 30)

[0218] <For detection of TAU productive mRNA>

[0219] 115 (Fw-Mapt-Exon1-4) (5'-GCTGGCCTGAAAGCTGA-3') (SEQ ID NO: 31)

[0220] 114 (see above)

[0221] 113 (see above)

[0222] <For TAU pre-mRNA detection>

[0223] 116 (Fw-Mapt-Intron3) (5'-CTTCATTTGCTGACACATACACC-3') (SEQ ID NO: 32)

[0224] 114 (see above)

[0225] 113 (see above)

[0226] Results

[0227] An absolute quantitative system was constructed to determine the expression of a highly expressed TAU productive mRNA with exon 4 following exon 1 and a TAU non-productive mRNA with exon 1B inserted therein. Figure 3AAs shown, qPCR was performed using a TAU non-productive mRNA detection kit containing a forward primer 112 designed to span between exon 1B and exon 4. The results showed that in the case of 111, a template synthetic DNA equivalent to productive mRNA that does not have exon 1B, exon 1 and exon 4 connected, and 117, a template synthetic DNA equivalent to pre-mRNA containing intron 3, the Ct value could not be calculated until 40 cycles. On the other hand, in the case of 110, a template synthetic DNA equivalent to non-productive mRNA connected to exon 4 after exon 1B, the Ct value was calculated based on the copy number. It can also be seen that under these conditions, the Ct value shows a correlation with the copy number of the template DNA, and the copy number of the cDNA contained in the reaction solution can be calculated based on the Ct value of the sample to be measured. The result of calculating the PCR amplification efficiency based on the slope of the curve was 94.4%, which can be quantified based on the minimum test concentration of 5 copies / well.

[0228] Then, to quantify TAU productive mRNA, as Figure 3B As shown, qPCR was performed using a TAU productive mRNA detection kit containing a forward primer 115 designed to span exon 1 and exon 4. The result was that in the case of 111 equivalent to productive mRNA, the Ct value could be calculated even at low copy numbers. On the other hand, in the case of 110 equivalent to non-productive mRNA, a Ct value of 35.8 was detected only at the maximum test concentration of DNA copy number (500,000 copies / well), showing a very weak cross-reaction. However, it is believed that the selectivity for the productive mRNA of the measurement target is more than 100,000 times. The amplification efficiency of PCR was 91.3%, and it was possible to quantify based on the minimum test concentration of 5 copies / well.

[0229] Furthermore, if Figure 3C As shown, qPCR was performed using the TAU pre-mRNA detection kit containing forward primer 116 designed within intron 3. The Ct value was calculated only when 117, the DNA template corresponding to the pre-mRNA, was synthesized. The PCR amplification efficiency was 98.7%, enabling quantification at the minimum assay concentration of 5 copies / well.

[0230] Based on the above, under the qPCR conditions of Experiment 4, a system was constructed that can selectively detect and quantify productive mRNA and non-productive mRNA of TAU transcripts.

[0231] 5. Detailed Investigation of the Splice-Switching Activity of Oligonucleotides

[0232] To investigate splice switching activity in detail, productive and non-productive mRNAs were quantified by qPCR.

[0233] <Method>

[0234] The iPS neural cell culture method described in Experiment 2 was used to culture six oligonucleotides (compounds 1, 2, 3, 4, 5, and 6) in a free uptake manner ( Figure 4A After treatment with dw (3 μM, N = 2 wells, 2 biological replicates) (15 days after treatment), cDNA samples were prepared. For non-treated samples, dw was treated to a final concentration of 0.1% (N = 6 wells). Then, the cDNA amount of TAU in the iPS neural cell sample was quantified by the qPCR method described in Experiment 4. The quantitative value of TAU was corrected using the quantitative value of ACTB. The primers and probe for ACTB used were ready-made Hs.PT.39a.22214847 (IDT).

[0235] Primer 1 (5'-ACAGAGCCTCGCCTTTG-3') (SEQ ID NO: 20)

[0236] Primer 2 (5'-CCTTGCACATGCCGGAG-3') (SEQ ID NO: 21)

[0237] Probe (5'- / 56-FAM / TCATCCATG / ZEN / GTGAGCTGGCGG / 3IABkFQ / -3') (SEQ ID NO: 33)

[0238] Sequence No. 24 described in the method of Experiment 2 was used as the template synthetic DNA for the standard curve of ACTB. Calibration was performed so that the non-treated DNA was 100%, and the graph was drawn.

