Method for synthesizing D-chiro-inositol through biotransformation and synthetic strain thereof

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a method for synthesizing D-chiro-inositol through biotransformation and a synthetic strain of the D-chiro-inositol, and the strain is obtained by co-expressing an inositol dehydrogenase iolG gene and a myose isomerase iolI gene from bacillus subtilis in escherichia coli; according to the invention, a key enzyme inositol dehydrogenase is further modified to construct an inositol dehydrogenase mutant Q122V / D187Y, and the inositol dehydrogenase mutant Q122V / D187Y is obtained by mutating glutamine at the 122th site of inositol dehydrogenase iolG into valine and mutating aspartic acid at the 187th site of inositol dehydrogenase iolG into tyrosine. The strain co-expressed by the inositol dehydrogenase iolG mutant Q122V / D187Y and the inositol isomerase iolI is used for whole-cell transformation of D-chiral inositol, the DCI yield reaches 24.1 g / L within the production period of 4 h, and the production rate is 6.025 g / L / h.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to a method for synthesizing D-chiro-inositol through biotransformation and a synthetic strain thereof. Background Art

[0002] Inositol, also known as cyclohexanehexol, is widely distributed in plants, animals, and microorganisms and is a key factor in animal and microbial processes. Inositol has nine stereoisomers, of which D-chiro-inositol (DCI) occurs naturally as a compound in plants such as buckwheat and carob, as well as insects. DCI has numerous important physiological functions and holds promising applications in medicine and healthcare. Research indicates that market demand for DCI is growing at an annual rate of 15%, and the global market size is expected to exceed US$350 million in 2024.

[0003] Currently, DCI preparation methods have numerous shortcomings. Plant extraction, from buckwheat or carob, has an extraction efficiency of only 0.2%-0.5%, resulting in product purity below 90%, low production capacity, and high costs. Chemical synthesis, produced through hydrochloric acid hydrolysis of D-pinitol or kasugamycin, uses expensive raw materials such as D-pinitol and kasugamycin. Furthermore, the strong acid and base reactions involved in this method require high equipment requirements and are less economical.

[0004] During biosynthesis, myo-inositol (MI) can be converted to DCI through a three-step reaction under the action of inositol dehydrogenase (iolG) and 2-keto-myo-inositol isomerase (iolI). First, iolG oxidatively dehydrogenates MI to form 2-keto-myo-inositol (2KMI). Then, iolI isomerizes 2KMI to 1-keto-D-chiro-inositol (1KDCI). Finally, iolG reduces 1KDCI to DCI.

[0005] With the development of bioengineering technology, the use of microbial conversion to synthesize DCI is currently a relatively economical and environmentally friendly production method. However, existing biological methods generally have low yields, long reaction times (usually requiring around 48 hours), and production rates generally range from 0.3 to 1.7 g / L / h.

[0006] Prior art CN119799803A utilizes whole cells expressing mutant scyllo-inositol dehydrogenase and thermostable mutant myo-inositol dehydrogenase to synthesize epi-inositol from myo-inositol in a two-step cascade catalytic process. This method differs from previously reported methods for synthesizing scyllo-inositol and D-chiro-inositol. In the process of synthesizing epi-inositol using myo-inositol as a substrate, the C4 position of myo-inositol must be dehydrogenated and then hydrogenated to achieve chirality inversion. Because both the substrate and product structures are very symmetrical, enzymes often have difficulty specifically recognizing them during the catalytic process. Therefore, the synthesis of different chiral compounds of inositol has long been a major challenge in the field of biocatalysis. This enzyme modification increased the yield of epi-inositol to 1.89 g / L, with a conversion rate of 52.6%, both of which are currently the highest levels reported.

