Application of dihydroquercetin in detoxification of passion fruit and disease-resistant breeding application of PeduCYP75B gene
By applying dihydroquercetin chemical treatment and micro-shoot tip culture in passion fruit, combined with the expression of the PeduCYP75B gene, the problem of detoxification of passion fruit virus disease was solved, efficient virus removal and disease-resistant breeding were achieved, providing the passion fruit industry with stable and efficient detoxification technology and disease-resistant gene support.
Patent Information
- Application Number
- CN202510782084.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-12
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2045-06-12
AI Technical Summary
In the existing technology, viral diseases of passion fruit have seriously affected industrial development. There have been no reports on the combination of chemical detoxification and micro-stem tip detoxification, and there have been no reports on the application of flavonoids in passion fruit detoxification. The functions of related genes in passion fruit are unknown, and there is a lack of efficient detoxification technology and disease-resistant genes.
A passion fruit detoxification system was established by chemical treatment with dihydroquercetin combined with micro-shoot tip culture. The PeduCYP75B gene was discovered, and the PeduCYP75B14, PeduCYP75B24, and PeduCYP75B37 genes were cloned. Eukaryotic expression vectors were constructed and expressed in a yeast system. The F3'H enzyme activity that catalyzed the conversion of dihydrokaempferol to dihydroquercetin was verified.
The virus removal efficiency of passion fruit was significantly improved. The detoxification rates of tuberose mosaic virus and passion fruit virus reached 21.09±4.28% and 19.85±2.24%, respectively. There was no significant difference in the seedling rate, which laid the foundation for the creation of virus-resistant germplasm and molecular breeding of passion fruit.
Smart Images

Figure CN120608010A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of tissue culture detoxification, in particular to application of dihydroquercetin in passion fruit detoxification and use of the PeduCYP75B gene in disease-resistant breeding. Background Art
[0002] Passion fruit (Passiflora edulis), also known as passion fruit, passion fruit, and Brazil nut, is a perennial vine native to South America. It is rich in vitamins, amino acids, phenolics, flavonoids, minerals, and other essential nutrients. In recent years, passion fruit cultivation has been vigorously promoted, but viral diseases have severely hampered the development of the passion fruit industry. To address this major industrial challenge, a stable and efficient passion fruit virus-free system can be established to obtain a large number of virus-free seedlings. Furthermore, resistant varieties can be cultivated by discovering disease-resistant genes.
[0003] Chemical detoxification is the process of adding antiviral agents such as ribavirin, ribavirin, salicylic acid, and dihydrolipoic acid to the culture medium for in vitro culture to obtain virus-free seedlings. Antiviral agents can stimulate systemic resistance in plants or inhibit the movement and proliferation of plant viruses. In the prior art, chemical treatment is often combined with micro-tip detoxification to achieve better detoxification results. However, there are currently no reports on chemical detoxification of passion fruit micro-tip. While flavonoids have been shown to inhibit proliferation by binding to viral proteins, their specific application in passion fruit detoxification has not been reported. Flavonoid synthesis in plants depends on enzymes in the CYP75 family (such as F3'H / F3'5'H), but the functions of the relevant genes in passion fruit are unknown. Therefore, developing efficient detoxification technologies for passion fruit and identifying disease-resistant genes are of great significance for the industrial production of virus-free seedlings in the passion fruit industry. Summary of the Invention
[0004] The present invention aims to provide the application of dihydroquercetin in passion fruit detoxification and the use of the PeduCYP75B gene in disease resistance breeding to address the problems of the prior art. The present invention also provides a method for chemical detoxification of passion fruit, establishing an in vitro culture system for virus-free passion fruit seedlings through chemical treatment with dihydroquercetin. The invention also explores the enzyme that catalyzes dihydroquercetin in passion fruit, providing a reference for resistance breeding.
[0005] To achieve the above object, the present invention provides the following solutions:
[0006] The present invention provides application of dihydroquercetin in preparing a passion fruit detoxification preparation.
[0007] The present invention also provides the use of the PeduCYP75B gene in cultivating virus-resistant passion fruit varieties, wherein the gene is used to increase the synthesis of dihydroquercetin, and the PeduCYP75B gene is selected from the PeduCYP75B14 gene having a nucleotide sequence as shown in SEQ ID NO.5, the PeduCYP75B24 gene having a nucleotide sequence as shown in SEQ ID NO.6, or the PeduCYP75B37 gene having a nucleotide sequence as shown in SEQ ID NO.7.