[0239] Results

[0240] In this experiment, the changes in the amount of non-productive mRNA and productive mRNA when each oligonucleotide was used were quantified by qPCR. The results showed that in the case of compounds 3 and 4, the non-productive mRNA increased by 2.9 times and 2.3 times, respectively ( Figure 4B , left). On the other hand, the productive mRNA decreased by 28% and 38%, respectively ( Figure 4B , right). The above results indicate that compounds 3 and 4 can regulate TAU splicing. In the case of the gapmer-type comparative compound 1, which acts via a different mechanism and serves as a positive control, non-productive mRNA and productive mRNA were reduced by 82% and 81%, respectively, confirming that comparative compound 1 reduces TAU via a non-splicing switching mechanism.

[0241] 6. Absolute Quantification of TAU Protein

[0242] A system was constructed to equally quantify the six variants of TAU protein.

[0243] <Method>

[0244] To quantify TAU protein, a homogeneous time-resolved fluorescence (HTRF (registered trademark)) assay (64NTAUPEG, Cisbio / PerkinElmer Japan) was used. The assay was performed as follows with reference to the accompanying instructions. Tau recombinant proteins (R&D Systems) of Tau441 (2N4R) (SP-495-100) and Tau 352 (0N3R) (SP-497-100) were serially diluted with 1X RIPA buffer. 0.1 μL of Total-Tau Eu Cryptate antibody solution (Solution A) was added to 1.9 μL of detection buffer. 0.1 μL of Total-Tau d2 antibody solution (Solution B) was then added to 1.9 μL of detection buffer. 4 μL of antibody solution prepared by mixing 2 μL of solution A and solution B was added to 16 μL of TAU recombinant protein (microplate, 384 wells, PS, F-shaped bottom, SMALL VOLUME, HIBASE, MED. BINDING, WHITE / Greiner Bio-One). The reaction was allowed to proceed overnight at 23-25°C under light shielding. The fluorescence signals at 620 nm and 665 nm (detection filters) were measured using an HTRF (registered trademark) microplate reader (ARTEMIS) with excitation at 320 nm. The fluorescence signals were measured at 620 nm and 665 nm (detection filters) respectively. The detection value at 665 nm was divided by the detection value at 620 nm and multiplied by 10,000, and the resulting values ​​were plotted on the vertical axis of the graph (N=2 wells). The horizontal axis plotted the molar concentration calculated from the molecular weight of the recombinant protein concentration and the total number of amino acids. The graph was drawn using GraphPad PRISM version 6.07.

[0245] Results

[0246] In the central nervous system, TAU productive mRNA has a total of 6 splice variants (Wang JZ et al., Prog Neurobiol. 85. 148-75. 2008), so it is believed that 6 TAU proteins with different molecular weights are expressed ( Figure 5 , above). In this experiment, we evaluated whether the HTRF (registered trademark) kit sold by Cisbio / PerkinElmer Japan, whose details of the anti-TAU antibody are not disclosed, can equally recognize all TAU proteins. The TAU recombinant protein derived from the longest TAU ​​productive mRNA (2N4RTAU / 441a.a.) and the TAU recombinant protein derived from the shortest TAU ​​productive mRNA (0N3R TAU / 352a.a.) were measured at varying concentrations, and both were detected equally ( Figure 5 ,Down).

[0247] 7. Concentration-dependence test I

[0248] Oligonucleotide concentration-dependency experiments were performed to quantify productive and non-productive mRNAs and TAU protein, and to investigate the splicing switching activity and TAU protein knockdown activity in detail.

[0249] <Method>

[0250] After treatment with compound 7 (sequence is the same as compound 3) or compound 8 (sequence is the same as compound 4) or comparative example compound 1 of gapmer-type oligonucleotide in a free uptake manner by the iPS neural cell culture method of Experiment 2 (treatment for 15 days), it was lysed with a 1× pre-made solution of RIPA buffer without protease inhibitors. Reverse transcriptase was added thereto to react it and prepare a cDNA sample. As a non-treated sample, it was treated in a manner such that dw reached a final concentration of 0.1%. Then, the cDNA amount of TAU and ACTB was quantified by the qPCR method described in Experiment 4. Only the values ​​of the holes whose quantitative values ​​of ACTB fell into the "mean ± 2 times the standard deviation of all measured values" were analyzed. As a control, neurofilament light chain polypeptide (NfL) was quantified. The primers and probes for NfL and the template synthetic DNA for the standard curve used the following substances (IDT). The quantitative values ​​of TAU and NfL were corrected with the quantitative values ​​of ACTB. The graph was drawn in a manner such that the non-treatment became 100%.