[0007] Prior art CN119842646A mutates scyllo-inositol dehydrogenase to obtain the beneficial mutant C261R, which is then coupled with a heat-resistant myo-inositol dehydrogenase to efficiently catalyze the synthesis of epi-inositol, belonging to the field of biocatalytic engineering. This novel pathway for the synthesis of epi-inositol is completely different from previously reported methods for synthesizing scyllo-inositol and D-chiro-inositol. It starts with myo-inositol, first dehydrogenating the C4 position of myo-inositol to form a ketone intermediate, followed by hydrogenation to invert the chirality of the hydrogen at the C4 position, to obtain the final product, epi-inositol. The obtained epi-inositol yield is 1.39 g / L, with a conversion rate of 38.7%.

[0008] Prior art CN118028322A overexpresses different inositol isomerase genes, iolIn, and inositol dehydrogenase genes, iolG, in Corynebacterium glutamicum, achieving the conversion of myo-inositol (MI) to DCI with a conversion rate of 16%. Building on this, the present invention uses a bacterium co-expressing iolI2 and iolG for whole-cell conversion of D-chiro-inositol. By optimizing the conversion process conditions, such as temperature, pH, and MI concentration, the present invention increases the conversion rate to 17%-28% and the yield to approximately 7g / L.

[0009] Studies have shown that the reaction catalyzed by myo-inositol dehydrogenase is the rate-limiting step in the entire pathway, so screening efficient myo-inositol dehydrogenase has become critical to increasing DCI production. Summary of the Invention

[0010] To increase the yield of D-chiro-inositol and rapidly obtain DCI, the present invention provides a strain that co-expresses a mutant of myo-inositol dehydrogenase (iolG) and inositol isomerase (iolI) derived from B. subtilis. Whole cells of this strain catalyze the conversion of myo-inositol (MI) to produce DCI. This method increases yield while significantly shortening the DCI synthesis process time. The production rate is significantly higher than existing technologies, reducing production costs. Furthermore, this method is simple, economical, and environmentally friendly.

[0011] To achieve the above objectives, the present invention discloses the following technical solutions: In the first aspect, the present invention provides an inositol dehydrogenase mutant Q122V / D187Y, wherein the inositol dehydrogenase mutant is synthesized by Bacillus subtilis The inositol dehydrogenase iolG is obtained by modifying the source, specifically by mutating the glutamine at position 122 to valine and the aspartic acid at position 187 to tyrosine.

[0012] The nucleotide sequence of the inositol dehydrogenase mutant Q122V / D187Y is shown in SEQ ID NO.1.

[0013] In a second aspect, the present invention provides a recombinant plasmid comprising an inositol dehydrogenase mutant Q122V / D187Y gene and an inositol isomerase gene.

[0014] The nucleotide sequence of the inositol isomerase iolI is shown in SEQ ID NO.2.

[0015] In a third aspect, the present invention provides a recombinant cell, characterized in that it contains the recombinant plasmid described in the second aspect.

[0016] Preferably, the recombinant cell is selected from a prokaryotic cell or a eukaryotic cell.

[0017] In a fourth aspect, the present invention provides a method for preparing D-chiro-inositol, comprising: using the cells described in the third aspect to catalyze the reaction of myo-inositol.

[0018] The reaction is carried out at a pH of 6.0-8.0 and a temperature of 30-50° C. Under these conditions, the inositol dehydrogenase mutant Q122V / D187Y and the inositol isomerase iolI in the recombinant cells work synergistically to convert myo-inositol into D-chiro-inositol.

[0019] In a fifth aspect, the present invention provides an application of the inositol dehydrogenase mutant, recombinant plasmid, recombinant cell and preparation method according to the first, second and third aspects in the production of D-chiro-inositol or a product containing D-chiro-inositol.

[0020] The present invention also provides an inositol isomerase iolI, the nucleotide sequence of the inositol isomerase iolI is shown in SEQ ID NO: 2, specifically: .

[0021] Compared with the prior art, the present invention has at least the following beneficial effects: The present invention provides a strain that co-expresses the inositol dehydrogenase iolG mutant Q122V / D187Y and the inositol isomerase iolI, which is used for the whole-cell conversion of D-chiro-inositol. Within a 4-hour production cycle, the DCI yield reaches 24.1 g / L, and the production rate is 6.025 g / L / h, which is much higher than the existing technology.