[0008] Furthermore, the PeduCYP75B gene encodes a protein having F3'H enzyme activity.
[0009] Furthermore, the virus includes tuberose mosaic virus and / or East Asian passion fruit virus.
[0010] The present invention also provides a passion fruit detoxification method, comprising the steps of inoculating passion fruit explants into a culture medium supplemented with dihydroquercetin and culturing the culture medium.
[0011] Furthermore, the explant is a micro-stem tip.
[0012] Furthermore, the culture time is 60 days.
[0013] The present invention also provides a culture medium for passion fruit detoxification, comprising a basal culture medium and dihydroquercetin.
[0014] Furthermore, the basal culture medium includes MS culture medium.
[0015] Furthermore, the concentration of the dihydroquercetin is 5-60 mg / L.
[0016] The present invention discloses the following technical effects:
[0017] The present invention significantly improves virus removal efficiency by adding 50 mg / L dihydroquercetin to MS medium and treating passion fruit tissue culture seedlings, combined with micro-shoot tip culture. The virus removal rates for tuberose mosaic virus (TeMV) reached 21.09±4.28%, and for East Asian passionflower virus (EAPV) reached 19.85±2.24%. The seedling survival rate was not significantly different from that of the control group, confirming that dihydroquercetin can effectively remove passion fruit viruses without affecting plant regeneration. At the same time, the present invention cloned the PeduCYP75B14 (SEQ ID NO.5), PeduCYP75B24 (SEQ ID NO.6), and PeduCYP75B37 (SEQ ID NO.7) genes from passion fruit for the first time, constructed their eukaryotic expression vectors, and successfully expressed them in a yeast system. LC-MS / MS verification showed that the recombinant enzymes can catalyze the conversion of the substrate dihydrokaempferol into dihydroquercetin, confirming that the three have F3'H enzyme activity, laying the foundation for the creation of antiviral germplasm and molecular breeding of passion fruit. The present invention verifies that PeduCYP75B14 / 24 / 37 is the key enzyme that catalyzes the biosynthesis of dihydroquercetin in passion fruit. Its functional verification and detoxification application fill the gap in the existing technology and provide core support for the production of antiviral seedlings and molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0019] Figure 1 The double enzyme digestion verification results of the eukaryotic expression vector are shown in Figure 2. M is a marker; 1-3 are expression vectors pYES2-NT-C-PeduCYP75B14, pYES2-NT-C-PeduCYP75B24, and pYES2-NT-C-PeduCYP75B37, respectively.
[0020] Figure 2 The results of Western blot detection of PeduCYP75B14, PeduCYP75B24, and PeduCYP75B37 recombinant proteins; M is a marker; 1-3 are PeduCYP75B14, PeduCYP75B24, and PeduCYP75B37 recombinant proteins, respectively;
[0021] Figure 3The results of LC-MS / MS detection of the expected product dihydroquercetin catalyzed by the recombinant protein in vivo; A, B and C are the catalytic products of PeduCYP75B14, PeduCYP75B24 and PeduCYP75B37 recombinant yeast under three ionic conditions (the three ionic conditions are consistent with the Figure 3 The corresponding relationships of green, blue, and red colors are respectively green: Q1 / Q3 = 303.2 / 284.7; blue: Q1 / Q3 = 303.2 / 176.8; red: Q1 / Q3 = 303.2 / 124.7) and the dihydroquercetin signals detected under these conditions. DETAILED DESCRIPTION
[0022] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0023] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.
[0024] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.
[0025] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.
[0026] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0027] Example 1
[0028] 1 Experimental Materials
[0029] Passion fruit was taken from the passion fruit experimental base of Anshun Academy of Agricultural Sciences in Guizhou Province. The variety was "Qinmi No. 9". It was transplanted into the sterilized cultivation medium and then moved into the artificial climate chamber for cultivation. The environmental parameters were set as a constant temperature of 26℃, a day and night photoperiod of 14h / 8h, and a constant relative humidity of 70%.
[0030] Escherichia coli DH5α was purchased from Shanghai Sangon Biotechnology Co., Ltd.; Saccharomyces cerevisiae WAT11 was purchased from Beijing Coolabo Technology Co., Ltd.; and the yeast eukaryotic expression vector pYES2-NT-C was purchased from Changsha Aibiwei Biotechnology Co., Ltd.