[0251] <For NfL mRNA detection>

[0252] Primer (5'-CCATCAGCAACGACCTCAA-3') (SEQ ID NO: 34)

[0253] Primer (5'-GCTTCCAGGACCTTGTTCT-3') (SEQ ID NO: 35)

[0254] Probe (5'- / 56-FAM / CTTCGCCAG / ZEN / CTTCATCGAGCG / 3IABkFQ / -3') (SEQ ID NO: 36)

[0255] NfL (5'-CGACCTGAGCCAGGTAGCCGCCATCAGCAACGACCTCAAGTCCATCCGCACGCAGGAGAAGGCCGCAGCTCCAGGACCTCAATGACCGCTTCGCCAGCTTCATCGAGCGCGTGCACGAGCTGGAGCAGCAGAACAAGGTCCTGGAAGCCGAGCTGCTGGTGCTGCGCCAGAAGCACTCC-3') (SEQ ID NO: 37).

[0256] Then, to determine the total protein amount using a BCA kit (Nacalai Test), 2 μL of the lysate obtained by lysis with a 1× pre-prepared solution of RIPA buffer without protease inhibitors was mixed with 8 μL of dw, and 200 μL of BCA solution (4 μL of solution B and 196 μL of solution A) was added and incubated at 60°C for about 30 minutes. To prepare a standard curve for total protein, a standard curve was prepared using a quick start bovine serum albumin standard kit (BIO-RAD) using a serial dilution of BSA solution starting from 500 ng / mL. The absorbance was measured at 562 nm to quantify the total protein amount of the lysate. Then, in order to measure the concentration of TAU protein by HTRF (registered trademark) measurement, the lysate obtained by lysis with a 1× pre-prepared solution of RIPA buffer without protease inhibitors was diluted 40 times with 1X RIPA buffer (NAKALI TESQUE) containing a protease inhibitor cocktail, so that 15 μL / well could be added, and 4 μL / well of the mixed antibody solution (an equal mixture of solution A and solution B described in the method of Experiment 6) was prepared. For the standard curve of TAU protein, a liquid prepared by serially diluting Tau 441 (2N4R) (SP-495-100, R&D Systems) with RIPA buffer was used. React overnight at 23-25°C under light shielding. Excite at 320 nm with an HTRF (registered trademark) microplate reader (ARTEMIS), and measure the fluorescence signals at 620 nm and 665 nm (detection filters), respectively. The concentration of Tau protein in iPS neuron lysates was quantified using a standard curve for Tau 441 (2N4R) by dividing the measured value at 665 nm by the measured value at 620 nm and multiplying the result by 10,000. The values ​​obtained by dividing the quantified values ​​for Tau protein by the quantified values ​​for total protein obtained using BCA were corrected to assume the untreated value was 100% and plotted using GraphPad PRISM version 6.07.

[0257] Results

[0258] The concentration dependence was evaluated using compound 7 (same sequence as compound 3) and compound 8 (same sequence as compound 4) with modified oligonucleotides. The results showed that TAU ​​non-productive mRNA increased from several nM and TAU productive mRNA decreased from about 10 nM. Figure 6A and 6B Furthermore, compounds 7 and 8 reduced the amount of TAU protein ( Figure 6A and 6B On the other hand, in the case of the gapmer-type comparative example compound 1, both the non-productive mRNA and the productive mRNA were reduced from the nM level ( Figure 6C). NfL reduction was not confirmed in all oligonucleotides, suggesting that compounds 7 and 8 may be able to selectively reduce TAU-producing mRNA.

[0259] 8. Identification of Neuronal Cells with Increased Tau Non-Productive mRNA

[0260] Cells affected by SSO were identified by cell staining.