[0022] The present invention effectively solves the problems of high reaction temperature, low yield and long conversion time in existing DCI production methods, improves the yield of DCI, greatly shortens the process time of DCI synthesis, reduces production costs, and also has the advantages of simple production process, green economy and environmental protection, providing a more advantageous technical solution for the industrial production of DCI. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 : pACYCDuet-1-BsiolG+BsiolI plasmid map; Figure 2 : HPLC analysis of DCI and MI. DETAILED DESCRIPTION

[0024] In order to make the technical problems, technical solutions and advantages to be solved by the present invention clearer, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.

[0025] The materials used in the embodiments of the present invention include: Escherichia coli ( Escherichia coli ) strain BL21 (DE3), the gene was synthesized by Beijing Qingke Biotechnology Co., Ltd.; PCR polymerase, restriction endonuclease, modification enzyme and other reagents were purchased from Dalian TaKaRa Co., Ltd.; myo-inositol was purchased from Bohaoda Co., Ltd.; D-chiro-inositol was purchased from Maclean Co., Ltd.

[0026] LB medium: peptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L.

[0027] Fermentation medium: potassium dihydrogen phosphate 13.4 g / L, ammonium sulfate 4 g / L, citric acid 1.8 g / L, defoamer 300 μL / L, glucose 10 g / L, magnesium sulfate heptahydrate 0.6 g / L, trace element I 10 mL / L, chloramphenicol 50 mg / L; Fermentation feed: glucose 600 g / L, magnesium sulfate heptahydrate 0.8 g / L, trace element II 10 mL / L; Table 1 Components of trace elements

[0028] SEQ ID NO: 2: ATGAAACTTTGTTTTAATGAAGCGACAACATTGGAAAACTCAAACCTTAAACTGGATTTAGAACTATGCGAAAAGCATGGCTATGATTATATTGAAATCCGTACTATGGATAAGCTGCCGGAGTACTTAAAAGATCATTCATTGGATGACCTTGCGGAATATTTTCAAACCCACCACATCAAACCGCTTGCCTTAAACGCACTCGTTTTCTTCAACAACCGTGATGAAAAGGGTCACAACGAGATCATCACTGAATTTAAAGGCATGATGGAAACATGCAAAACCCTCGGTGTGAAATATGTGGTGGCCGTTCCGCTTGTGACAGAGCAGAAGATTGTAAAAGAAGAGATCAAAAAGAGCAGTGTAGACGTGCTGACTGAGCTGTCAGATATCGCGGAGCCGTACGGCGTAAAAATCGCGCTTGAGTTTGTCGGCCATCCGCAATGTACGGTCAATACGTTTGAACAGGCGTATGAGATTGTAAACACAGTTAACCGTGACAATGTCGGGCTTGTCCTTGACAGTTTTCACTTCCATGCAATGGGTTCAAATATTGAGAGCTTAAAGCAGGCGGACGGAAAGAAAATCTTCATCTATCATATTGATGATACAGAAGATTTCCCAATCGGCTTTTTAACAGATGAGGATCGTGTATGGCCGGGACAAGGGGCAATTGACTTAGATGCCCACTTATCAGCACTGAAGGAAATCGGCTTCTCTGATGTTGTTTCGGTTGAGCTCTTCCGGCCTGAATACTATAAGCTGACTGCTGAGGAAGCCATTCAAACAGCGAAAAAAACAACAGTGGATGTCGTATCAAAATACTTCAGCATGTAA。

[0029] Example 1: Whole gene synthesis of pACYCDuet-1-BsiolG + BsiolI gene Entrusted Tsingke Biological Company to obtain, by means of whole gene synthesis, the Bacillus subtilis The inositol dehydrogenase gene iolG (GeneID: 937615) and the inositol isomerase gene iolI (GeneID: 937582) were cloned and the iolG gene was connected between the PstI and HindIII restriction sites in the MCS1 region of the vector pACYCDuet-1, and the iolI gene was connected between the NdeI and XhoI restriction sites in the MCS2 region of the vector pACYCDuet-1 to form the recombinant plasmid: pACYCDuet-1-BsiolG+BsiolI ( Figure 1 ).