[0031] 2. Virus Detection
[0032] 2.1 Total RNA extraction and cDNA synthesis from diseased passion fruit leaves
[0033] Total RNA was extracted from diseased passion fruit leaves using the TRIzol method. The specific steps are as follows:
[0034] (1) 100–200 mg of fresh diseased leaf samples were cut and placed in a 2 mL grinding tube filled with sterilized steel balls, and then quickly frozen in liquid nitrogen.
[0035] (2) Grind thoroughly in a grinder (50 Hz, 30 s) until powdery, add 1 mL of TRIzol, shake and mix thoroughly, and let stand on ice for 5 min;
[0036] (3) Add 200 μL RNA extraction solution, shake and mix, and then let it stand on ice for 5 minutes;
[0037] (4) Centrifuge at 12000 rpm for 10 min at 2°C, and transfer 500 μL of the supernatant into a new 1.5 mL enzyme-free centrifuge tube;
[0038] (5) Add 500 μL of isopropanol (pre-cooled at -20°C), invert 20 times, and place in a -20°C refrigerator for 20 min;
[0039] (6) Centrifuge at 12,000 rpm for 10 min at 2°C, discard the supernatant, and immediately add 800 μL of enzyme-free 70% alcohol to wash the precipitate;
[0040] (7) Centrifuge at 12,000 rpm for 5 min at 2°C, carefully discard the supernatant, briefly centrifuge, and aspirate the remaining liquid. Open the lid and let it dry for 5–8 min. Add 50 μL of DEPC water and store at -80°C until use.
[0041] The obtained total RNA was used as a template to synthesize cDNA. The first-strand cDNA was synthesized according to the instructions of HiScript IV 1st Strand cDNA Synthesis Kit (Novozymes Biotech Co., Ltd.). 50 μL ddH 2 O was added to dilute the cDNA and stored at -20°C until use.
[0042] 2.2 Primer synthesis
[0043] The passion fruit virus detection-specific primers of the present invention were commissioned to be synthesized by Beijing Qingke Biotechnology Co., Ltd. (Table 1).
[0044] Table 1 Passion fruit virus detection specific primers
[0045]
[0046] 2.3 RT-PCR detection of viruses
[0047] The RT-PCR system was as follows: 1 μL cDNA, 0.5 μL upstream primer, 0.5 μL downstream primer, 13.5 μL 2× Rapid Taq Master Mix, 10.5 μL ddH2O. The PCR reaction program is shown in Table 2 (35 cycles). Passion fruit infected with the mixed strains was used as the explant material for virus-free treatment.
[0048] Table 2 PCR reaction procedure
[0049]
[0050]
[0051] 2.4 Tissue culture conditions
[0052] The culture medium consisted of 4.41 g / L MS basal salts, 30 g / L sucrose, and 6.5 g / L agar. The pH was adjusted to 6.0 ± 0.1 and sterilized by autoclaving at 121°C, 0.1 MPa, for 20 min. The culture conditions were an ambient temperature of 24 ± 1°C, a 12-h photoperiod, and a light intensity of approximately 1800 lx.
[0053] 3. Chemical detoxification
[0054] 3.1 Calculation formula and data processing
[0055] The following calculation formula is used to quantify the various indicators:
[0056] Seedling rate (%) = (total number of micro-stem tips that germinated into seedlings / total number of inoculated micro-stem tips) × 100%;
[0057] Virus-free rate (%) = (total number of virus-free tissue culture seedlings / total number of tested tissue culture seedlings) × 100%;
[0058] Virus-free seedling rate (%) = seedling rate × virus-free rate.
[0059] 3.2 Explant disinfection
[0060] On a sunny afternoon during the passion fruit growing season (March to September), cut the young branches of the current year from the passion fruit plants with good growth conditions, close to the main vine, and remove the leaves. Cut the branches to about 6 cm and use them as explant materials. Soak the explants in a 500-fold carbendazim solution for 30 minutes, then rinse with running water for more than 3 hours. Transfer the explants to a clean bench, first immerse them completely in 75% alcohol for 30 seconds, then wash them three times with sterile water, each time for more than 2 minutes. Use 20% NaClO as a disinfectant and disinfect for 10 minutes. After disinfection, rinse with sterile water three times, each time for more than 2 minutes. During the process, shake the bottle containing the explants continuously. After the end, use filter paper to absorb the moisture on the surface of the explants.