[0261] <Method>

[0262] After treatment with compound 7 (N=2 wells) or compound 8 (N=2 wells) of SSO in a free uptake manner by the iPS neural cell culture method of Experiment 2 (treatment for 15 days), the cells were fixed with 10% neutral buffered formalin solution at room temperature for about 16 hours. However, in order to reduce cell detachment caused by fixation, the coating agent was changed from poly-L-ornithine (Sigma-Aldrich) to 0.1% polyethyleneimine solution for the method of Experiment 2. In addition, in order to increase the proportion of the inhibitory neural population, iCell (registered trademark) GABAergic neural cells (FUJIFILM Cellular Dynamics, Inc.) and iCellGlutaNeurons 01279 were mixed at a ratio of about 20: about 80 and seeded. Reference was made to Target Probe-BA-Hs-MAPT-211-2EJ-O1-C1 (1201211-C1) and BaseScope purchased from Advanced Cell Diagnostics, Inc. (ACD company) TM The instructions for the Reagent Kit v2-RED (323900) are used to visualize TAU non-productive mRNA. Specifically, the fixed cells were washed with D-PBS (-) (PBS, Fujifilm and Koh Pure Chemical Industries, Ltd.), and then digested with Protease plus diluted 15 times with PBS at room temperature for 10 minutes. Then, after washing with PBS, the probe was reacted at 40°C for 2 hours. After washing twice with 1x washing buffer, the AMP1 reagent was reacted at 40°C for 15 to 30 minutes. This operation was repeated for AMP2, 3, 4, 5 and 6. Then, after washing twice with 1x washing buffer, AMP7 was reacted at room temperature for 15 to 30 minutes. Then, this operation was also performed for AMP8. After washing twice with 1x washing buffer, the BaseScope containing reagent as a color developing reagent was added. TM Fast RED-B's BaseScope TM Fast RED solution (a solution prepared by diluting solution B 60-fold with solution A) was reacted at room temperature for about 30 minutes, washed with PBS, and stored at 4°C in the dark.

[0263] Then, in order to immunostain the cells with antibodies, the following procedures were performed. After washing with PBS, the cells were permeabilized with a PBS solution containing 0.1% Triton X-100 at room temperature for 10 minutes. After washing with PBS, the cells were washed with Pierce TM Blocking was performed with protein-free T20 (TBS) blocking buffer (Thermo Fisher Scientific) at room temperature for 1 hour. After washing with PBS, the sections were incubated with an anti-neuronal nucleus (NeuN) antibody (ab104224, Abcam) diluted 1000-fold with the blocking agent and an anti-γ-aminobutyric acid (GABA) antibody (A2052-100UL, Sigma-Aldrich) diluted 1000-fold with the blocking agent for 1 hour at room temperature. After washing with PBS, the sections were incubated with secondary antibodies, donkey anti-mouse IgG H&L (Alexa Fluor (registered trademark) 488) (ab150105, Abcam) diluted 1000-fold with the blocking agent, and donkey anti-rabbit IgG H&L (Alexa Fluor (registered trademark) 647) (ab150075, Abcam) diluted 1000-fold with the blocking agent, and DAPI (Dongren Chemical Research Institute) diluted 10,000-fold with the blocking agent for 1 hour at room temperature. The cells were washed with PBS and excited using the high-throughput cell function exploration system CellVoyager CV8000 (YOKOGAWA) at 405 nm, 488 nm, 561 nm, and 640 nm, with signals detected using bandpass filters of 445 / 45 nm, 525 / 50 nm, 600 / 37 nm, and 676 / 29 nm (for DAPI, NeuN, TAU non-productive mRNA, and GABA, respectively). Images were exported using the high-content analysis software CellPathfinder.

[0264] Results

[0265] In order to prepare probes for detecting TAU non-productive mRNA, we commissioned ACD to synthesize probes complementary to the junctions of exon 1 and exon 1B, and exon 1B and exon 4 ( Figure 7A , above). TAU non-productive mRNA ( Figure 7A , bottom), NeuN protein and GABA ( Figure 7B ) visualization. In the case of compounds 7 and 8, there were more cells with TAU non-productive mRNA than in the non-treated ( Figure 7A , below). Cells with TAU non-productive mRNA were mainly observed as NeuN-positive and GABA-negative cells ( Figure 7B ), thus showing a tendency for TAU non-productive mRNA to increase in excitatory neurons.