[0030] Example 2: Obtaining the inositol dehydrogenase mutant Q122V / D187Y The Q122V / D187Y gene is modified by mutating the glutamine at position 122 of the inositol dehydrogenase gene iolG to valine and the aspartic acid at position 187 to tyrosine. The nucleotide sequence is shown in SEQ ID NO. 1. The specific steps are as follows: (1) Using pACYCDuet-1-BsiolG+BsiolI in Example 1 as a template, an inverse PCR reaction was performed using the primers in Table 2. The PCR system is shown in Table 3, and the PCR conditions are shown in Table 4.

[0031] Table 2. Primers required for PCR Primer name Primer sequences Q122V-F CGCCTTGTTGTTGTCGGCT Q122V-R TGAAGCCGACAACAACAAGGC D187Y-F GGCTCGTCAATTACGACTACGAG D187Y-R GACTCGTAGTCGTAATTGACGAGC Table 3. PCR reaction system Reaction system volume Q122V-F 0.5 µL Q122V-R 0.5 µL D187Y-F 0.5 µL D187Y-R 0.5 µL Template plasmid 1 µL 2*PCR polymerase 12.5µL ddH2O 9.5µL Total volume 25 µL Table 4. PCR reaction conditions PCR steps PCR conditions Pre-denaturation 98°C, 3 min98°C, 30 s annealing 58°C, 30 seconds (denaturation, annealing; 30 cycles) Extended cryopreservation 72℃, 1 min4℃, forever (2) The above PCR products were tested by gel electrophoresis. Then, 1 μL of Dpn I restriction endonuclease was added to 20 μL of PCR products to digest the template plasmid and incubated at 37°C for 1 h.

[0032] (3) 5 μL of the product from step (2) was aspirated and transformed into Escherichia coli BL21 (DE3) to obtain the corresponding recombinant Escherichia coli, which was then spread on LB plates containing chloramphenicol (50 mg / L) and cultured overnight at 37°C. Clones were randomly picked for colony PCR identification and sequencing verification. The results showed that the recombinant expression vector containing the gene encoding the inositol dehydrogenase mutant was successfully transformed into the expression host Escherichia coli BL21 (DE3). The strain that was successfully mutated was verified by sequencing by Beijing Qingke Biotechnology Co., Ltd. as the recombinant strain containing the mutant and was named Q122V / D187Y.

[0033] Example 3. Induced expression of recombinant strains and cell preparation A single colony of the recombinant mutant Q122V / D187Y constructed in Example 2 was picked and inoculated into 10 mL of LB medium (containing 50 mg / L chloramphenicol). Culture was shaken at 37°C overnight. The next day, a 1% inoculum was transferred to 50 mL of LB medium (containing 50 mg / L chloramphenicol). Culture was performed at 37°C for 2-3 hours, followed by induction with 0.5 mM IPTG at 25°C for 12-24 hours. The cells were then centrifuged at 8000 rpm for 10 minutes at 4°C to harvest for subsequent reactions.

[0034] Example 4: Optimization of Whole-cell Catalytic Conversion of D-Chiro-Inositol The catalytic reaction was performed using the Q122V / D187Y cells collected in Example 3. A 5 ml system contained 200 g / L myo-inositol and 50 mM HEPES buffer. After dissolution, the pH was adjusted to 7.0 using sodium hydroxide. Then, 100 g / L of cells was added. The cells were incubated at 45°C and 200 rpm for 12 hours. Samples were collected and the reaction was terminated by centrifugation. The product was analyzed by HPLC.

[0035] HPLC detection conditions: chromatographic column: amino column (4.6×150 mm, 3.5 μm); mobile phase: 80% acetonitrile: 20% water; flow rate: 2 mL / min isocratic elution; column temperature: 40°C; injection volume: 10 ul; detector: differential detector.

[0036] Table 5. Catalytic results of shake flasks strain wild type Mutant Q122V / D187Y DCI yield (g / L) 16 20.3 The results are shown in Table 5. The yield of the mutant increased by 26.88% compared with the wild type.