[0061] 3.3 Chemical treatment and detoxification of passion fruit
[0062] Different concentrations of dihydroquercetin (see Table 3) were added to MS medium, and 6-9 cm tall passion fruit tissue culture seedlings were transferred to this medium. 0.5-1 mm shoot tips were excised 21 days after inoculation. Untreated micro-shoot tips served as blank controls (CKs). MS supplemented with 1 mg / L 6-BA and 0.3 mg / L NAA was used as the micro-shoot tip induction medium. Thirty micro-shoot tips were inoculated per treatment, replicated three times. Sixty days after inoculation, the seedling survival rate, TeMV and EAPV virus-free rates, and virus-free seedling rate were analyzed.
[0063] The results are shown in Table 3. Among all treatment groups, there was no significant difference in the seedling rate compared with the blank control. When the concentration of dihydroquercetin was 50 mg / L, the virus-free seedling rates of TeMV and EAPV were 21.09±4.28% and 19.85±2.24%, respectively, which were significantly higher than the blank treatment. Therefore, the best virus-free treatment was the H3 treatment group.
[0064] Table 3 Effects of different dihydroquercetin addition concentrations on seedling rate, virus-free rate and virus-free seedling rate
[0065]
[0066]
[0067] 4Construction of PeduCYP75B eukaryotic expression vector
[0068] The nucleotide sequence of passion fruit PeduCYP75B is as follows:
[0069] PeduCYP75B14 gene:
[0070]
[0071] PeduCYP75B24 gene:
[0072]
[0073] PeduCYP75B37 gene:
[0074] ATGATTTATTATGAACATGTGGGTTCTGGTGGTAGACTGAAAATCCTTATGGAGAGGATGGTAGACGTAGCAGGTAGCACAAATATTGCAGACTTTTATCCGTTTCTTGCTGGAGTAGATCCACAGGGGATAAGAGGAGAGATGAGAAGGCTTATTGATGAAATGTATGAAGCATGGGAAGATGAAGTCAAAGCAAGAAGAGCATGTCGAGACAATGGTGCTCCTAAGAGAGACCTTTTGGATTCTTTTCTGGAGAATGGATTTGATAACGATCATATCAATTGGTTAACACTTGAGTTACTAATTGCAGGTTCAGACACTACAATTGCAACAGTAGAATGGGCAATGAAACAAACAAGTCCTGGACAAGGTATGCGAAGAGCTAGCACGGAAATGGACGACCAAAACCAGATGAAAGAGTCTCGTATCTCTCAACTTCCATATTTACATGCTTGTGTGAAGGAAACACTAAGACTGCATCCACCAACACCATTACTTGATCCTCGTCGAGCCACCGATTCATGTGAAGTCATGAACTATACAATTCCGAGAGAAACTCAGATATTCATAAACGTCTGGGCTATGGGACGTGACCCTTCAGTATGGGAGGATCCATTATCGTTCAAGCCCGAGAGGTTTCTTAGCTCAAACATGGATTACAAAGGCCAGCACTATGAGTTCTTACCTTTCGGTGGAGGAAGAAGGATTTGCCCAGGATTGAATATGACTCCCTCCTTGTTGCATTATTTTGATTGGTCTCTGCCAAATGGGGAAGATCCTTCAAAGCTGGACATGAAGGAAAAATTTGGAGTGATATTGCAGAAGGAACAGCAGCTGCTTCTTGTTCCCAACAAAAGATCTTGA (SEQ ID NO.7).
[0075] 4.1 Gene cloning
[0076] The eukaryotic expression vector was constructed using homologous recombination. Based on the sequence information of the candidate gene and the vector, full-length cloning primers for the PeduCYP75 gene were designed using the Vazyme online primer design tool (https: / / crm.vazyme.com / cetool / singlefragment.html).
[0077] Table 4 Primers for full-length cloning of PeduCYP gene
[0078]
[0079]
[0080] Note: The lowercase part is the homology arm.
[0081] The gene was amplified using passion fruit cDNA as a template. The reaction system and PCR program are shown in Tables 5 and 6.
[0082] Table 5 Reaction system
[0083]
[0084] Table 6 PCR program
[0085]
[0086] Note: The reaction was performed for 32 cycles.
[0087] 4.2 Expression vector construction
[0088] The eukaryotic expression vector pYES2-NT-C was double-digested with BamH I and EcoR I. The enzyme digestion system is shown in Table 7. The double-digestion products were identified by gel electrophoresis, and the linearized vector was recovered and purified.