[0266] 9. Single-cell RNA-seq

[0267] To classify neurons into excitatory and inhibitory neurons and confirm changes in TAU (MAPT) expression induced by SSO, single-cell RNA sequencing (scRNA-seq) was performed.

[0268] <Method>

[0269] After the treatment of 3 μM of compound 7, compound 8 and comparative example compound 1 was performed in a free uptake manner by the iPS neural cell culture method of experiment 2 (treated for 17 days), the nerve cells were dispersed and recovered using Papain Dissociation System (Worthington Biochemical Corporation). It should be noted that in order to increase the proportion of inhibitory nerve populations, iCell (registered trademark) GABAergic nerve cells (FUJIFILM Cellular Dynamics, Inc.) and iCell GlutaNeurons 01279 were mixed and seeded. The flat plate used Corning (registered trademark) BioCoat (registered trademark) poly D-lysine 96-well transparent flat-bottom TC-treated microplates (Corinig), seeding 130,000 cells / well of GlutaNeuron and 42,900 cells / well of GABAergic nerve cells. Cultured with 200 μL / well culture medium, the culture medium was replaced with half the amount every 3 days. On day 18 of culture, a digestion solution containing Accumax and DNase in papain (vial 2) was added to the neurons, and the cells were dispersed for 30 minutes at 37°C under 5% CO2. The wells were washed with a resuspension solution (HBSS containing DNase, vial 4, and 5 μM Y-27632), and the collected cell suspension was centrifuged at 500 x g for 5 minutes using a PluriStrainer-Mini 40 μm (PluriSelect USA) to remove debris. The supernatant was discarded, and the precipitated cells were resuspended in the resuspension solution. A fivefold volume of vial 4 was added to the lower layer, and the cells were centrifuged at 500 x g for 5 minutes. The supernatant was discarded, and the precipitated cells were suspended in PBS containing 0.04% BSA (Miltenyi Biotec). After centrifugation at 500 x g for 5 minutes, the supernatant was discarded, and the precipitated cells were resuspended in PBS containing 0.04% BSA, and the viable cells were counted. Next GEM Single Cell 3' GEM Kit v3.1, Next GEM Single Cell 3' Library Kit v3.1, and Single Index Kit T Set A (10x Genomics) were used to prepare suspensions at 10,000 viable cells per reaction using a Chromium controller (10x Genomics) according to the Chromium Single Cell 3' Reagent Kits user manual (v3.1 Chemistry Dual Index, 10x Genomics).In the reverse transcription reaction, the reaction was carried out at 50 μL / well at 37°C (15 minutes), 53°C (45 minutes), and 85°C (5 minutes) to obtain a cDNA solution (C1000 Touch Thermal Cycler, Bio-Rad Laboratories, Inc.). The number of PCR reactions for amplifying cDNA and GEX libraries was set to 11 and 14 times, respectively. The quality and fragment size of the two libraries were determined using High Sensitivity D5000 ScreenTape (Agilent) and TapeStation (Agilent). The DNBSEQ-G400 sequencing system (MGI Tech) was used to measure the primer length of 28 bp in the case of R1 and 100 bp in the case of R2. For each sample, FastQC (v.0.11.9) was used to evaluate the quality of more than 400 million sequencing fragments (reads). Sequencing data were processed using Cellranger 7.0.1, and sequencing fragments were positioned (reads mapping) using default parameters and the GRCh38 reference genome. For the count matrix calculated using Cellranger, the Seurat software package (version 3.1.4) of R (version 3.6.1) was used for analysis. The ratio of mitochondrial genes in the RNA molecules detected in each cell was calculated. Cells with a detection RNA molecule number greater than 2500 and a ratio of mitochondrial genes less than 10% were extracted to remove cells with particularly low gene expression quality. Then, the expression was standardized and the data of the four samples (non-treated group, compound 7 treated group, compound 8 treated group, comparative example compound 1 treated group) were merged. 2000 genes with large dispersion of expression in the merged data were extracted and standardized for expression. Principal component analysis (PCA) was performed using the standardized 2000 genes, and dimensionality reduction and cluster analysis were performed using the first 30 components by uniform manifold approximation and projection (UMAP). The populations with low gene expression quality were determined based on the number of gene detections per cluster, and were excluded. The expression pattern of SLC17A6 was used to infer the population of excitatory neurons. The expression patterns of GAD1 and GAD2 were used to infer the population of inhibitory neurons. In addition, genes specific to each cluster were extracted. The cells were divided into excitatory neurons, inhibitory neurons, ISL1-high-expressing cells, and LHX8-high-expressing cells. The average gene expression level for each classification was calculated, and the expression levels of SLC17A6, TBR1, GAD1, GAD2, ISL1, PCDH11Y, LHX8, and CRABP1 were depicted using a heat map. The population inferred to be excitatory neurons was extracted, and the expression levels of TAU (MAPT) were compared between the non-treated group and the oligonucleotide-treated group.Extract the group that is inferred to be inhibitory nerve, and compare the expression level of TAU (MAPT) in the non-treated group and the oligonucleotide treated group. Calculate the difference in the ratio of reducing the expression level of TAU (MAPT) in the excitatory nerve and the inhibitory nerve in each oligonucleotide treated group. For the TAU expression level of the non-treated group and the TAU expression level of the oligonucleotide treated group, 100 cells were randomly extracted repeatedly to find the difference between the cells. This attempt was repeated 10 times according to the bootstrap method, and its mean value and 95% confidence interval were calculated using SAS Software for Windows, Release 9.4 (SAS Institute Japan Ltd.).