[0037] The wild type refers to Escherichia coli containing the original nucleotide sequence of the iolG gene and the iolI gene derived from Bacillus subtilis.

[0038] Example 5: Optimization of enzyme production and whole-cell catalytic process in 5 L fermenter 1. Preparation of Whole-cell Catalysts (1) Primary seed solution: Pick a single colony of Q122V / D187Y from the plate and place it in 5 mL of LB liquid medium (containing 50 mg / L chloramphenicol) and culture at 37°C and 180 rpm for 8-12 h.

[0039] (2) Secondary seed solution: The mutant Q122V / D187Y was inoculated into 200 mL LB (containing 50 mg / L chloramphenicol) at a ratio of 1‰ (v / v) and cultured at 37°C, 200 rpm for 10 h.

[0040] (3) Fermentation in a fermenter: The freshly cultured secondary seed liquid was inoculated at a volume concentration of 5% into a fermentation medium containing a 0.05% defoamer and 50 mg / L chloramphenicol. The temperature was controlled at 37°C, the dissolved oxygen (DO) was controlled to be greater than 20%, and the fermentation pH was controlled at 6.5 using 25% ammonia water. When the OD600 reached about 10, the dissolved oxygen was monitored. When the dissolved oxygen rose rapidly (to 70), sugar was added and 6 g / L of feed was automatically added. When the OD600 reached 20, the fermenter temperature was adjusted to 25°C. After cooling, the sugar addition rate was reduced, and 0.5 M IPTG was added for induction. The culture was continued for 18 h to obtain the fermentation broth. The cells were collected by centrifugation at 8000 rpm for 10 min for subsequent reactions.

[0041] 2. Whole-cell catalyst for DCI biotransformation The catalytic reaction was performed using the cells collected above. A 3 L system included: 200 g / L myo-inositol, 50 mM HEPES buffer, which was dissolved and adjusted to pH 7.0 using sodium hydroxide. 100 g / L of cells was added and the reaction was incubated at 45°C and 200 rpm for 4 h. Samples were collected and the reaction was terminated by centrifugation. The product was detected by HPLC ( Figure 2 ), the concentration of DCI catalytically generated was 24.1 g / L, and the production rate was 6.025 g / L / h.

[0042] The choice of host cells is not limited to E. coli; other suitable prokaryotic or eukaryotic cell systems can also be used to adapt to different production requirements and conditions. By using the Q122V / D187Y mutant of the present invention, the industry can produce DCI more efficiently and rapidly, thereby meeting the growing market demand for DCI, particularly in the functional food sector.

[0043] The above is a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. An inositol dehydrogenase mutant Q122V / D187Y, characterized in that: The inositol dehydrogenase mutant is obtained by mutating the glutamine at position 122 in the inositol dehydrogenase iolG to valine and the aspartic acid at position 187 to tyrosine; the nucleotide sequence of the inositol dehydrogenase mutant Q122V / D187Y is shown in SEQ ID NO.

1.

2. A recombinant plasmid carrying the inositol dehydrogenase mutant gene according to claim 1.

3. The recombinant plasmid according to claim 2, characterized in that The recombinant plasmid contains the inositol dehydrogenase mutant Q122V / D187Y gene and the inositol isomerase gene.

4. The recombinant plasmid according to claim 3, characterized in that The nucleotide sequence of the inositol isomerase iolI is shown in SEQ ID NO.

2.

5. A recombinant cell, characterized in that Contains the recombinant plasmid according to claim 3.

6. The recombinant cell according to claim 5, characterized in that The cell is selected from a prokaryotic cell or a eukaryotic cell.

7. A method for preparing D-chiro-inositol, characterized in that: The recombinant cells according to claims 5-6 catalyze myo-inositol to produce D-chiro-inositol.

8. Use of the inositol dehydrogenase mutant gene according to claim 1, or the recombinant plasmid according to any one of claims 2 to 4, or the recombinant cell according to claim 5, or the method according to claim 6 in the production of D-chiro-inositol or a product containing D-chiro-inositol.

Images