[0089] Table 7 Enzyme digestion system
[0090]
[0091] The cloning product was connected to the linearized vector. The reaction system was as follows: 2 μL of linearized vector, 0.5 μL of target gene fragment, 2.5 μL of ligase, and ligation at 50°C for 5 min. Escherichia coli DH5α was thawed on ice, 2.5 μL of ligation product was added, and the mixture was mixed by flicking. The cells were allowed to stand on ice for 30 min, followed by heat shock at 42°C for 45 s. The cells were quickly placed on ice and allowed to stand for 2 min. 600 μL of liquid LB medium (without antibiotics) was added and cultured at 37°C at 300 rpm for 45 min. 80 μL of bacterial solution was evenly spread on solid LB medium containing the corresponding antibiotics and cultured in a 37°C incubator overnight. Single clones were picked for colony PCR verification, single clones containing the target bands were expanded, and plasmids were extracted for double enzyme digestion and sequencing verification.
[0092] The results are as follows Figure 1 As shown, the recombinant plasmid was double-enzyme digested with BamH I and EcoR I to verify the results. Electrophoresis showed single bands at 1500 bp and 800 bp, which was consistent with the size of the candidate gene. The sequencing results were consistent with the CDS sequence of the candidate gene, indicating that the eukaryotic expression vectors pYES2-NT-C-PeduCYP75B14, pYES2-NT-C-PeduCYP75B24 and pYES2-NT-C-PeduCYP75B37 were successfully constructed.
[0093] 5. Verification of catalytic activity
[0094] 5.1 Induced expression and extraction of recombinant protein
[0095] (1) The recombinant plasmid was transformed into the competent yeast WAT11, and the positive clones in the SG-Ura medium were selected and inoculated into 20 mL of SD / -Ura liquid medium. The culture was shaken at 30°C and 280 rpm overnight.
[0096] (2) Collect the cells by centrifugation at 1500 g for 5 min at 4°C, resuspend the pellet in 500 mL of SG / -Ura liquid medium, and continue to culture overnight under the same conditions;
[0097] (3) Collect the cells by centrifugation at 1500 g for 5 min at 4°C, resuspend them in TEK buffer, let them stand at room temperature for 5 min, centrifuge them at 1500 g at 4°C, discard the supernatant, and resuspend the cell pellet in 2.5 mL of TESB buffer;
[0098] (4) Add 0.5 mm acid-washed glass beads until the cells are completely covered, and use a fully automatic tissue rapid grinder to grind them (30 Hz, 30 s / time). After a 1 min ice bath, repeat the operation 30 times.
[0099] (5) Add 5 mL of TESB buffer to wash the glass beads, repeat the wash three times, and combine the eluates;
[0100] (6) Centrifuge at 12,000 g for 10 min at 4°C and collect the supernatant;
[0101] (7) Dilute the sample to 3 times its volume with TESB buffer;
[0102] (8) Add NaCl and PEG4000 to a final concentration of 0.15 M and precipitate on ice for 15 min;
[0103] (9) Centrifuge at 12,000 g for 10 min at 4°C to collect the precipitate, resuspend in TEG buffer, and aliquot into 1.5 mL centrifuge tubes. Store at -80°C until use.
[0104] 5.2 Western blot detection of recombinant protein
[0105] (1) Take 50 μL of extracted recombinant protein and mix with 150 μL of loading buffer, incubate in a 100°C metal bath for 15 min, and store at -80°C until use;
[0106] (2) The treated protein sample was aspirated and subjected to SDS-PAGE gel electrophoresis at 90 V until the sample formed a straight line in the stacking gel, and then at 120 V until the sample approached the bottom;
[0107] (3) Take a PVDF membrane of appropriate size for transfer. The PVDF membrane needs to be soaked in methanol before use. The transfer conditions are 400 mA for 25 min.
[0108] (4) After transfer, the PVDF membrane was placed in the prepared skim milk powder and blocked at room temperature for 2 h;
[0109] (5) The PVDF membrane was incubated in the primary antibody solution (1:5000) at room temperature for 2 h. After the incubation, it was washed three times with 1× TBST for 10 min each time.
[0110] (6) The PVDF membrane was placed in the secondary antibody solution (1:8000) and incubated at room temperature for 1 h. After incubation, it was washed three times with 1× TBST, each time for 10 min. The developer was added and photographed.