[0270] Results

[0271] The changes in TAU expression in excitatory and inhibitory neuronal populations were evaluated by scRNA-seq. Figure 8A The results of clustering in two dimensions by reducing the dimensionality of the gene expression profile of each cell are shown in FIG. Figure 8B The left group (the group surrounded by squares) was observed to express SLC17A6 / VGLUT2, a transporter for taking glutamate into cells, so we defined it as the excitatory nerve group ( Figure 8B , C). The group on the lower right (the group surrounded by a circle) expresses GAD1 and GAD2, enzymes related to GABA production, and is therefore defined as inhibitory neurons ( Figure 8B , C). The average value of the change in TAU (MAPT) expression in the excitatory nerve population (knockdown (KD) level) was calculated. As a result, the comparative example compound 1 decreased by 54.2% compared to the non-treatment ( Figure 8D , far left). Next, the KD level of the inhibitory neuron population was calculated. The results showed that the KD level of the inhibitory neuron population was reduced by 49.4% in the case of the comparative example compound 1 compared to the non-treatment group ( Figure 8D , the second from the left). It can be seen that the difference in KD levels between the two groups of comparative example compound 1 is 4.8% (4.8% = 54.2% - 49.4%). In the case of compound 7, TAU decreased by 20.4% in the excitatory nerve group and by 6.4% in the inhibitory nerve group. It can be seen that the difference in KD levels between the two groups of compound 7 is 14.0%, which is greater than that of comparative example compound 1 (14.0% = 20.4% - 6.4%) ( Figure 8D , the 3rd and 4th from the left). In the case of compound 8, TAU decreased by 29.0% in the excitatory nerve population and by 18.2% in the inhibitory nerve population. Therefore, the difference in KD levels of the two groups of compound 8 was 10.8%, which was greater than that of the comparative example compound 1 (10.8% = 29.0% - 18.2%) ( Figure 8D, the 5th and 6th from the left). From the above, it can be seen that in compounds 7 and 8, the difference in KD levels between the two groups is greater than that of comparative compound 1, and the reduction in TAU in the excitatory nerve group is greater than that in the inhibitory nerve group. Then, 100 cells were randomly extracted from the non-treated group and the oligonucleotide-treated group, and the difference in KD levels was calculated. This attempt was repeated 10 times according to the bootstrap method, and its mean value and 95% confidence interval were calculated. As a result, a statistically significant difference (significance level 5%) was confirmed between comparative compound 1 and compounds 7 and 8 ( Figure 8E ). As shown above, compounds 7 and 8 significantly and selectively reduced TAU in the excitatory nerve population compared to the comparative example compound 1.

[0272] 10. Inhibiting excessive neural activity synchronization by reducing endogenous Tau protein

[0273] We evaluated whether SSO-induced reduction of endogenous TAU protein inhibits the synchronization of excessive neural activity.

[0274] <Method>

[0275] Maestro Pro multi-point electrode array (MEA) was implemented with reference to the instructions attached to iCell GlutaNeurons 01279 (FUJIFILM Cellular Dynamics, Inc.). Specifically, a flat CytoView MEA 24 (Axion BioSystems) was coated in a 0.1% polyethyleneimine solution at room temperature overnight, washed with dw, and dried. Then, it was further coated with a culture medium containing 100 μg / mL laminin (Sigma-Aldrich) at 4°C overnight. The next day, it was further allowed to stand in a 5% CO2 incubator (37°C) for 1 hour. iCell (registered trademark) GABAergic neurons and iCellGlutaNeurons 01279 were mixed in equal amounts of cells, with a total of 9.9 x 10 5 cells / cm 2 The next day, 2.2 x 10 5 cells / cm 2XCL-1 mature astrocytes (AM-001-1V) were added to the electrode portion. Two days later, the comparative example compound 1 or compound 7 was diluted with culture medium to a specified concentration and then added (600 μL / well). No substance was added to the non-treated group, and culture was performed with culture medium. Each group was set to N=6 wells. Half of the culture medium was replaced every 4 days. On the 25th day of culture, (Pre) autonomic nervous activity was measured using Maestro Pro (Axion BioSystems) at 37°C and 5% CO2 15 minutes before the addition of KCl. To achieve conditions containing approximately 10 mM KCl, which induces excessive neural synchronization, 3 μL of 1 M KCl was added to 600 μL / well of culture medium. (BrainPhys medium, as publicly available information only indicates that it contains less than 5 mM KCl under basic conditions, cannot accurately determine the final KCl concentration and is therefore recorded as <10 mM) (Bardy C et al., Proc Natl Acad Sci USA. 2015. 112. E2725-E2734.). AxIS Navigator (version 2.0.4.21) and Neural Metric Tool (version 2.4.12) were used for analysis. The burst detection algorithm used interspike interval (ISI) thresholds, a minimum number of spikes (network burst) of 50, a maximum interspike interval (network burst) of 100 ms, and a minimum number of participating electrodes (%) of 35 (default settings) as network burst detection settings in the burst detector settings.

[0276] Results

[0277] like Figure 9A As shown, after about 22 days of knocking down endogenous TAU using two oligonucleotides, the spontaneous firing of Pre was measured, and spontaneous neural activity was confirmed regardless of the presence or absence of oligonucleotide treatment ( Figure 9B , left). Then, KCl was added to induce synchronization of pathologically excessive neural activity. In the group without oligonucleotide treatment (no treatment), the number of network bursts surrounded by squares increased significantly ( Figure 9B , right, and Figure 9C ). Network burst refers to the phenomenon in which neural activity is observed simultaneously at multiple electrodes in one well (the definition of detection is described in the method). We believe that the chronic increase in network bursts may cause neurodegeneration. Therefore, we investigated whether endogenous TAU knockout can correct the abnormal increase in network bursts. As a result, the increase could not be suppressed under the condition of prior treatment with 0.3μM of comparative example compound 1, but the increase in network bursts could be suppressed under the condition of treatment with 3μM of comparative example compound 1 ( Figure 9CIn addition, compound 7 was able to inhibit the increase of network burst at 1 μM ( Figure 9C ). From the above, it can be seen that the increase of TAU non-productive mRNA by compound 7 reduces TAU productive mRNA, which can also inhibit the synchronization of excessive neural activity.

[0278] 11. Concentration-dependence test II

[0279] Concentration-dependence experiments were conducted using sequence-identical SSO and gapmer oligonucleotides to quantify productive mRNA, non-productive mRNA, and TAU protein, and to investigate splicing switching activity and TAU protein knockdown activity in detail.

[0280] <Method>

[0281] The iPS cell culture method of Experiment 2 was used to treat the SSO compound 7 or compound 8, or the comparative example compound 2 or comparative example compound 3, each prepared as a gapmer oligonucleotide, in a free uptake manner (treatment for 15 days). As a non-treated sample, treatment was performed to a final concentration of 0.1% dw. Comparative example compounds 2 and 3 were synthesized in the same manner as in Experiment 1.