[0111] The results are as follows Figure 2 As shown, single bands appeared at 50 KDa and 30 KDa, which were consistent with the expected sizes, indicating that PeduCYP75B14, PeduCYP75B24 and PeduCYP75B37 were successfully expressed in recombinant yeast.
[0112] 5.3 In vivo catalytic experiments in recombinant yeast
[0113] (1) Pick a positive single clone of recombinant yeast from the SD / -Ura culture plate, take a 50mL centrifuge tube, add 30mL SD / -Ur-a + 20g / L glucose liquid medium, and culture at 30℃ 250rpm shaking until OD 600 =0.6;
[0114] (2) Centrifuge at 700 g for 5 min at room temperature to collect the cells, discard the supernatant, and add 30 mL of SD / -Ur-a + 20 g / L galactose liquid medium to resuspend the cells. 600 Adjust to 0.4;
[0115] (3) Take 2 mL of the prepared culture medium into a 10 mL centrifuge tube, add filter-sterilized 1 mM NADPH and 20 μg / mL dihydrokaempferol, and culture overnight at 16°C and 250 rpm for 12 h;
[0116] (4) Add 2 mL of ethyl acetate to stop the reaction, vortex to mix, centrifuge at room temperature, and remove the supernatant into a new centrifuge tube.
[0117] (5) Repeat step 4;
[0118] (6) The organic phase was collected by evaporation in a vacuum rotary evaporator at 50 rpm and 30-35 °C, and 150 μL of chromatographic grade methanol was added to redissolve it. The product was filtered through a 0.22 μm organic filter membrane and then used for LC-MS product detection and analysis.
[0119] The results are as follows Figure 3 As shown, the LC-MS / MS liquid phase spectra showed that the catalytic products of PeduCYP75B14, PeduCYP75B24 and PeduCYP75B37 recombinant yeasts were catalyzed under three daughter ion conditions (the three ion conditions were: Q1 / Q3 = 303.2 / 284.7, Q1 / Q3 = 303.2 / 176.8, Q1 / Q3 = 303.2 / 124.7; the three ion conditions were Figure 3 The corresponding relationships of green, blue and red colors are green: Q1 / Q3 = 303.2 / 284.7; blue: Q1 / Q3 = 303.2 / 176.8; red: Q1 / Q3 = 303.2 / 124.7). Dihydroquercetin signals were detected in all of them. This result indicates that PeduCYP75B14, PeduCYP75B24 and PeduCYP75B37 have F3'H activity and can catalyze the hydroxyl substitution at the 3' position of the B ring of dihydrokaempferol to generate dihydroquercetin.
[0120] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.
Claims
1. Application of dihydroquercetin in the preparation of passion fruit detoxification preparation.
2. Application of the PeduCYP75B gene in cultivating virus-resistant passion fruit varieties, characterized in that: The gene is used to increase the synthesis of dihydroquercetin, and the PeduCYP75B gene is selected from the PeduCYP75B14 gene with a nucleotide sequence as shown in SEQ ID NO.5, the PeduCYP75B24 gene with a nucleotide sequence as shown in SEQ ID NO.6, or the PeduCYP75B37 gene with a nucleotide sequence as shown in SEQ ID NO.
7.
3. The use according to claim 2, characterized in that The PeduCYP75B gene encodes a protein with F3'H enzyme activity.
4. The use according to claim 2, characterized in that The viruses include tuberose mosaic virus and / or East Asian passionflower virus.
5. A method for detoxifying passion fruit, characterized in that: The method comprises the steps of inoculating passion fruit explants into a culture medium supplemented with dihydroquercetin for culturing.
6. The detoxification method according to claim 5, characterized in that: The explant is a micro-stem tip.
7. The detoxification method according to claim 5, wherein: The culture time is 60 days.
8. A culture medium for passion fruit detoxification, characterized in that, Contains basal medium and dihydroquercetin.
9. The culture medium according to claim 8, characterized in that The basal culture medium includes MS medium.
10. The culture medium according to claim 8, characterized in that The concentration of the dihydroquercetin is 5-60 mg / L.
Citation Information
Patent Citations
Method for cultivating passion fruit virus-free seedlings
CN105706935A
Method for cultivating detoxified mint
CN107646680A
Detoxification method of passion fruits
CN117084171A
Cosmetic composition for containing callus and culture media mixture comprising the same
KR1020130083330A
Antiviral Activity from Medicinal Mushrooms and their Active Constituents
US20160000754A1