[0282] [Table 3]

[0283]

[0284] In order to implement qPCR, refer to the instructions attached to the SuperPrep (registered trademark) II Cell Lysis & RT Kit for qPCR (TOYOBO), add 10 μL of lysis buffer (a mixture of 9.78 μL of lysis solution, 0.17 μL of RNase inhibitor and 0.05 μL of gDNA remover) to the cells, let it stand at room temperature for 5 minutes to decompose the genomic DNA and obtain a solution containing RNA. Then, for reverse transcription, 5X RT Master Mix was mixed with the RNA-containing solution and dw, and reacted at 37°C (15 minutes), 50°C (5 minutes), and 98°C (5 minutes) to obtain a cDNA solution, which was diluted 4 times with dw. Then, TAU, ACTB, and NfL were quantified using the qPCR method described in Experiment 4. The quantitative values ​​of TAU and NfL were corrected using the quantitative values ​​of ACTB. The graph was drawn in a manner such that non-treatment became 100%.

[0285] In order to quantify the amount of TAU protein, the cells were lysed with a 1× pre-made solution of RIPA buffer without protease inhibitors. The total protein amount and the concentration of TAU protein were determined using a BCA kit (Nakai Test) and an HTRF (registered trademark) kit by the method described in Experiment 7. The fluorescence signals at 620 nm and 665 nm (detection filters) were measured using an EnVision multifunctional microplate reader (Perkin Elmer) at 320 nm for excitation. The values ​​obtained by dividing the quantitative value of TAU protein by the quantitative value of total protein obtained using BCA were corrected and plotted in a manner such that the non-treatment was 100%.

[0286] Results

[0287] In the case of SSO compounds 7 and 8, TAU non-productive mRNA increased from several nM level, and TAU productive mRNA decreased from about 10 nM ( Figure 10A and 10B On the other hand, in the case of Comparative Example Compounds 2 and 3, which have the same sequence and are gapmer-type, both non-productive mRNA and productive mRNA were reduced from the nM level ( Figure 10C and 10D ). It was confirmed that, even if the sequences were identical, in the case of gapmer-type oligonucleotides, both non-productive mRNA and productive mRNA were reduced, whereas the SSO-type oligonucleotides of the present invention selectively reduced productive mRNA by splicing.

[0288] These experiments indicate that SSOs that increase the amount of non-productive TAU mRNA containing exon 1B reduce TAU protein levels. This effect may be selective for excitatory neurons and can also inhibit the synchronization of excessive neural activity. These SSOs are useful for treating or preventing TAU-related diseases.

Claims

1. A splice switching oligonucleotide that binds to intron 1B of TAU pre-mRNA. 2 . The splice-switching oligonucleotide according to claim 1 , which is capable of increasing the amount of TAU mRNA containing TAU exon 1B. The splice-switching oligonucleotide according to claim 1 , which is capable of reducing the amount of TAU protein. The splice-switching oligonucleotide according to claim 1 , comprising a sequence complementary to a portion of intron 1B of TAU pre-mRNA. The splice-switching oligonucleotide according to claim 1 , comprising a sequence complementary to at least a portion of positions 6 to 24 of SEQ ID NO:

2. The splice-switching oligonucleotide according to claim 1 , which is 16 to 20 bases in length. The splice-switching oligonucleotide according to claim 1 , which is capable of selectively reducing the amount of TAU protein in excitatory neurons. 8 . The splice-switching oligonucleotide according to claim 7 , which is capable of reducing the amount of TAU protein in excitatory nerves by at least 5% more than the reduction in inhibitory nerves. 9 . A pharmaceutical composition for treating or preventing a TAU-related disease, comprising the splice-switching oligonucleotide according to claim 1 .

10. The pharmaceutical composition according to claim 9, wherein The TAU-related disease is Tauopathy or epilepsy.

11. The pharmaceutical composition according to claim 9, wherein The TAU-associated disease is selected from the group consisting of Alzheimer's dementia, vascular dementia, dementia with Lewy bodies, Parkinson's disease, amyotrophic lateral sclerosis, Down syndrome, Pick's disease, chronic traumatic encephalopathy, progressive supranuclear palsy, basal ganglia degeneration and myotonic dystrophy type 1.

12. The pharmaceutical composition according to claim 9, wherein The TAU-associated disease is selected from the group consisting of Dravet syndrome, tuberous sclerosis, periodic ataxia, CDFE syndrome and DEE14 or 18.

13. The pharmaceutical composition according to claim 9, wherein The TAU-associated disease is selected from the group consisting of glaucoma and age-related macular degeneration.

Citation Information

Patent Citations

  • Electronic device, electronic system, and method

    JP2023019305A